Printer Friendly
The Free Library
5,669,957 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Global emergence of trimethoprim/sulfamethoxazole resistance in stenotrophomonas maltophilia mediated by acquisition of sul genes.


Trimethoprim/sulfamethoxazole (TMP/SMX) resistance remains a serious threat in the treatment of Stenotrophomonas maltophilia Stenotrophomonas maltophilia is an aerobic, nonfermentative, Gram-negative bacterium which cause uncommon but difficult to treat infections in humans.[1] Initially classified as Pseudomonas maltophilia, S.  infections. We analyzed an international collection of 55 S. maltophilia TMP/SMX-sensitive (S) (n = 30) and -resistant (R) (n = 25) strains for integrons; Sul1, sul2 and dhfr genes; and insertion element common region (ISCR ISCR Investor Summit on Climate Risk ) elements, sul1, as part of a class 1 integron, was detected in 17 of 25 TMP/SMX-R. Nine TMP/SMX-R strains carried sul2; 7 were on large plasmids. Five TMP/SMX-R isolates were positive for ISCR2, and 4 were linked to sul2; 2 others possessed ISCR3. Two ISCR2s were adjacent to floR. Six TMP/SMX-S isolates harbored novel ISCR elements, ISCR9 and ISCR10. Linkage of ISCR3, ISCR9, and ISCR10 to sul2 and dhfr genes was not demonstrated. The data from this study indicate that class 1 integrons and ISCR elements linked to sul2 genes can mediate TMP/SMX resistance in S. maltophilia and are geographically widespread, findings that reinforce the need for ongoing resistance surveillance.

**********

Nosocomial nosocomial /noso·co·mi·al/ (nos?o-ko´me-il) pertaining to or originating in a hospital.

nos·o·co·mi·al
adj.
1. Of or relating to a hospital.

2.
 Stenotrophomonas maltophilia are intrinsically resistant to a plethora of antimicrobial agents Antimicrobial agents

Chemical compounds biosynthetically or synthetically produced which either destroy or usefully suppress the growth or metabolism of a variety of microscopic or submicroscopic forms of life.
 that severely limit commonly used empiric standard antimicrobial therapies. S. maltophilia is resistant to many [beta]-lactams, [beta]-lactamase inhibitors, and aminoglycosides (1,2). A recent survey of SENTRY (www.jmilabs.com) Antimicrobial Surveillance Program isolates indicated that the newer fluoroquinolones demonstrated good efficacy; the most active were levofloxacin (6.5% resistance) and gatifloxacin (14.1%) (3). Furthermore, the resistance to the polymyxins (20%-32%) is higher than observed in Pseudomonas aeruginosa Pseudomonas aeruginosa A normal soil inhabitant and human saprophyte that may contaminate various solutions in a hospital, causing opportunistic infection in weakened Pts Clinical Infective endocarditis in IVDAs, RTIs, UTIs, bacteremia, meningitis, 'malignant'  (3,4). Because of low resistance levels ([approximately equal to] 5%), trimethoprim/sulfamethoxazole (TMP/ SMX SMX Search Marketing Expo
SMX Sulfamethoxazole
SMX Server Macro Expansion
SMX Santa Maria, CA, USA - Santa Maria Public Airport (Airport Code)
SMX SonicsMX
SMX Smithway Motor Xpress, Inc.
) remains the therapy of choice worldwide. A recent study encompassing data from Europe, Latin America, and North America indicates that the level of resistance to TMP/SMX is 3.8%; however, previous studies indicate that the level is higher in Latin America than North America (5,6). Although surveillance studies are few, resistance to TMP/SMX appears to be emerging, and recent in vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment.

in vi·tro
adj.
In an artificial environment outside a living organism.
 modeling studies have shown that combination therapies of TMP/SMX plus ciprofloxacin ciprofloxacin /cip·ro·flox·a·cin/ (sip?ro-flok´sah-sin) a synthetic antibacterial effective against many gram-positive and gram-negative bacteria; used as the hydrochloride salt.

cip·ro·flox·a·cin
n.
 and TMP/SMX plus tobramycin tobramycin /to·bra·my·cin/ (to?brah-mi´sin) an aminoglycoside antibiotic derived from a complex produced by Streptomyces tenebrarius,  exhibit a greater killing capacity then TMP/SMX alone (7,8).

S. maltophilia exhibits an array of mechanisms that singularly or collectively contribute to its multidrug resistance multidrug resistance,
n the adaptation of tumor cells or infectious agents to resist chemotherapeutic agents.
 status. Intrinsic resistance includes inducible efflux efflux Medtalk That which flows outward  pumps (2) and multiple [beta]-lactamase expression (1) but not mutations in the quinolone resistance-determining region (9). In addition, S. maltophilia can acquire resistance through integrons, transposons Transposons

Types of transposable elements which comprise large discrete segments of deoxyribonucleic acid (DNA) capable of moving from one chromosome site to a new location.
, and plasmids (10). Recently, class 1 integrons have been characterized from S. maltophilia strains isolated in Argentina and Taiwan, which indicates that they contribute to TMP/SMX resistance through the sul1 gene carried as part of the 3' end of the class 1 integron (10).

In addition to class 1 integrons, other mobile elements are associated with sul genes. For example, Vibrio cholerae Vibrio chol·er·ae
n.
A bacterium that causes Asiatic cholera in humans; Koch's bacillus.


Vibrio cholerae Infectious disease The Vibrio
 serogroup 0139 is resistant to several antimicrobial agents, including SMX, and it has been recently shown that the sul2 gene was part of a cluster located on a novel genetic element of the integrative conjugative element group named SXT SXT Soft X-Ray Telescope
SXT Sensient Technologies Corp (stock symbol)
SXT Sulfamethoxazole-Trimethoprim
SXT Solar X-Ray Telescope (Launched in 1991 as a part of the Japanese Yokoh satellite) 
. The resistance genes harbored by SXT are embedded in a composite transposon-like structure and were probably acquired recently (11). Within this antimicrobial drug resistance region, an insertion element common region (ISCR) sequence, ISCR2, is adjacent to a sul2 gene that moves by 1-ended transposition transposition /trans·po·si·tion/ (trans?po-zish´un)
1. displacement of a viscus to the opposite side.

2.
. Thus, the possibility exists that sul2 genes can transfer intra- and inter-generically, including into S. maltophilia. Herein, we describe the molecular characterization of an international collection of S. maltophilia isolates and determine their mechanism of resistance to TMP/SMX, including the first report of sul2 genes and the first description of insertion element common region (ISCR) elements carried in S. maltophilia.

Methods and Materials

Bacterial Strains

During 1998-2003, a total of 1,744 S. maltophilia isolates collected worldwide were forwarded to the SENTRY Program (Europe, USA, and Australia) and tested for antimicrobial drug susceptibility. A TMP/SMX resistance phenotype was demonstrated for 71. From these isolates, 25 nonclonal strains from patients in North America, Latin America, and Europe were analyzed by using molecular methods together with 30 representative isolates that were TMP/SMX-susceptible. Isolates were identified by using the Vitek System and confirmed by using API20NE (bioMerieux, Hazelwood, MO, USA).

Susceptibility Methods

Isolates were tested for susceptibility to TMP/SMX according to procedures of the Clinical and Laboratory Standards Institute (CLSI CLSI Clinical and Laboratory Standards Institute (Wayne, PA)
CLSI Cisco Link Services Interface
, formerly the National Committee for Clinical Laboratory Standards [NCCLS NCCLS National Committee for Clinical Laboratory Standards ]) (12,13) by using broth microdilution methods (TREK Diagnostics, Cleveland, OH, USA). MIC results were confirmed with TMP/SMX. Etests were performed according to the manufacturer's directions (AB Biodisk, Solna, Sweden).

Molecular Materials

PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 primers were purchased from Sigma-Genosys Ltd. (Pampisford, UK) and are listed in the Table. General reagents for DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 manipulation were obtained from Invitrogen (Groningen, the Netherlands). All other reagents were obtained from Sigma Chemical Co. or BDH BDH Big Damn Hero (characters in TV show Firefly/Serenity)
BDH Brusthöhendurchmesser (German: Chest High Diameter, Forestry)
BDH Bund Deutscher Haarformer EV
 (both of Poole, England, UK).

Strain Typing

Clonality among the S. maltophilia isolates was assessed by pulsed-field gel electrophoresis (PFGE PFGE Pulsed-Field Gel Electrophoresis ) followed by XbaI digestion of genomic DNA. This assessment was conducted according to the standard 1-day protocol (16).

Plasmid Isolation

Bacterial plasmids were isolated by the alkaline lysis method described by Grinsted and Bennett (17). Essentially, an overnight 10-mL culture was centrifuged (12,000x g) and suspended in water (250 [micro]L) before 200 [micro]L of lysis lysis /ly·sis/ (li´sis)
1. destruction or decomposition, as of a cell or other substance, under influence of a specific agent.

2. mobilization of an organ by division of restraining adhesions.

3.
 solution (0.2 mol/L NaOH, 1% sodium dodecyl sulfate Sodium dodecyl sulfate (or sulphate) (SDS or NaDS) (C12H25NaO4S),is an anionic surfactant that is used in household products such as toothpastes, shampoos, shaving foams and bubble baths for its thickening effect and its ability to  [SDS 1. (company) SDS - Scientific Data Systems.
2. (tool) SDS - Schema Definition Set.
]) was added. After lysis, 125 [micro]L of neutralizing solution (0.3 mol/L potassium acetate potassium acetate

K-Vescent, K-Effervescent

Pharmacologic class: Mineral, electrolyte

Therapeutic class: Electrolyte replacement, nutritional supplement

Pregnancy risk category C

, 1 mmol/L EDTA EDTA: see chelating agents. ) was added. After precipitation, the suspension was centrifuged (12,000x g) and washed twice with 500 [micro]L of a 50/50 (v/v) phenol/chloroform solution. The DNA was precipitated from the solution with the addition of 0.7 volumes of iso-amyl alcohol. The DNA/RNA pellet was washed twice in 1 mL 70% ethanol before being dried. The DNA was dissolved in 30 [micro]L with 0.1 U RNase.

Southern Hybridization hybridization /hy·brid·iza·tion/ (hi?brid-i-za´shun)
1. crossbreeding; the act or process of producing hybrids.

2. molecular hybridization

3.
 

ISCR and sul2 PCR amplicons generated with primers CRF/CRFF-r were labeled with P[sup.32]-CTP by random primer extension by using a commercially available kit (Stratagene, Amsterdam, the Netherlands) according to the manufacturer's instructions. Unincorporated nucleotides were removed by passing the labeled DNA through a Sephadex column (Nick column, Pharmacia Bio-tech, Uppsala, Sweden).

Agarose agarose

more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments.
 gels used for Southern transfer were denatured de·na·ture  
tr.v. de·na·tured, de·na·tur·ing, de·na·tures
1. To change the nature or natural qualities of.

2.
 for 45 min in denaturing solution (0.5 mol/L NaOH, 1.5 mol/L NaCl) before being neutralized in 0.5 mol/L Tris-HCl, pH 7.5, 1.5 mol/L NaCl for 30 min. DNA was then transferred to Hybond (Amersham, Buckinghamshire, UK) nylon membrane by vacuum by using a custom-made Southern blotting apparatus. The nylon filter was prehybridized for at least 2 h with a blocking solution (6x SSC SSC Secondary School Certificate
SSC Standard Systems Center (USAF)
SSC State Services Commission (New Zealand)
SSC Swedish Space Corporation
SSC Salem State College (Massachusetts) 
 [1x SSC is 0.15 mol/L NaCl plus 0.014 mol/L sodium citrate], 0.1% [w/v] polyvinylpyrrolidone polyvinylpyrrolidone /poly·vi·nyl·pyr·rol·i·done/ (-vi?nil-pi-ro´li-don) povidone.

polyvinylpyrrolidone

see povidone; called also PVP.
 400, 0.1% Ficoll [v/v], 0.1% bovine serum albumin serum albumin
n.
See seralbumin.
, 0.5% SDS, 150 [micro]g/mL denatured calf thymus thymus

Pyramid-shaped lymphoid organ (see lymphoid tissue) between the breastbone and the heart. Starting at puberty, it shrinks slowly. It has no lymphatic vessels draining into it and does not filter lymph; instead, stem cells in its outer cortex develop into
 DNA) at 65[degrees]C. The labeled denatured probe was then added to the solution and incubated overnight at 65[degrees]C. Finally, the filter was washed (300 mL 2x SSC, 0.1% [w/v] SDS followed by 0.1x SSC 0.1% SDS) at 65[degrees]C. Autoradiographic au·to·ra·di·o·graph  
n.
An image recorded on a photographic film or plate produced by the radiation emitted from a specimen, such as a section of tissue, that has been treated or injected with a radioactively labeled isotope or that has absorbed or
 images were recorded on Hyperfilm-MP (Pharmacia Bio-tech), which was exposed overnight with intensifying screens.

PCR Analysis

The presence of class 1 integrons in each strain was assessed by using class 1 specific primers. Gene cassettes embedded within the class 1 integrons were determined by using primers listed in the Table. Isolates were also screened for sul1, sul2, and sul3 by using sul1-F and -R, sul2-F and -R, and sul3-F and -R, respectively. Seven positive class 1 integron PCR products were chosen randomly, extracted from agarose gels after size separation, and sequenced with IntF, IntR, and custom-made oligonucleotide primers (Table).

The presence of ISCR elements in each strain was also determined by using primers CRF/CRFF-r designed to amplify the same 700-bp fragment internal to the open reading frames (ORFS ORFS O-Ring-Face-Seal (fitting)
ORFS Output Radio Frequency Spectrum
ORFS Origin Rail Freight
ORFS Oxford RF Sensors
) of ISCR1-5 (Table). Full-length ISCR2 elements were amplified with primers designed to target the ends of ISCR2. Primers used to amplify genes often associated with ISCR2 or ISCR3 are also given (Table). Because dhfr genes are associated with ISCR elements, we also performed molecular analysis of them.

PCRs were conducted in a final volume of 20 [micro]L by using 10 [micro]L ABgene Expand Hi-fidelity Master Mix (ABgene House, Surrey, UK). Primers were used at final concentrations of 10 [micro]mol/L, and 1 [micro]L of an overnight bacterial culture (optical density 1.0 at 600 nm) was added as source of DNA template. The cycling parameters were as follows: 95[degrees]C for 5 min, followed by 30 cycles of 95[degrees]C for 1 min, 55[degrees]C for 1 min, and 68[degrees]C for 1-4 min, depending on the sequence to be amplified, and ending with a 5-min incubation at 68[degrees]C.

DNA Sequencing and Analysis

Sequencing was conducted on both strands by the dideoxyl-chain termination method with a Perkin-Elmer Biosystems 377 DNA sequencer (Perkin-Elmer, Waltham, MA, USA). Sequence analysis was performed with the Lasergene DNASTAR software package (SelectScience Ltd., Bath, UK). Sequence alignments were conducted with the ClustalW program (www.ebi.ac.uk/clustalw) and the PAM 250 matrix.

The sequence of ISCR2, together with the adjacent sul2 region and the novel ISCR9 and ISCR10, has been deposited in GenBank. The genetic locus ISCR2-glmM/sul2 from isolates 5232, 4647, 3800, and 2107 has been attributed the accession nos. AM182031, 182030, 182029, and 181666, respectively. ISCR9 and ISCR10 have been given the numbers AM 182033 and AM182032, respectively.

Results

TMP/SMX MICs

TMP/SMX MICs separated the isolates into an obvious bimodal distribution bimodal distribution

a distribution with two peaks separated by a region of low frequency of observations.
. The TMP/SMX-resistant isolates possessed MICs >32 mg/L, whereas the sensitive controls used as molecular comparators possessed TMP/SMX MICs ranging from 0.5 to 2 mg/L (Online Appendix Table, available from http://www.cdc.gov/EID/content/13/4/559-appT.htm).

Detection and Determination of Class 1 Integrons

Of the 25 TMP/SMX-resistant S. maltophilia isolates that we analyzed, 17 possessed the sul1 gene as part of the 3' end of a class 1 integron. None of the TMP/SMX-susceptible S. maltophilia isolates yielded positive sul1 PCR products. PFGE analysis (data not shown) showed that only 2 isolates (9189 and 12221 from Chile) are clonally related (online Appendix Table). To our knowledge, this is the first report of sul1-positive S. maltophilia isolates from North America and Europe. The sul1-positive isolates are widespread, being from Europe, North America, and South America. Most (5) were isolated from Brazil. The integrons associated with the sul1 gene vary in size; however, when 2 strains were isolated from the same country (e.g., 3438 and 3444, 9189 and 12221, and 98 and 14469), they possessed integrons of the same size, despite not being clonally related (Online Appendix Table). Seven of these integrons were randomly selected to examine their gene cassettes. The genetic context of the class 1 integrons and procured gene cassettes are shown in Figure 1. Strains 1893 (Germany) and 9431 (Brazil) possessed only the int and sul/qac genes. The class 1 integrons from strains 4891 (USA), 9189 (Chile), and 12221 (Chile) contained an embedded aacA4 gene cassette. The 2 Mexican strains (3438 and 3444) contained 2 aminoglycoside-modifying genes (aacA7 and aadA5) and an unknown ORF (Figure 1) yet were clonally unrelated, as judged by PFGE profiling. None of the integrons were the same as those characterized from strains isolated from Argentina (10).

[FIGURE 1 OMITTED]

Detection and Location of sul2 Genes

All 55 isolates (both TMP/SMX resistant and sensitive) were screened for sul2 genes with the primers listed in the Online Appendix Table. Nine of the isolates gave PCR products for sul2. None of the TMP/SMX-susceptible S. maltophilia isolates displayed positive sul2 PCR products. Sequence analysis showed 100% identity with previous sul2 sequences.

Given that sul2 is normally located on medium-to-large sized plasmids, plasmids were isolated and characterized for sul2 carriage. Plasmid DNA was prepared from each isolate and used as a template for PCRs by using the sul2 primer detection set. In every case, a product of the size expected ofsul2 sequence amplification was obtained. The purity of each plasmid preparation was evaluated by attempted PCR amplification of the host cell chromosomal gyrA gene. In no case was an amplification product obtained when plasmid DNA was used as template; in contrast, a gyrA amplification product of the correct size was obtained from genomic DNA. These data were later confirmed by Southern hybridization that used the labeled sul2 gene as a probe (data not shown). Unsurprisingly, in most cases sul2 was found on a large plasmid of [approximately equal to] 120 kb; however, in 2 of 9 sul2-positive isolates, sul2 gene was chromosomally encoded.

Detection of ISCR Elements in TMP/SMX-sensitive and -resistant Strains

The sul2 gene and dhfr genes are often found on plasmids and in close association with class 1 integrons or ISCR mobile genetic elements Mobile genetic elements (MGE) are a type of DNA that can move around within the genome. They include:
  • Transposons
  • Retrotransposons
  • DNA transposons
 (10,15,18,19). Accordingly, we investigated the 55 S. maltophilia isolates for ISCR elements. Seven of the 25 TMP/SMX-resistant isolates yielded PCR products of the expected size ([approximately equal to] 700 bp) when the ISCR specific primers CRF/CRFF-r were used, and 6 of 23 TMP/SMX-sensitive S. maltophilia isolates also yielded the correct-sized amplification products.

To determine whether the locations of the ISCR sequences in the S. maltophilia isolates are chromosomal or plasmid mediated, plasmid DNA was prepared from each isolate and used as a template for ISCR-PCR and Southern hybridization analysis in a similar manner as described for sul2. In every case, a product of the size expected of ISCR sequence amplification was obtained. Hence, in those isolates that possess an ISCR element, the element is located on a plasmid (data not shown). The PCR ISCR amplification products were recovered, purified, and ligated into the cloning vector cloning vector
n.
An autonomously replicating plasmid having regions into which foreign DNA can be inserted.
, PCR-Topo-2.1 (Invitrogen) and recombinant plasmids were recovered by transformation of Escherichia coli Escherichia coli (ĕsh'ərĭk`ēə kō`lī), common bacterium that normally inhabits the intestinal tracts of humans and animals, but can cause infection in other parts of the body, especially the urinary tract.  DH5[alpha]. One clone from each transformation was chosen for further study.

Sequence analysis showed that 5/7 amplicons obtained from TMP/SMX-resistant S. maltophilia isolates were identical to the equivalent sequence of ISCR2; the other 2 amplicons were identical to that of ISCR3 (Online Appendix Table). ISCR2 sequences were identified in isolates originating from North and South America, as well as from Europe. In contrast, the ISCR3 sequence was identified only in isolates that originated from Spain.

The ISCR-like elements carried by the sensitive isolates, while clearly related to ISCR1-5, differed markedly from known ISCR sequences (15). Two variants were found, which we have designated ISCR9 and ISCR10. The putative amino acid amino acid (əmē`nō), any one of a class of simple organic compounds containing carbon, hydrogen, oxygen, nitrogen, and in certain cases sulfur. These compounds are the building blocks of proteins.  sequences of ISCR9 and ISCR10 are [approximately equal to] 95% identical to each other and display 30%, 48%, and 74% identity to ISCR2, ISCR,3 and ISCR5, respectively (Online Appendix Figure, available from http://www.cdc.gov/EID/13/4/content/559-appG.htm). These novel ISCRs are harbored in isolates from several different regions, including South American countries, the United States, and Turkey (Table).

Identification of Resistance Genes and Sequences Adjacent to ISCR Elements

ISCR2 is often associated with various antimicrobial resistance genes, not least, genes mediating TMP/SMX resistance (Figure 2) (15). These and other genes normally associated with ISCR2 were therefore analyzed; these included dhfrA10, dhfrA9, dhfrA20,floR, tetR, strA, sul2, and glmM encoding a truncated phosphoglucosamine mutase mutase /mu·tase/ (mu´tas) a group of enzymes (transferases) that catalyze the intramolecular shifting of a chemical group from one position to another.

mu·tase
n.
. Pairs of oligonucleotides were used (Table) to genetically characterize all those S. maltophilia isolates that possessed an ISCR element.

[FIGURE 2 OMITTED]

The floR gene was detected in isolates 2139 and 2170 (which also contains ISCR2) from Turkey and the United States, respectively, and in isolates 12044 and 12049 (which also contains ISCR3) from Spain. A truncated glmM allele allele (əlēl`): see genetics.
allele

Any one of two or more alternative forms of a gene that may occur alternatively at a given site on a chromosome.
 ([DELTA]glmM) was detected in all ISCR2-containing isolates, and sul2 was found in all ISCR2- and ISCR3-containing isolates. The dhfr, tetR, and strA genes were not detected.

Linkage of the ISCR element to [DELTA]glmM, sul2, or floR was then investigated by PCR analysis, i.e., the oligonucleotide pair CRFF/sul2F is expected to generate a product if the ISCR sequence is close to sul2 and downstream of it (Figure 2). Using this strategy, we found that ISCR2 was linked to [DELTA]glmM and sul2 in all isolates that possess ISCR2. The floR gene was also found to be linked to ISCR2, on the opposite side from [DELTA]glmM and sul2, in isolates 2139 and 2170 (Figure 2). Linkage of ISCR3 to either sul2 or floR was not demonstrated.

Discussion

We report sul2 genes being present in S. maltophilia and contributing to TMP/SMX resistance. In most cases, sul2 was carried on large plasmids ([approximately equal to] 120 kb), but as judged by Southern hybridization data, a few appear to be chromosomally encoded. This study also supports the findings of Barbolla et al. that sul1 present in S. maltophilia is associated with class 1 integrons (10). Herein, we have characterized S. maltophilia sul1 genes from North America, South America, Spain, Turkey, Italy, and Germany, and observed that all of them were associated with class 1 integrons.

Most studies of the location and dissemination of sul2 genes have concentrated on Enterobacteriaceae, such as E. coli E. coli: see Escherichia coli.
E. coli
 in full Escherichia coli

Species of bacterium that inhabits the stomach and intestines. E. coli can be transmitted by water, milk, food, or flies and other insects.
 and Salmonella enterica. A recent study by Antunes et al. found sul1, sul2, or sul3 genes in most Portuguese isolates (18); 24 of 200 isolates contained both sul1 and sul2. sul2 has also recently been identified in S. enterica from Brazil (20). Similar results have been reported from E. coli urinary tract isolates in which [approximately equal to] 26% of strains possessed both sul1 and sul2 genes (21). A biased study examining TMP/SMX-resistant E. coli recently reported that 15 of 20 isolates possessed sul2 and that 6 of those also carried sul1 on a class 1 integron (14). Additional studies of E. coli have shown the intercontinental predominance of sul1 through class 1 integrons (22). A study by Pei et al. demonstrated the correlation of anthropogenic an·thro·po·gen·ic  
adj.
1. Of or relating to anthropogenesis.

2. Caused by humans: anthropogenic degradation of the environment.
 activity with the presence of sul genes in environmental samples (23). However, none of the studies demonstrated the genetic origin of the sul2.

In addition to sul genes associated with plasmids and class 1 integrons, we investigated whether the S. maltophilia isolates possessed ISCR elements and whether these could be linked to dhfr or sul genes, as has been shown (18). Of the 25 TMP/SMX-resistant isolates, 6 harbored sul2 linked to ISCR2. However, we could not detect any sul3 genes. In the isolates with ISCR2, the element was directly linked to a deleted version of a phosphoglucosamine mutase gene, [DELTA]glmM, as has been reported on other occasions (Figure 2). This arrangement is identical to those of 5 other sequences in the EMBL EMBL European Molecular Biology Laboratory
EMBL Eniwetok Marine Biological Laboratory
 database, in E. coli isolated from cattle in France and Germany (24), in the plasmid pRVS1 isolated from a strain of Vibrio vibrio

Any of a group of aquatic, comma-shaped bacteria in the family Vibrionaceae. Some species cause serious diseases in humans and other animals. They are gram-negative (see
 salmonicida from Norway, in a plasmid from a strain of S. enterica isolated in Japan, and on the chromosome of Shigella flexneri Shigella flex·ner·i
n.
Flexner's bacillus.
 isolated in the United States (18,24). In all cases, [DELTA]glmM and sul2 are linked to the end of ISCR2 that accommodates the IS91 oriIS equivalent (Figure 2). The dual arrangement of [DELTA]glmM and sul2 is also found in plasmids of marine psychotrophic bacteria isolated in Norway (GenBank accession no. AJ306553/4), but in these cases the ISCR2 element appears not to be present.

Two of the isolates harbored a copy of the floR gene immediately upstream of a copy of ISCR2 (Figure 2), an arrangement identical to that reported on plasmids found in isolates of E. coli from cattle in France and Germany (24). The S. maltophilia isolates investigated in this study came from Turkey and the United States. Two isolates from Spain also carry the floR gene but not ISCR2. Instead, the isolates possess copies of ISCR3, which do not appear to be linked to floR. The finding of florfenicol-resistant traits on plasmids in different bacterial species from different countries highlights the wide geographic spread of this resistance mechanism. The location of floR next to ISCR2 is such that it is possible, if not probable, that the resistance gene can be cotransposed with the ISCR element.

The findings within this study are important for several reasons. First, this is, to our knowledge, the first report of ISCR elements being found in S. maltophilia isolates. In 6 cases, these were linked to sul2 genes responsible for the TMP/SMX-resistant phenotype. Moreover, these isolates were unrelated strains found in different countries. Second, since TMP/SMX is the mainstay therapy for S. maltophilia infections, the mobilization of sul genes by means of class 1 integrons and ISCR elements is likely to increase with TMP/SMX consumption. Third, most sul2 genes in this study have been found on plasmids, and sul2-containing plasmids can potentially confer an increase in bacterial "fitness" (25). As yet, such phenomena have only been explored in Enterobacteriaceae, and it has yet to be established whether sul2-carrying plasmids have such an additive effect additive effect
n.
An effect in which two substances or actions used in combination produce a total effect the same as the sum of the individual effects.
 in S. maltophilia or for that matter, other nonfermenting gram-negative bacilli bacilli /ba·cil·li/ (bah-sil´i) plural of bacillus.

bacilli

see bacillus.
.

These data suggest that microbiology laboratories need to carefully monitor S. maltophilia TMP/SMX resistance, which has the potential to increase by means of mobile elements. We also advocate the continued international surveillance of antimicrobial drug resistance that may act as early warning systems for this kind of resistance. Furthermore, yearly monitoring with molecular probes is advisable.

This work is funded by the EC through COBRA contract LSHM-CT-2003-503335 and a STREP DRESP2 contract. M.A.T. is currently funded by Cardiff University.

Dr Toleman is currently working as a research fellow at the Medical School, Cardiff University, Wales Wales, Welsh Cymru, western peninsula and political division (principality) of Great Britain (1991 pop. 2,798,200), 8,016 sq mi (20,761 sq km), west of England; politically united with England since 1536. The capital is Cardiff. . His interest is the dissemination of antimicrobial-drug-resistant genes among clinical and environmental bacteria.

References

(1.) Avison MB, Higgins CS, Ford PJ, von Heldreich CJ, Walsh TR, Bennett PM. Differential regulation of L1 and L2 [beta]-lactamase expression in Stenotrophomonas maltophilia. J Antimicrob Chemother. 2002;49:387-9.

(2.) Li X-Z, Nikaido H. Efflux-mediated drug resistance in bacteria. Drugs. 2004;64:159-204.

(3.) Sader HS, Jones RN. Antimicrobial susceptibility of uncommonly isolated non-enteric gram-negative bacilli. Int J Antimicrob Agents. 2005;25:95-109.

(4.) Hogardt M, Schmoldt S, Gotzfried M, Adler K, Heesemann J. Pitfalls of polymyxin polymyxin /poly·myx·in/ (-mik´sin) generic term for antibiotics derived from Bacillus polymyxa; they are differentiated by affixing different letters of the alphabet.  antimicrobial susceptibility testing of Pseudomonas aeruginosa isolated from cystic fibrosis cystic fibrosis (sĭs`tĭk fībrō`sĭs), inherited disorder of the exocrine glands (see gland), affecting children and young people; median survival is 25 years in females and 30 years in males. . J Antimicrob Chemother. 2004;54:1057-61.

(5.) Fedler KA, Biedenbach DJ, Jones RN. Assessment of pathogen frequency and resistance patterns among paediatric Adj. 1. paediatric - of or relating to the medical care of children; "pediatric dentist"
pediatric
 patient isolates: report from the 2004 SENTRY Antimicrobial Surveillance Program on three continents. Diagn Microbiol Infect Dis. 2006;56:427-36.

(6.) Gales AC, Jones RN, Forward KR, Linares J, Sader HS, Verhoef J. Emerging importance of Acinetobacter species and Stenotrophomonas maltophilia as pathogens in severely ill patients: geographic patterns, epidemiological features, and trends in the SENTRY Antimicrobial Surveillance program (1997-1999). Clin Infect Dis. 2001;32(Suppl):S104-13.

(7.) Al-Jasser AM. Stenotrophomonas maltophilia resistant to trimethoprim trimethoprim /tri·meth·o·prim/ (-meth´o-prim) an antibacterial closely related to pyrimethamine; almost always used in combination with a sulfonamide, primarily for the treatment of urinary tract infections.  sulfamethoxazole sulfamethoxazole /sul·fa·meth·ox·a·zole/ (-meth-ok´sah-zol) a sulfonamideantibacterial and antiprotozoal, particularly used in acute urinary tract infections.

sul·fa·me·thox·a·zole
n.
: an increasing problem. Ann Clin Microbiol Antimicrob. 2006;5:23-6.

(8.) Zelenitsky SA, Iacovides H, Ariano RE, Harding GK. Antibiotic combinations significantly more active than monotherapy in an in vitro infection model of Stenotrophomonas maltophilia. Diagn Microbial microbial

pertaining to or emanating from a microbe.


microbial digestion
the breakdown of organic material, especially feedstuffs, by microbial organisms.
 Infect Dis. 2005;51:39-43.

(9.) Valdezate S, Vindel A, Saez-Nieto JA, Baquero F, Canton R. Preservation of topoisomerase topoisomerase

an enzyme involved in DNA replication that introduces a single-strand nick in the DNA enabling it to swivel and thereby relieve the accumulated winding strain generated during unwinding of the double helix.
 genetic sequences during in vivo in vivo /in vi·vo/ (ve´vo) [L.] within the living body.

in vi·vo
adj.
Within a living organism.



in vivo adv.
 and in vitro development of high-level resistance to ciprofloxacin in isogenic isogenic /iso·gen·ic/ (-jen´ik) syngeneic.
isogenic (ī´sōjen´ik),
adj originating from a common source; possessing the same genetic composition.
 Stenotrophomonas maltophilia strains. J Antimicrob Chemother. 2005;56:220-3.

(10.) Barbolla R, Catalano M, Orman BE, Famiglietti A, Vay C, Smayevsky J, et al. Class 1 integrons increase trimethoprim/sulfamethoxazole MICs against epidemiologically unrelated Stenotrophomonas maltophilia isolates. Antimicrob Agents Chemother. 2004;48:666-9.

(11.) Beaber JW, Hochhut B, Waldor MK. Genomic and functional analyses of SXT, an integrating antibiotic resistance antibiotic resistance,
n the ability of certain strains of microorganisms to develop resistance to antibiotics.

antibiotic resistance 
 gene transfer element derived from Vibrio cholerae. J Bacteriol. 2002;184:4259-69.

(12.) National Committee for Clinical Laboratory Standards. Methods for dilution antimicrobial tests for bacteria that grow aerobically: approved standard M7-A6. Wayne (PA): The Committee; 2003.

(13.) Clinical Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing. Supplemental tables M100-S15. Wayne (PA): The Institute; 2005.

(14.) Infante in·fan·te  
n.
A son of a Spanish or Portuguese king other than the heir to the throne.



[Spanish and Portuguese, both from Latin
 B, Grape M, Larsson M, Kristiansson C, Pallecchi L, Rossolini GM, et al. Acquired sulphonamide sulphonamide or US sulfonamide
Noun

Pharmacol any of a class of organic compounds that prevent the growth of bacteria
 resistance genes in faecal fae·cal  
adj. Chiefly British
Variant of fecal.

Adj. 1. faecal - of or relating to feces; "fecal matter"
fecal
 Escherichia coli from healthy children in Bolivia and Peru. Int J Antimicrob Agents. 2005;25:308-12.

(15.) Toleman MA, Bennett PM, Walsh TR. Common regions e.g. orf513 and antibiotic resistance: IS91-1ike elements evolving complex class 1 integrons. J Antimicrob Chemother. 2006;58:1-6.

(16.) Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center. . One-day (24-48 h) standardization laboratory protocol for molecular sub-typing of Escherichia coli O157:H7, non-typhoidal Salmonella serotypes, and Shigella sonnei Shigella son·ne·i
n.
Sonne bacillus.


Shigella sonnei Shigella group D Microbiology The most commonly isolated, least virulent Shigella serotype
 by pulsed-field gel electrophoresis (PFGE). in: PulseNet PFGE manual. Atlanta: The Centers; 2002.

(17.) Grinsted J, Bennett PM. Preparation and electrophoresis of plasmid DNA. In: Grinsted J, Bennett PM, editors. Plasmid technology. London: Academic Press; 1990. pp. 129-42.

(18.) Antunes P, Machado J, Sousa JC, Piexe L. Dissemination ofsulfonamide resistance gene (sul1, sul2 and sul3) in Portuguese Salmonella enterica strains and relation with integrons. Antimicrob Agents Chemother. 2005;49:836-9.

(19.) Toleman MA, Bennett PM, Walsh TR. Common regions: novel gene capturing systems of the 21st century? Microbiol Mol Biol Rev. 2006;70:296-316.

(20.) Michael GB, Cardoso M, Schwartz S. Class 1 integron-associated gene cassettes in Salmonella enterica subsp, enterica serovar Agona isolated from pig carcasses in Brazil. J Antimicrob Chemother. 2005;55:776-9.

(21.) Grape M, Farra A, Kronvall G, Sundstrom L. Integrons and gene cassettes in clinical isolates of cotromoxazole-resistant gram-negative bacteria. Clin Microbiol Infect. 2005;11:185-92.

(22.) Blahna MT, Zalewski CA, Reuer J, Kahlmeter G, Foxman B, Marrs CF. The role of horizontal gene transfer “HGT” redirects here. For other uses, see HGT (disambiguation).
Horizontal gene transfer (HGT), also Lateral gene transfer (LGT), is any process in which an organism transfers genetic material to another cell that is not its offspring.
 in the spread of trimethoprim-sulfamethoxazole resistance among uropathogenic Escherichia coli in Europe and Canada. J Antimicrob Chemother. 2006;57:666-72.

(23.) Pei R, Kim S-C S-C Split - Convert Switch , Carlson KH, Pruden A. Effect of fiver landscape on the sediment concentrations of antibiotics and corresponding antibiotic resistance genes (ARG See argument.

arg - argument
). Water Res. 2006;40:2427-35.

(24.) Cloeckaert A, Baucheron S, Flaujac G, Schwarz S, Kehrenberg C, Martel JL, et al. Plasmid-mediated florfenicol resistance encoded by the floR gene in Escherichia coli isolated from cattle. Antimicrob Agents Chemother. 2000;44:2858-60.

(25.) Enne VI, Bennett PM, Livermore DM, Hall LM. Enhancement of host fitness by the sul2-coding plasmid p9123 in the absence of selective pressure. J Antimicrob Chemother. 2004;53:958-63.

Address for correspondence: Timothy R. Walsh, Department of Medical Microbiology, School of Medicine, Cardiff University, Heath Park, Cardiff CF14 4XN, Wales, U.K.; email: WalshTR@Cardiff.ac.uk

Use of trade names is for identification only and does not imply endorsement by the Public Health Service or by the U.S. Department of Health and Human Services Noun 1. Department of Health and Human Services - the United States federal department that administers all federal programs dealing with health and welfare; created in 1979
Health and Human Services, HHS
.

Mark A. Toleman, * Peter M. Bennett, ([dagger]) David M.C. Bennett, ([dagger]) Ronald N. Jones, ([double dagger]) and Timothy R. Walsh *

* School of Medicine at Cardiff University, Cardiff, Wales, U.K.; ([dagger]) School of Medical Sciences at University of Bristol, England, UK; ([double dagger]) The JONES Group/JMI Laboratories, North Liberty, Iowa North Liberty is a city in Johnson County, Iowa, United States. It is a suburb of Iowa City and part of the Iowa City Metropolitan Statistical Area.

When the city incorporated on November 10, 1913, its population was approximately 190.
, USA
Table. Oligonucleotide primers used in this study, Cardiff, 2007

                                               GenBank
Primer     Sequence (5' [right arrow] 3')   accession no.    Target

Ina-F           GCCTGTTCGGTTCGTAAGCT                          intl
Int-R           CGGATGTTGCGATTACTTCG                          intl
sul1-F       ATGGTGACGGTGTTCGGCATTCTGA                        sul1
sul1-R       CTAGGCATGATCTAACCCTCGGTCT                        sul1
sul2-F        GAATAAATCGCTCATCATTTTCGG        AJ289135        sul2
sul2-R        CGAATTCTTGCGGTTTCTTTCAGC        AJ289135        sul2
aacA4-F         AACTTGCGAGCGATCCGATG                          aacA4
aacA4-R         ATGTACACGGCTGGACCATC                          aacA4
aacA7-F         AATGGATAGTTCGCCGCTCG                          aacA7
aacA7-R         TTCCGGAAGCAGCGTACTTG                          aacA7
CRF             CACTWCCACATGCTGTKKC           AF231986      All ISCR
CRF-r           GMMACAGCATGTGGWAGTG           AF231986      All ISCR
CRFF            GGRYGCAACGSCTCAAGCG           AF231986      All ISCR
CRFF-r          CGCTTGAGSCGTTGCRYCC           AF231986      All ISCR
LECR2           CACTGGCTGGCAATGTCTAG          AF231986        ISCR2
RECR2           CTTTGGACCGCAGTTGACTC          AF231986        ISCR2
FloF            TCGACATCCTGGCTTCACTG          AF231986        floR
FloR            ATTACAAGCGCGACAGTGGC          AF231986        floR
dfra20f         GGGAAACACCGAGAAATGGG          AJ605332       dfrA20
dfrA20R         TTCTTCTTCCCATTCTCCCC          AJ605332       dfrA20
dfrA9F          CAGATTCCGTGGCATGAACC           X57730         dfrA9
dfrA9R          GACCTCAGATACGAGTTTCC           X57730         dfrA9
dfrA10F         TGTAGCGCGTGGTGTAAACG          AY055428       dhfr10
dfrA10R         ACGTCTACGTGAGTATCCGC          AY055428       dhfr10
strAF           TCTGTCGCACCTGCTTGATC          AY055428        strA
strAR           CATTGCTGATGAACTGCGCG          AY055428        strA
tetAF           CGCTGTTTGTGATTACACCC          AJ250203        tetA
tetAR           CAGCGAGATGCGATATATCC          AJ250203        tetA
glmmR           GAGTCAACTGCGGTCCAAAC          AJ289135        glmM
glmmF           ACGGTATTCGTGGCAAAGCC          AJ289135        glmM

Primer               Reference

Ina-F                   (14)
Int-R                   (14)
sul1-F                  (15)
sul1-R                  (15)
sul2-F                  (15)
sul2-R                  (15)
aacA4-F                 (14)
aacA4-R                 (14)
aacA7-F              This study
aacA7-R              This study
CRF                  This study
CRF-r                This study
CRFF                 This study
CRFF-r               This study
LECR2                This study
RECR2                This study
FloF                 This study
FloR                 This study
dfra20f              This study
dfrA20R              This study
dfrA9F               This study
dfrA9R               This study
dfrA10F              This study
dfrA10R              This study
strAF                This study
strAR                This study
tetAF                This study
tetAR                This study
glmmR                This study
glmmF                This study
COPYRIGHT 2007 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2007, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:RESEARCH
Author:Walsh, Timothy R.
Publication:Emerging Infectious Diseases
Date:Apr 1, 2007
Words:4715
Previous Article:Diagnosis of tuberculosis by an enzyme-linked immunospot assay for interferon-[gamma].(RESEARCH)(Disease/Disorder overview)
Next Article:Flinders Island spotted fever rickettsioses caused by "marmionii" strain of rickettsia honei, eastern Australia.(RESEARCH)
Topics:



Related Articles
Tracking drug-resistant streptococcus pneumoniae in Oregon: an alternative surveillance method.(Statistical Data Included)
Changes in antimicrobial resistance among Salmonella enterica serovar Typhimurium isolates from humans and cattle in the Northwestern United States,...
Changes in Antimicrobial Resistance in Salmonella enterica Serovar Typhimurium.(Letter to the Editor)
Persistence and Variability of Stenotrophomonas maltophilia in Cystic Fibrosis Patients, Madrid, 1991-1998.(Statistical Data Included)
Enteric Fever Treatment Failures: A Global Concern.
Antimicrobial resistance of Escherichia coli O26, O103, O111, O128, and O145 from animals and humans. (Research).
Vibrio cholerae SXT element, Laos.(Letters)(Letter to the Editor)
Stenotrophomonas maltophilia in salad.(LETTERS)(Letter to the Editor)
Multidrug-resistant commensal Escherichia coli in children, Peru and Bolivia.(RESEARCH)(includes statistical tables)
Expanded-spectrum [beta]-lactamase and plasmid-mediated quinolone resistance.(LETTERS)(Letter to the editor)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles