Genotyping Rickettsia prowazekii isolates.

We developed a typing method that can differentiate 8 strains of Rickettsia prowazekii into 7 genotypes. This method can be used to type and trace the origin of R. prowazekii isolated from samples collected during epidemics after a bioterrorism attack.

**********

Rickettsia prowazekii is the causative agent of epidemic typhus and also a potential bioterrorism agent. The disease may occur in epidemics when social, economic, or political systems are disrupted and expose a large population such as refugees to louse infestation due to lack of hygiene. Recent outbreaks of typhus have occurred in Burundi, Algeria, Peru, and Russia (1,2). R. prowazekii is transmitted by the human body louse, Pediculus humanus corporis, in the human cycle. Sylvatic typhus associated with R. prowazekii has been documented in the eastern United States. However, it is not clear whether R. prowazekii transmission to humans from flying squirrels results from the bite of fleas or lice or contaminated arthropod fecal material (3, 4). Reemergence of epidemic typhus and the potential use of R. prowazekii in bioterrorist attacks requires a molecular method that can type isolates and trace the origin or epidemiology of the disease.

The Study

Our objective was to identify a minimal gene set in which PCR amplification and sequencing would allow the efficient differentiation of R. prowazekii strains for diagnostic purposes. Using BLAST analysis (www.ncbi.plm.nih. gov/blast/b12seq/wblast2.cgi) to identify target DNA sequences for genotyping, we compared the genomic sequences of Madrid E strain (E strain, NC_000963) (5) with those of Nuevo Leon strain, a new tick isolate of R. prowazekii (6), which was sequenced recently (unpub. data). We identified 6 loci with insertion or deletion in 1 of 2 strains. PCR primers were designed from the target sequences and used to amplify DNA from 8 strains of R. prowazekii, including human isolates Addis Ababa, Breinl, Cairo, and E strain; a guinea pig isolate of Evir strain (7); a tick isolate (ZRS) from Ethiopia (8); and 2 flying squirrel isolates (GvV-250 from Virginia and GvF-16 from Florida) (Table 1) (4). Rickettsial genomic DNA was extracted from the R. prowazekii-infected L929 cells or infected yolk sacs of embryonated chicken eggs by using the GenElute Mammalian Genomic DNA Miniprep kit (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer's instructions.

For designing the primers (Table 1), we used Primer 3.0 software (http://frodo.wi.mit.edu/cgi-bin/primer3/ primer3_www.cgi); primers were synthesized. Two microliters of the DNA preparation were amplified in a 50-[micro]L RED taq ReadyMIX PCR (Sigma-Aldrich). The following conditions were used for amplification: an initial 5 min of denaturation at 94[degrees]C followed by 30 cycles of denaturation for 30 s at 94[degrees]C, annealing for 30 s at 53 [degrees]C, and extension for 1 min at 72[degrees]C. Amplification was completed by holding the reaction mixture for 2 rain at 72[degrees]C. PCR products were directly sequenced with PCR primers for both strands. PCR amplification and DNA sequencing were performed twice for each gene of each R. prowazekii strain. A PCR reaction without template DNA was included as a negative control in each PCR.

DNA sequences were aligned by using DNASTAR Lasergene software, version 6.0 (DNASTAR, Inc., Madison, W], USA). The sequences amplified by 6 pairs of primers from each strain were joined together to form a concatenated sequence for each strain. A multiple alignment of the concatenated sequences was constructed by using ClustalW (www.ebi.ac.uk/clustalw) and was analyzed by using the neighbor-joining method in PAUP 4.0 Beta (Sinauer Associate, Inc., Sunderland, MA, USA). Bootstrap was estimated for neighbor-joining trees by 1,000 resamplings. The sequences reported here were assigned consecutive GenBank accession numbers from EU 192931 to EU192949.

Conclusions

We amplified the 6 loci from all 8 R. prowazekii strains and compared the corresponding sequences of each strain to identify the variations among strains. Three loci were intergenic spacers (rp272/rp273, rp308/rp309, and rp691/rp692), and 2 loci were pseudogenes (rpl81 and rp195) in all R. prowazekii strains. We also sequenced rp028, the methyltransferase gene, because we wanted to know if this gene was inactivated in any virulent strain of R. prowazekii. Pseudogene rp028 was inactivated in a virulent E strain but not in its virulent revertant Evir strain (9). Coincident with inactivation of the methyltransferase gene, E strain is deficient in methylation of surface proteins (10,11).

Our result shows that a single nucleotide insertion at position 732 in rp028 occurred only in E strain among the tested R. prowazekii strains (Table 2). However, single nucleotide polymorphism (SNP) existed in rp028 among strains ofR. prowazekii and was very useful in the differentiation of R. prowazekii strains (Table 2). Apparently none of these nucleotide substitutions caused attenuation of E strain because the E strain and Evir strain were identical at these sites.

DNA sequence comparison and phylogenetic analysis of the concatenated sequences indicated that the R. prowazekii strains were grouped together by geographic location and source of isolation (Table 2, Figure). Two flying squirrel isolates from the United States were differentiated by a single nucleotide substitution at position 480 in rp028. E strain and its revertant Evir strain differed by a single nucleotide insertion in E strain at position 732 in rp028, which we reported previously (9). Breinl and Cairo strains were closely related but were differentiated by several deletion/insertion mutations in rp181 and the spacer between rp272 and rp273. The cattle tick isolate ZRS and the human isolate Addis Ababa, both from Ethiopia, were identical in all 6 loci. ZRS strain and Addis Ababa strain were phylogenetically more closely related to E/Evir strains than other strains (Figure). There was only a single nucleotide difference between ZRS/Addis Ababa strains and Evir strain (Table 2).

Genotyping of R. prowazekii has been explored recently. Zhu et al., using intergenic spacers rpmE/tRNAfMet and serS/virB4, differentiated 5 strains and PCR amplicons from 10 body lice of R. prowazekii into 4 genotypes (12). Ge et al. showed that R. prowazekii Breinl strain and E strain were different in the rp084 gene, which was deleted from the Breinl strain (13). However, using the rpmE/ tRNAfMet intergenic spacer, we were able to classify the 8 strains of R. prowazekii tested into only 2 genotypes. Genotype 1 contains Breinl strain and genotype 2 includes all other strains. All 8 strains were identical in the serS/virB4 spacer. With the exception of R. prowazekii Breinl strain, rp084 was not deleted from any strains of R. prowazekii tested in our study. Conversely, using our methods, the 8 strains of R. prowazekii can be differentiated into 7 genotypes. ZRS and Addis Ababa strains are the only isolates that cannot be differentiated with our method. Because all R. prowazekii ZRS and Addis Ababa strains originated from Ethiopia, it is reasonable to believe that they might be genetically identical. Ge et al. recently showed that 5 R. prowazekii strains, including Breinl, Cairo, E, GvV257, and GvF12 were different from each other by 1 to 4 SNPs in ompB and sca4, respectively (14). However, the differentiation of R. prowazekii based on SNPs between closely related strains may be complicated by PCR and sequence errors. Conversely, our method confers more confidence in the validation of the mutations because we differentiated all strains except for 2 flying squirrel strains by insertion and deletion mutations, which are rarely generated by PCR or sequence errors.

[FIGURE OMITTED]

Our method provides a technique for typing and tracing the origin of new R. prowazekii isolates. This method will have a broad use in the biodefense against and the molecular epidemiology of R. prowazekii and in detection of laboratory cross-contamination ofR. prowazekii strains.

Acknowledgment

We are grateful to Dr Zhikai Zhang for help in DNA sequencing.

This study was supported by a grant (U01AI71283) from the National Institute of Allergy and Infectious Diseases.

References

(1.) Raoult D, Woodward T, Dumler JS. The history of epidemic typhus. Infect Dis Clin North Am. 2004;18:127-40. DOI: 10.1016/S08915520(03)00093-X

(2.) Raoult D, Roux V, Ndihokubwayo JB, Bise G, Baudon D, Marte G, et al. Jail fever (epidemic typhus) outbreak in Burundi. Emerg Infect Dis. 1997;3:357-60.

(3.) Bozeman FM, Sonenshine DE, Williams MS, Chadwick DP, Lauer DM, Elisberg BL. Experimental infection of ectoparasitic arthropods with Rickettsiaprowazekii (GvF-16 strain) and transmission to flying squirrels. Am J Trop Med Hyg. 1981;30:253-63.

(4.) Duma RJ, Sonenshine DE, Bozeman FM, Veazey JM Jr, Elisberg BL, Chadwick DP, et al. Epidemic typhus in the United States associated with flying squirrels. JAMA. 1981;245:2318-23. DOI: 10.1001/jama.245.22.2318

(5.) Andersson SG, Zomorodipour A, Andersson JO, Sicheritz-Ponten T, Alsmark UC, Podowski RM, et al. The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature. 1998;396:133-40. DOI: 10.1038/24094

(6.) Medina-Sanchez A, Bouyer DH, Cantara-Rodriguez V, Mafra C, Zavala-Castro J, Whitworth T, et al. Detection of a typhus group Rickettsia in Amblyomma ticks in the state of Nuevo Leon, Mexico. Ann N Y Acad Sci. 2005;1063:327-32. DOI: 10.1196/annals.1355.052

(7.) Balayera NM, Nikolskaya VN. Enhanced virulence of the vaccine strain E of Rickettsia prowazekii on passaging in white mice and guinea pigs. Acta Virol. 1972;16:80 2.

(8.) Reiss-Gutfreund RJ. The isolation of Rickettsia prowazeki and mooseri from unusual sources. Am J Trop Med Hyg. 1966;15:943-9.

(9.) Zhang JZ, Hao JF, Walker DH, Yu XJ. A mutation inactivating the methyltransferase gene in avirulent Madrid E strain of Rickettsia prowazekii reverted to wild type in the virulent revertant strain. Vaccine. 2006;24:2317-23. DOI: 10.1016/j.vaccine.2005.11.044

(10.) Ching WM, Carl M, Dasch GA. Mapping of monoclonal antibody binding sites on CNBr fragments of the S-layer protein antigens of Rickettsia typhi and Rickettsia prowazekii. Mol Immunol. 1992;29:95-105. DOI: 10.1016/0161-5890(92)90161-P

(11.) Ching WM, Wang H, Davis J, Dasch GA. Amino acid analysis and multiple methytation of lysine residues in the surface protein antigen of Rickettsiaprowazekii. In: Angeletti RH, editor, Techniques in protein chemistry, Vol. IV. San Diego: Academic Press. 1993:307-14.

(12.) Zhu Y, Fournier PE, Ogata H, Raoult D. Multispacer typing of Rickettsia prowazekii enabling epidemiological studies of epidemic typhus. J Clin Microbiol. 2005;43:4708-12. DOI: 10.1128/ JCM .43.9.4708-4712.2005

(13.) Ge H, Chuang YY, Zhao S, Tong M, Tsai MH, Temenak JJ, et al. Comparative genomics of Rickettsiaprowazekii Madrid E and Breinl strains. J Bacteriol. 2004;186:556-65. DOI: 10.1128/JB. 186.2.556565.2004

(14.) Ge H, Tong M, Jiang J, Dasch GA, Richards AL. Genotypic comparison of five isolates of Rickettsia prowazekii by multilocus sequence typing. FEMS Microbiol Lett. 2007;271:112-7. DOI: 10.1111/j.1574-6968.2007.00706.x

Yong Zhu, * Aaron Medina-Sanchez, * Donald Bouyer, * David H. Walker, * and Xue-jie Yu *

* University of Texas Medical Branch, Galveston, Texas, USA

DOI: 10.3201/eid1408.080444

Dr Zhu is a postdoctoral fellow in the Department of Pathology, University of Texas Medical Branch at Galveston. His research interests are in the genotyping and molecular biology of Rickettsia spp.

Address for correspondence: Xue-jie Yu, Unviersity of Texas Medical Branch, 301 University Blvd, Galveston, TX 77555-0609, USA; email: [e-mail]

All material published in Emerging Infectious Diseases is in the public domain and may be used and reprinted without special permission; proper citation, however, is required.

Table 1. Primers for 6 loci of Rickettsia prowazekii genomic
DNA sequences

Target                Sequences of forward primer/reverse primer
sequence                        (5' [right arrow] 3')

rp028          TTGATATAGGTTGCGGAGTCGGTGTTA/TCATTGATGGCTTGTAGTTTTTCTGCT
rp181                  ATTATGCAAATAATGCAG/GCATCGGATAAGTTAGTTCA
rp195                 TTTATTGGGGATTTACCTTT/CAAGTGTTAGATAGCTTGCT
rp272/rp273           TCTTGCGATACAGTAAGCAC/TATTCGCTCCTTACCAGTTA
rp308/rp3O9          TTAACAGAAGTAATAATAATTG/AGCAATAGAATTTGATAAGCA
rD691/rp692         AGAAATTTGTATTGCATTTTTATG/GCTCTAGAAGCTATTGCTGA

Target                       PCR product
sequence                      size, bp       Reference

rp028                            682            (9)
rp181                            390         This study
rp195                            384         This study
rp272/rp273                      612         This study
rp308/rp3O9                      369         This study
rD691/rp692                      447         This study

Table 2. Genotypes of Rickettsia prowazekii strains determined by
nucleotide mutation in multiple loci

                                  rp028 *

               268
Strain      ([dagger])      286          480          732

GvV-250         T            G            C            --

GvF-16          T            G            T            --

Breinl          T            A            C            --

Cairo           T            A            C            --

ZRS             G            A            C            --
Addis           G            A            C            --
Ababa
Madrid E        G            A            C            A
Evir            G            A            C            --

              rp181                rp195             rp272-
                                                     rp273

Strain       713-714        140          1529        52-53

GvV-250         --       TACTTCAAG        C            AA
                         CTCATTTCG

GvF-16          --       TACTTCAAG        C            AA
                         CTCATTTCG

Breinl          --       TACTTCAAG        G            --
                         CTCATTTCG

Cairo           G        TACTTCAAG        G            A
                         CTCATTTCG

ZRS             G            --           G            AA
Addis           G            --           G            AA
Ababa
Madrid E        GG           --           G            AA
Evir            GG           --           G            AA

              rp308-                   rp691-rp692
              rp309

Strain         306       1306-1307       1415          GT

GvV-250      GTCATTA         TT           G            1
              TCGTAT

GvF-16       GTCATTA         TT           G            2
              TCGTAT

Breinl       GTCATTA         --           --           3
              TCGTAT

Cairo        GTCATTA         --           --           4
              TCGTAT

ZRS             --           TT           --           5
Addis           --           TT           --           5
Ababa
Madrid E        --           TT           --           6
Evir            --           TT           --           7

* Gene names or intergenic spacers between genes.

([dagger]) Positions of nucleotides with mutation, which were counted
from the first nucleotide of the coding sequence or the first
nucleotide after the stop codon in the case of intergenic spacers;
-, deletion of nucleotides, in which the number of nucleotides deleted
equals the nucleotides in the same column for the corresponding
strains that do not have the deletion. For example, in rp181, the
GvV-250 strain has 1 deleted nucleotide when compared with the Cairo
strain, but it has deleted 2 nucleotides when compared with the
E strain.