Printer Friendly
The Free Library
14,573,802 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Genotyping, orientalis-like Yersinia pestis, and plague pandemics.


Three pandemics have been attributed to plague in the last 1,500 years. Yersinia pestis Yersinia pes·tis
n.
A bacterium that causes plague and is transmitted from rats to humans by the rat flea Xenopsylla cheopis. Also called Pasteurella pestis.
 caused the third, and its DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 was found in human remains from the second. The Antiqua biovar of Y. pestis may have caused the first pandemic pandemic /pan·dem·ic/ (pan-dem´ik)
1. a widespread epidemic of a disease.

2. widely epidemic.


pan·dem·ic
adj.
Epidemic over a wide geographic area.

n.
; the other two biovars, Medievalis and Orientalis, may have caused the second and third pandemics, respectively. To test this hypothesis, we designed an original genotyping system based on intergenic spacer sequencing called multiple spacer typing (MST See micro systems technology. ). We found that MST differentiated every biovar in a collection of 36 Y. pestis isolates representative of the three biovars. When MST was applied to dental pulp dental pulp
n.
The soft tissue forming the inner structure of a tooth and containing nerves and blood vessels. Also called tooth pulp.
 collected from remains of eight persons who likely died in the first and second pandemics, this system identified original sequences that matched those of Y. pestis Orientalis. These data indicate that Y pesos caused cases of Justinian plague. The two historical plague pandemics were likely caused by Orientalis-like strains.

**********

Yersinia pestis, a group A bioterrorism agent (1), causes plague, a reemerging zoonotic disease Noun 1. zoonotic disease - an animal disease that can be transmitted to humans
zoonosis

animal disease - a disease that typically does not affect human beings
 transmitted to humans through flea bites and typically characterized by the appearance of a tender and swollen lymph node lymph node

Small, rounded mass of lymphoid tissue contained in connective tissue. They occur all along lymphatic vessels, with clusters in certain areas (e.g., neck, groin, armpits).
, the bubo bubo /bu·bo/ (bu´bo) an enlarged and inflamed lymph node, particularly in the axilla or groin, due to such infections as plague, syphilis, gonorrhea, lymphogranuloma venereum, and tuberculosis.  (2). This organism has been subdivided into three biovars on the basis of their abilities to ferment ferment /fer·ment/ (fer-ment´) to undergo fermentation; used for the decomposition of carbohydrates.

fer·ment
n.
1.
 glycerol glycerol, glycerin, glycerine, or 1,2,3-propanetriol (prō`pāntrī'ŏl), CH2OHCHOHCH2OH, colorless, odorless, sweet-tasting, syrupy liquid.  and to reduce nitrate. Based on their current geographic niche and on historical records that indicate the geographic origin of the pandemics, researchers have postulated that each biovar caused a specific pandemic (2,3). Biovar Antiqua, from East Africa, may have descended from bacteria that caused the first pandemic, whereas Medievalis, from central Asia, may have descended from the bacteria that caused the second pandemic. Bacteria linked to the third pandemic are all of the Orientalis biovar (3). In this study, we tested this hypothesis for the first time by detecting biovars in ancient human remains.

No molecular biology-based method proved reliable and convenient for Y. pestis genotyping. Genome sequences of Y. pestis strain CO92, a Orientalis biovar, and Y. pestis strain KIM, a Medievalis biovar, are now available (4,5), which provides an opportunity to examine them for differences associated with the biovar and for genotyping. Genome analysis of the closely related Rickettsia prowazekii Rickettsia pro·wa·zek·i·i
n.
A bacterium that causes epidemic typhus fever.
 (6) and R. conorii (7) showed that intergenic spacers, which have been submitted to less evolutionary pressure Evolutionary pressure or selection pressure can be formalized as an external pressure applied to a process, thereby pushing that process in a distinct direction.  than coding sequences, may be variable enough to differentiate closely related microorganisms. We, therefore, hypothesized that sequencing of several intergenic spacers would allow determination of a biovar-specific spacer pattern in Y. pestis. We named this method multiple spacer typing (MST). We first demonstrated that MST allowed biovar genotyping of a large collection of Y. pestis isolates and further applied it to the dental pulp collected from persons whose deaths are attributed to the first and second pandemics.

Methods

Bacterial Strains

Thirty-five strains representative of the three Y. pestis biovars (11 Antiqua isolates, 12 Medievalis isolates, and 12 Orientalis isolates) isolated from 1947 to 1996 from various host species in 13 countries are presented in Table 1. Nineteen of these isolates have been previously characterized by Achtman et al. (8). Nucleic acid nucleic acid, any of a group of organic substances found in the chromosomes of living cells and viruses that play a central role in the storage and replication of hereditary information and in the expression of this information through protein synthesis.  was extracted as previously described (9), and species identification was confirmed for all the strains by partial sequencing of the rpob gene (10).

Spacer Sequence Database and Phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 Analyses

We analyzed the complete genome sequences of Y. pestis strain CO92, biovar Orientalis (GenBank accession no. NC-003143) (4) and Y. pestis strain KIM, biovar Medievalis (GenBank accession no. NC-004088) (5), which were obtained from the Kyoto Encyclopedia of Genes and Genomes (KEGG KEGG Kyoto Encyclopedia of Genes and Genomes ) database (11). We used the Primer3 program (http://frodo.wi.mit.edu/cgi-birdprimer3/primer3_www.cgi) to determine the primer sequences specific for the genomic segments of interest (12). The primers flanked intergenic sequences of Y. pestis CO92 that exhibited large sequence differences with the homologous homologous /ho·mol·o·gous/ (ho-mol´ah-gus)
1. corresponding in structure, position, origin, etc.

2. allogeneic.


ho·mol·o·gous
adj.
1.
 Y. pestis KIM strain sequences. We generated a list of Y. pestis CO92 intergenic sequences of 50 to 300 bp and carried out BLASTN searches to identify the homologous intergenic sequences in Y. pestis KIM strain by using the Y. pestis CO92 genes flanking the intergenic sequences as queries (13). When both genes flanking the intergenic sequence exhibited best-matches with the BLAST score >120 bits, we estimated the length of the corresponding intergenic sequence in the Y. pestis KIM strain. We then aligned the homologous intergenic sequences ([less than or equal to] 300 bp) and selected eight pairs of sequences with insertion or deletion divergence between the two Y. pestis biovars to locate the primers (Table 2). Two microliters of DNA extracted as previously described (9) were amplified in a 50-[micro]L mixture containing 10 pmol of each primer; 200 [micro]mol/L (each) dATP, dCTP, dGTP, dTTP (Invitrogen, Cergy-Pontoise, France); 1.5 U Taq DNA polymerase DNA polymerase /DNA po·lym·er·ase/ (pah-lim´er-as) any of various enzymes catalyzing the template-directed incorporation of deoxyribonucleotides into a DNA chain, particularly one using a DNA template.  (Invitrogen); and 2.5 [micro]L of a 50-mM solution of Mg[Cl.sub.2] in 1 x Taq buffer. Each polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) was performed in a T3 thermocycler (Biometra, Archamps, France) under the following conditions: an initial 5 min of denaturation denaturation, term used to describe the loss of native, higher-order structure of protein molecules in solution. Most globular proteins exhibit complicated three-dimensional folding described as secondary, tertiary, and quarternary structures.  at 95[degrees]C was followed by 39 cycles of denaturation for 30 s at 94[degrees]C, annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  for 30 s at 60[degrees]C, and extension for 1 min at 72[degrees]C. The amplification was completed by holding the reaction mixture for 5 min at 72[degrees]C to allow complete extension of PCR products. These products were purified by using the Multiscreen PCR plate (Millipore Corp., Bedford, MA), as described by the manufacturer. Sequencing reactions were carried out with a DNA sequencing DNA sequencing

The determination of the sequence of nucleotides in a sample of DNA.
 kit (Big Dye Terminator Cycle Sequencing V2.0; PE Biosystem, Courtaboeuf, France), as described by the manufacturer. Sequencing products were purified and underwent electrophoresis with the 3100 Genetic Analyzer (Applied Biosystems Applied Biosystems, Inc. (formerly NASDAQ: ABIO) is the original name of a pioneer biotechnology company founded in 1981 in Foster City, California, among the Silicon Valley cities of the southern San Francisco Bay Area. ) and aligned by using the multisequence alignment CLUSTALX version 1.8 (13).

For phylogenetic analyses, DNA sequences were aligned by using the CLUSTALW software, version 1.81 (13). Because variations among spacer sequences were only due to deletions (see below), every deletion was considered a unique molecular event that resulted in a unique mismatch, regardless of its length. For any position in the spacer sequence, identity of nucleotide was coded "1"; a mismatch was coded "0"; and a pairwise binary matrix In mathematics, particularly matrix theory, a binary matrix or (0,1)-matrix is a matrix in which each entry is either zero or one. For example:

is a 2 × 2 binary matrix.
 was constructed with the MEGA 2.1 software package (14). Distance matrices were determined by using p-distance analysis and were used to infer dendrograms by the unweighted pair group method with arithmetic mean (mathematics) arithmetic mean - The mean of a list of N numbers calculated by dividing their sum by N. The arithmetic mean is appropriate for sets of numbers that are added together or that form an arithmetic series.  (UPGMA UPGMA Unweighted Pair Group Method, Arithmetic Mean ), maximum parsimony Maximum parsimony, often simply referred to as "parsimony," is a non-parametric statistical method commonly used in computational phylogenetics for estimating phylogenies. Under maximum parsimony, the preferred phylogenetic tree is the tree that requires the least number of , and neighbor-joining, available in the MEGA 2.1 software package (14). We also used the maximum likelihood method within the PHYLIP PHYLIP Phylogeny Inference Package (genetics software)  software package (15).

Sources of Ancient DNA
Adna redirects here. For the unincorporated community in Washington, see Adna, Washington.
Ancient DNA can be loosely described as any DNA recovered from biological samples that have not been preserved specifically for later DNA analyses.


The Anthropology Laboratory of Bordeaux University 1 studied a first series of 60 skeletons discovered during excavations in 1989 in Sens, France. The skeletons were buried in four adjoining mass graves, dated by radiocarbon ra·di·o·car·bon  
n.
A radioactive isotope of carbon, especially carbon 14.


radiocarbon
Noun

a radioactive isotope of carbon, esp.
 to be from the 5th to 6th century A.D. (16). The second series came from a cemetery in Dreux, France, where nine mass graves were identified during excavations in 1990 (online Figure 1, available at http://www.cdc.gov/nci-dod/EID/vol10no9/03-0933-G1.htm). Each grave contained 2-22 skeletons. Ceramic fragments, found in the burial site, dated the graves from the 12th to the 14th century A.D. (17). Archeological data (burial patterns) and anthropologic data (absence of bone fractures, indications of sex and age of persons) supported the hypothesis that the two grave sites contained remains of persons who died during an epidemic. No historical written records for the Sens and Dreux grave sites exist, but comparisons with demographic models suggest that the graves resulted from the Justinian plague (6th-8th century) and the Black Death, respectively. The Saint-Come and Saint-Damien site in Montpellier had been used as a church cemetery outside the city walls during the 9th to 17th centuries A.D. (18). Four graves have been dated as having been dug in the 13th and late 14th centuries, on the basis of their position on top of a 13th-century remblai (a small hill created by burying bodies) and the fact that they were behind a wall that dated from the second half of the 14th century. Dating of the different parts of this site was based on historical data, stratigraphy stratigraphy, branch of geology specifically concerned with the arrangement of layered rocks (see stratification). Stratigraphy is based on the law of superposition, which states that in a normal sequence of rock layers the youngest is on top and the oldest on the , the study of 7,059 ceramic fragments, and [sup.14]C dating.

[FIGURE 1 OMITTED]

We collected 10 teeth from three skeletons in Sens, 4 teeth from three skeletons in Dreux, and 5 teeth from two skeletons in Montpellier. The teeth were washed thoroughly with sterile phosphate-buffered saline and fractured longitudinally. Powdery pow·der·y  
adj.
1. Composed of or similar to powder.

2. Dusted or covered with or as if with powder.

3. Easily made into powder; friable.

Adj. 1.
 remnants of dental pulp were scraped into sterile tubes for DNA extraction DNA extraction is a routine procedure to collect DNA for subsequent molecular or forensic analysis. Outline of a DNA extraction
There are three basic steps in a DNA extraction, the details of which may vary depending on the type of sample and any substances that may
, as previously described (19). Seventeen teeth collected from contemporary dental patients in Marseille without any evidence of plague were used as negative control teeth ("negative teeth").

Amplification of Ancient Y. pestis

MST was applied to DNA extracted from 19 teeth from the remains of eight persons in one Justinian era burial and two graves from the time of the second pandemic, as described above. We instituted precautions to avoid bacteriologic bac·te·ri·ol·o·gy  
n.
The study of bacteria, especially in relation to medicine and agriculture.



bac·te
 and molecular contamination of ancient material (online Figure 2, available from http://www.cdc.gov/nci-dod/EID/vol10no9/03-0933-G2.htm). Two successive experiments were conducted. Dental pulp was recovered in a Y. pestis--free building A by two operators (operators 1 and 2), who had never worked with Y. pestis, its DNA, or amplicons. Teeth were processed individually by cleaning and opening the tooth and recovering the dental pulp into a sterile tube, which was closed securely. Each tooth was processed separately in chronologic order from Justinian to Black Death material, and negative control teeth were processed at the end. New sterile forceps were used for every tooth. Dental pulps were then transported into another laboratory, B1, 200 m away from building A, and to building C, 600 m away from building A for DNA extraction. It was performed by operator 3, who also had never worked with Y. pestis. DNA extraction for each experiment was performed with new reagents, ordered directly from the distributors by operators 1 and 3, who followed the protocol for good practices for ancient DNA manipulation (20). Extracted DNA was submitted to a second laboratory in building B2/D for suicide PCRs (18), which were conducted with one negative control for every three specimens. Finally, amplicons were transported to building D for cloning and sequencing, which was carried out by operators 4 to 6, who had never worked with Y. pestis. PCR products were cloned in PGEM-T Easy Vector (Promega, Charbonnieres, France), as described by the manufacturer. Six clones were cultivated in LB medium (USB USB
 in full Universal Serial Bus

Type of serial bus that allows peripheral devices (disks, modems, printers, digitizers, data gloves, etc.) to be easily connected to a computer.
, Cleveland, OH) overnight, and plasmid purification was performed by using the Promega system. Six clones were sequenced from every amplicon by consensus primers. The sequences were compared with sequences available in GenBank by using the BLAST software version 2.2.8 to ensure accurate species identity. The sequences were further compared by using the BLAST software version 2.2.8 with our local Y. pestis spacer sequence database to ensure proper biovar identity.

[FIGURE 2 OMITTED]

Results

Y. pestis Spacer Database

All the isolates were firmly identified as belonging to Y. pestis species on the basis of their phenotypic profile and partial analysis of 16S rRNA gene and rpoB gene sequences. A total of eight intergenic spacers located throughout Y. pestis genome (Table 1) yielded 2-9 alleles per spacer, resulting in a total of 23 molecular events potentially corresponding to >8 x [10.sup.6] combinations ([2.sup.23] molecular events). The 387-bp spacer YP1 exhibited a 183-bp deletion specific for the Medievalis isolates. For spacer YP3, we observed five alleles: Orientalis isolates 1513 and 695 exhibited a complete, 340-bp sequence, and the other Orientalis isolates exhibited a 16-bp deletion; Medievalis isolates featured a 48-bp deletion and a mutation G [right arrow] A at position 135 of the spacer; Antiqua isolates exhibited a 32-bp deletion except for isolate 611, which had a 16-bp deletion and mutations [C.sub.164] [right arrow] T, [C.sub.166] [right arrow] T and [A.sub.191] [right arrow] G. Spacer YP3 thus differentiated every biovar. As for spacer YP4, Medievalis isolates were characterized by a 36-bp deletion, whereas Antiqua and Orientalis isolates exhibited a complete spacer. For spacer YP5, Medievalis isolates exhibited a full-length 292-bp spacer, whereas Antiqua and Orientalis isolates exhibited a 32-bp deletion at position 101 of the spacer. For spacer YP7, a total of nine alleles were found; Antiqua isolates were classified within seven alleles, Medievalis isolates within four alleles, and Orientalis isolates within five alleles. Alleles two and three were found only among Orientalis isolates. A full-length sequence of 330 bp was found for strain 549; the other isolates exhibited deletions. At position 126 in the spacer, strains 643 and 695 exhibited a 56-bp deletion; at position 133, strains 304, 1092, 507 and 571 exhibited a 49-bp deletion; at position 140, strains 611, 685, and 537 exhibited a 42-bp deletion; at position 142, strains 616, 548, 565, 518, 520, 560, 56l, and 670 exhibited a 35-bp deletion; at position 149, strains 519, 542, 566, 564, and 1513 exhibited a 28-bp deletion; at position 155, strains 552, 613, 772, and 989 exhibited a 21-bp deletion; at position 162, strains 550, 677, and 1594 exhibited a 14-bp deletion; and at position 169 in the spacer, strains 544, 553, and 545 exhibited a 7-bp deletion. As for spacer YP8, Antiqua and Medievalis isolates exhibited a full-length 236-bp spacer, whereas Orientalis isolates had an 18-bp deletion at position 36 of the spacer. As for spacer YP9, Antiqua and Medievalis isolates exhibited a full-length 292-bp sequence; Orientalis isolates had an 18-bp deletion located at position 123 of the spacer. As for YPI YPI Youth and Philanthropy Initiative (Canada)
YPI Yearly Planning Instrument
YPI Young People's Initiative
YPI Young Peoples' Institute
YPI Young Principal Investors
0 spacer, Y. pestis CO92 strain had a unique sequence of 369-bp; all the oilier isolates exhibited an 18-bp deletion located at position 177 of the spacer. Sequences herein determined were deposited in GenBank (Appendix 1; available from http://www.cdc.gov/neided/EID/vol10no9/03-0933_appl.htm).

Phylogenetic Analysis

Among the 35 studied Y. pestis strains, we identified three main phylogenetic clusters, each of which included only strains from a single biovar, i.e., Orientalis, Medievalis, or Antiqua, as observed in the unrooted dendrogram A dendrogram is a tree diagram frequently used to illustrate the arrangement of the clusters produced by a clustering algorithm (see cluster analysis). Dendrograms are often used in computational biology to illustrate the clustering of genes.  (Figure 1). The same topology was obtained when data were analyzed by parsimony par·si·mo·ny  
n.
1. Unusual or excessive frugality; extreme economy or stinginess.

2. Adoption of the simplest assumption in the formulation of a theory or in the interpretation of data, especially in accordance with the rule of
, neighbor-joining, and maximum likelihood analyses (online Figure 3; available from http://www.cdc.gov/ncidod/EID/vollOno9/O30933-G3.htm) Within the Medievalis cluster, strains 519 and 616, and strains 557 and 564 were grouped by pairs; no other subgroup was identified. Within the Orientalis cluster, three groups were identified; one group included strains 989, 613, 772, and 1513; a second group was made up of three pairs of strains, i.e., 304 and CO92, 507 and 571, and 685 and 1537; the third group diverged before the differentiation of the other two groups and contained strains 695 and 643. Within the Antiqua cluster, two groups were identified; one group included strains 553, 544, 545,550, and 677, with the last two clustered; the second group comprised strains 552,542, and 566; strains 548 and 549 did not group with either of these two groups but diverged before the differentiation of the other Antiqua strains. The Antiqua strain 611 exhibited a unique phylogenetic position. This strain differed from all other studied Y. pestis strains and appeared to have diverged before the separation of the three main clusters.

MST of Ancient Dental Pulp Specimens

In the 46 PCR experiments we performed on ancient tooth samples, we obtained 10 Y. pestis sequences (Figure 2); no sequences were found in the 51 PCR experiments with control teeth (p < [10.sup.-4]). The teeth from 7 of the 8 persons' remains yielded 10 specific sequences, 3 persons were positive for two molecular targets, but none of the teeth of 17 persons used as negative controls yielded specific sequences (p < 104). YPI PCR yielded an amplicon in one of six tested persons, YP8 PCR yielded an amplicon with identical sequence in six of six tested persons, and YP3 PCR yielded an amplicon in three of seven tested persons. When compared with GenBank database (Appendix 2, available from http://www.cde.gov/ncided/EID/vol10 no9/03-0933_app2.htm), the YP1 sequence obtained in skeleton 5 yielded complete similarity with the homologous region in Y. pestis CO92 strain over 390 positions and 99% sequence similarity with the homologous region in X pestis KIM strain over 174 positions; the YP8 sequence obtained in the six persons yielded 99% sequence similarity with homologous region in Y. pestis C092 strain over 178 positions and complete sequence identity with homologous region in Y. pestis KIM strain over 116 positions; the YP3 sequence obtained in skeletons 4 and 8 yielded complete sequence identity with that of homologous region in Y. pestis strain CO92 over 364 positions and 98% sequence similarity with homologous region in Y. pestis KIM strain over 206 positions; the YP3 sequence obtained in human remain 2 yielded a 98% similarity with homologous region in Y. pestis CO92 strain over 283 positions and a 95% similarity with homologous region in Y. pestis KIM strain over 162 positions. For each one of these 10 amplicons, further matches dropped to <90% sequence similarity over short sequences of 10 not to 50 nt. When blasted to our local Y. pestis spacer sequence database, the YP1 spacer sequence obtained in human skeleton The human skeleton consists of both fused and individual bones supported and supplemented by ligaments, tendons, muscles and cartilage. Fused bones include those of the pelvis and the cranium. Osteocytes are present in the bone matrix.  5 was identical to that of the Orientalis and Antiqua reference sequences (Appendix 3; available from http://www.cdc.gov/ncided/EID/vol10 no9/03-0933_app3.htm), whereas smaller BLAST scores were obtained for the Medievalis reference sequences. Regarding the six YP8 spacer sequences obtained in skeletons 1-6, the 12 first best scores were obtained with Orientalis reference sequences. For the YP3 spacer sequence obtained in skeletons 4 and 8, the 10 first best scores were obtained with Orientalis reference sequences. For the YP3 spacer sequence obtained in skeleton 2, the 10 first best scores were obtained with Orientalis reference sequences, and this amplicon exhibited two specific nucleotide substitutions (Figure 2; Appendix 2). These mutations were consistently obtained in six clones.

Discussion

Our data show that MST differentiates the three biovars of Y. pestis in a collection of 35 isolates representative of the three biovars and originating from various sources and 13 countries. This finding suggests that MST data can be extrapolated to the entire Y. pestis species. Pulsed-field gel electrophoresis gel electrophoresis
n.
Electrophoresis performed in a gel composed of agarose, polyacrylamide, or starch.
 (PFGE PFGE Pulsed-Field Gel Electrophoresis ) has been the only other technique that allows for biovar and strain differentiation, but it requires large amounts of cultured microorganisms, and the stability of PFGE profiles in subculture subculture /sub·cul·ture/ (sub´kul-chur) a culture of bacteria derived from another culture.

sub·cul·ture
n.
 has been questioned (9). Rib typing did not classify isolates into their respective biovars (9,21,22). Specific insertion sequences (IS), including IS100 (23), IS285 (24,25), and 1SI541 (26,27), were used as markers in restriction fragment length polymorphism restriction fragment length polymorphism
n. Abbr. RFLP
Intraspecies variations in the length of DNA fragments generated by the action of restriction enzymes and caused by mutations that alter the sites at which these enzymes act, changing
 (RFLP RFLP
abbr.
restriction fragment length polymorphism



RFLP

restriction fragment length polymorphism.

RFLP 
) analyses (8,28) and in PCR-based technique (29). The last approach produced identical patterns of IS100 distribution in Antiqua and Medievalis isolates (29). A variable-number tandem repeat This is a term from genetics, which describes a pattern that helps determine an individual's inherited traits.

Tandem repeats and variable number tandem repeats in DNA occur when a pattern of two or more nucleotides is repeated and the repetitions are directly adjacent to
 technique (30, 31) had a greater discrimination capacity than did rib typing, but isolates from different areas were found to harbor identical types. Sequencing of fragments of five housekeeping genes in 36 Y. pestis isolates from various locations and from 12 to 13 isolates from Y. pseudotuberculosis and Y. enterocolitica did not show diversity in any Y. pestis housekeeping gene (8). Indeed, 19 of these 36 Y. pestis isolates were also included in the present work and featured 12 different MST profiles, thus demonstrating the validity of our hypothesis and the usefulness of MST for Y. pestis genotyping. Morever, its format is applicable to microbial microbial

pertaining to or emanating from a microbe.


microbial digestion
the breakdown of organic material, especially feedstuffs, by microbial organisms.
 analyses of ancient samples since it requires small amounts of DNA and targets small genomic fragments.

Few studies have aimed to disclose intraspecific in·tra·spe·cif·ic   also in·tra·spe·cies
adj.
Arising or occurring within a species: intraspecific competition.
 phylogenetic relationships of Y. pestis isolates. RFLP, probed with the IS100, indicated that, among 36 Y. pestis isolates, the three biovars formed distinct branches of the phylogenetic tree phylogenetic tree

Diagram showing the evolutionary interrelations of a group of organisms that usually originated from a shared ancestral form. The ancestor is in the tree trunk; organisms that have arisen from it are placed at the ends of tree branches.
 and that Y. pestis was a clone that evolved from Y. pseudotuberculosis 1,500-20,000 years ago (8). Isolates of biovars Antiqua and Medievalis clustered altogether apart from those belonging to biovar Orientalis. Likewise, a dendrogram constructed by the UPGMA clustering method on a PCR-based ISIO ISIO Instrument Serial Input/Output 0 fingerprint database clearly discriminated Y. pestis isolates of the Orientalis biovar that formed a homogeneous group, whereas isolates of the Antiqua and Medievalis biovars mixed together (29). Isolates of biovar Antiqua showed a variety of fingerprinting profiles, whereas Medievalis isolates clustered with the Antiqua isolates originating from Southeast Asia Southeast Asia, region of Asia (1990 est. pop. 442,500,000), c.1,740,000 sq mi (4,506,600 sq km), bounded roughly by the Indian subcontinent on the west, China on the north, and the Pacific Ocean on the east. , which suggests their close phylogenetic relationships. In this study, one isolate (strain Nicholisk 51) displayed a genotyping pattern typical of biovar Orientalis isolates, although this isolate was biovar Antiqua and lacked a 93-bp deletion within the glycerol-3-phosphate dehydrogenase Glycerol-3-phosphate dehydrogenase (GPDH) is an Nicotinamide adenine dinucleotide-dependent enzyme that catalyzes the oxidation of sn-glycerol 3-phosphate to dihydroxyacetone phosphate (aka glycerone phosphate, outdated).  glpD gene characteristic for the glycerol-negative Orientalis biovar. Our data support the view that most Y. pestis isolates cluster according to according to
prep.
1. As stated or indicated by; on the authority of: according to historians.

2. In keeping with: according to instructions.

3.
 their biovar, but isolates of biovar Antiqua are more distantly related to other isolates than biovars Orientalis and Medievalis are. MST-based phylogenetic reconstructions unexpectedly found that one Y. pestis Antiqua isolate, number 611, formed a fourth branch, which suggests that Y. pestis may comprise four different lineages instead of the three that have been recognized so far. This unique isolate had not been included in Achtman and collaborators' study (8).

MST was applied to ancient human specimens to test the hypothesis that three biovars were responsible for the three historical pandemics. Contamination of ancient samples by modem Y. pestis DNA and cross-contamination were prevented in our experiments. Indeed, we carried out two independent experiments, each with new reagents, in a laboratory where Y. pestis had never been introduced or studied, without positive controls (17).

Both experiments produced consistent results, and negative controls were always negative. That we obtained a unique YP3 sequence further excludes the possibility of contamination, since this sequence differs from all the currently known sequences. This unique sequence was consistently found in six of six clones and thus did not result from the false incorporation of nucleotides by the DNA polymerase. In our previous work on the Black Death, we also reported a unique sequence (17). In the present study, the accurate identification of Y. pestis was confirmed by using two successive sequence analyses. We first blasted the sequences derived from ancient specimens against the GenBank database and observed best matches for Y. pestis homologous sequences, thus ensuring accurate species identification of the amplicons. We then blasted these sequences against our local Y. pestis spacer sequence database and found best matches for homologous sequence in Orientalis reference isolates for the three tested spacers. As our local database has 35 different reference sequences representative of the three Y. pestis biovars, there is no doubt regarding the identification nor the fact that Orientalis-like Y. pestis alone was implicated im·pli·cate  
tr.v. im·pli·cat·ed, im·pli·cat·ing, im·pli·cates
1. To involve or connect intimately or incriminatingly: evidence that implicates others in the plot.

2.
 in the personal remains that we investigated. DNA of Y. pestis was recovered from remains of persons in one mass grave established to be of the Justinian pandemic era on the basis of radiocarbon dating radiocarbon dating
n.
The determination of the approximate age of an ancient object, such as an archaeological specimen, by measuring the amount of carbon 14 it contains. Also called carbon dating, carbon-14 dating.
 (online Figure 4, available at http://www.cdc.gov/ncidod/EID/vol10no9/03-0933-G4.htm).

We found that the genotype genotype (jēn`ətīp'): see genetics.
genotype

Genetic makeup of an organism. The genotype determines the hereditary potentials and limitations of an individual.
 Orientalis, which now occurs worldwide, was involved in all three pandemics. Also, we detected Y. pestis in additonal human remains from Black Death sites, which adds more evidence for its role in the second pandemic in southern France Southern France (or the South of France), colloquially known as Le Midi, is a loosely defined geographical area consisting of the regions of France that border the Atlantic Ocean south of the Gironde, Spain, the Mediterranean Sea, Italy, and Switzerland south of the  (four sites tested positive) (18, 19). Indeed, historical descriptions were suggestive of suggestive of Decision making adjective Referring to a pattern by LM or imaging, that the interpreter associates with a particular–usually malignant lesion. See Aunt Millie approach, Defensive medicine.  bubonic plague bubonic plague: see plague.

bubonic plague

ravages Oran, Algeria, where Dr. Rieux perseveres in his humanitarian endeavors. [Fr. Lit.: The Plague]

See : Disease
 in medieval southern Europe Southern Europe or sometimes Mediterranean Europe is a region of the European continent. There is no clear definition of the term which can vary depending on whether geographic, cultural, linguistic or historical factors are taken into account. ; in northern Europe, historical data indicated that the Black Death had a different epidemiologic pattern. This finding may indicate that latter outbreaks in the north were not caused by transmission of Y. pestis by blocked rat fleas but rather by mechanical transmission of plague bacteria by another ectoparasite ec·to·par·a·site
n.
A parasite that lives on the surface or exterior of the host organism, such as an ectophyte or an ectozoon.



ec
 that used humans as their primary hosts. Alternatively, another pathogen may have caused these outbreaks, and a search for Y. pestis in the dental pulps of suspected plague victims in Copenhagen (two persons' remains) and Verdun (five persons" remains) dating from the 18th century failed to show Y. pestis DNA (32). Further studies may elucidate the respective role of Y. pestis and other pathogens that may have contributed to deaths in these times.
Table 1. Alleles of eight spacers in three Versinia pestis biovars

Biovar        YP no. strains     Country      YP1    YP3    YP4

Antiqua
                611/Japan         Japan        1      4      1
               552/Margaret       Kenya        1      3      1
                 548/343         Belgium       1      3      1
                   544            Congo        1      3      1
                   549            Kenya        1      3      1
                   542           Belgium       1      3      1
                   550            Congo        1      3      1
                   553            Kenya        1      3      1
                   566            Kenya        1      3      1
                   677            Kenya        1      3      1
                   545            Kenya        1      3      1
Medievalis
                519/PKH-4       Kurdistan      2      2      2
                616/PAR-13         Iran        2      2      2
                557/PKR292      Kurdistan      2      2      2
                   564          Kurdistan      2      2      2
                   565            Turkey       2      2      2
                   557          Kurdistan      2      2      2
                   518          Kurdistan      2      2      2
                   520          Kurdistan      2      2      2
                   560          Kurdistan      2      2      2
                   561          Kurdistan      2      2      2
                   617             Iran        2      2      2
                   670          Kurdistan      2      2      2
                   1594         Kurdistan      2      2      2
Orientalis
                 304/6-69       Madagascar     1      5      1
                   685           Germany       1      5      1
                Hamburg10          USA         1      5      1
                   CO92            USA         1      5      1
                   507           Vietnam       1      1      1
                   1513         Madagascar     1      5      1
                   571            Brazil       1      5      1
                   613           Myanmar       1      5      1
                   643          Madagascar     1      5      1
                   695           Germany       1      1      1
                   772           Vietnam       1      5      1
                   989           Vietnam       1      5      1

Biovar        YP no. strains    YP5    YP7    YP8    YP9     YP10

Antiqua
                611/Japan        3      1      1      1       1
               552/Margaret      1      4      1      1       1
                 548/343         1      5      1      1       1
                   544           1      7      1      1       1
                   549           1      8      1      1       1
                   542           1      6      1      1       1
                   550           1      9      1      1       1
                   553           1      7      1      1       1
                   566           1      6      1      1       1
                   677           1      9      1      1       1
                   545           1      7      1      1       1
Medievalis
                519/PKH-4        2      1      1      1       1
                616/PAR-13       2      1      1      1       1
                557/PKR292       2      4      1      1       1
                   564           2      6      1      1       1
                   565           2      5      1      1       1
                   557           2      4      1      1       1
                   518           2      5      1      1       1
                   520           2      5      1      1       1
                   560           2      5      1      1       1
                   561           2      5      1      1       1
                   617           2      5      1      1       1
                   670           2      5      1      1       1
                   1594          2      9      1      1       1
Orientalis
                 304/6-69        1      1      2      2       1
                   685           1      2      2      2       1
                Hamburg10        1      2      2      2       2
                   CO92          1      2      2      2       1
                   507           1      6      2      2       1
                   1513          1      2      2      2       1
                   571           1      4      2      2       1
                   613           1      3      2      2       1
                   643           1      3      2      2       1
                   695           1      4      2      2       1
                   772           1      4      2      2       1
                   989           1      1      2      2       1

                                Isolate
Biovar        YP no. strains     type

Antiqua
                611/Japan          1
               552/Margaret        2
                 548/343           3
                   544             4
                   549             5
                   542             6
                   550             7
                   553             4
                   566             6
                   677             7
                   545             4
Medievalis
                519/PKH-4         10
                616/PAR-13         8
                557/PKR292         9
                   564            10
                   565             8
                   557             9
                   518             8
                   520             8
                   560             8
                   561             8
                   617             8
                   670             8
                   1594           11
Orientalis
                 304/6-69         12
                   685            13
                Hamburg10         14
                   CO92           13
                   507            15
                   1513           16
                   571            17
                   613            18
                   643            18
                   695            17
                   772            17
                   989            19

Table 2. Location of primers used for PCR amplification and sequencing
of eight intergenic spacers in Yersinia pestis (a)

              Upstream gene (N)           Primer sequence
Spacer       Downstream gene (N)       (5' [right arrow] 3')

YP1            ace K (YP03724)         AATCCCTGCAAAATGGTCTG
               ace A (YP03725)         CTGATGGGAAGCAAAGGTGT
YP3            glg P (YP03938)         TCAGTGCATCCACACTGACA
               glg A (YP03939)         CGTATCGCCTTCACTAAGGC
YP4       gene ID 1176814 (YP03976)    TAATCCGCCGTGGAAATTAG
                gor (YP03977)          ACGATTATCTGGCAATTGGC
YP5       Gene ID 1175557 (YP02727)    GCATGCGCTGTTTGATATTG
          Gene ID 1175558 (YP02728)    TTATGACTCACGGACGATGC
YP7            lex A (YP00314)         GTAACGGGGACTGGATCTGA
          Gene ID 1173160 (YP00315)    ATAAACCGTGTGCTTCCACC
YP8       Gene ID 1175559 (YP02729)     ACGGAAATTGCCAGATTCA
          Gene ID 1175560 (YP02730)    GACTTGAGCTTCATTTGGCC
YP9            mrd F (YP02648)         GCGCTGATACGTGTTATTGG
               mrd E (YP02649)         TTGTTAATATCGCGGGTGGTA
YP10           bio D (YP02269)         ATGCTGAAACAATCGCAATG
          Gene ID 1175101 (YP02270)    CAATAAGGTGTACTCGCCGG

(a) Numbering according to the Y. pestis CO92 strain genome, GenBank
accession no. NC-223143). PCR, polymerase chain reaction.


References

(1.) Kortepeter M, Parker G. Potential biological weapons threats. Emerg Infect Dis. 1999;5:523-7.

(2.) Perry RD, Fetherston JD. Yersinia Yersinia

A genus of bacteria in the Enterobacteriaceae family. The bacteria appear as gram-negative rods and share many physiological properties with related Escherichia coli. Of the 11 species of Yersinia, Y. pestis, Y. enterocolitica, and Y.
 pestis-etiologic agent of plague. Clin Microbiol Rev. 1997;10:35-66.

(3.) Wren BW. The yersiniae--a model genus to study the rapid evolution of bacterial pathogens. Nat Rev Microbiol. 2003;1:55-64.

(4.) Parkhill J, Wren BW, Thomson NR, Titball RW, Holden MT, Prentice MB, et al. Genome sequence of Yersinia pestis, the causative agent of plague. Nature. 2001;413:523-7.

(5.) Deng W, Burland V, Plunkett G 3rd, Boutin A, Mayhew GF, Liss P, et al. Genome sequence of Yersinia pestis KIM. J Bacteriol. 2002;184:4601-11.

(6.) Andersson SG, Zomorodipour A, Andersson JO, Sicheritz-Ponten T, Alsmark UC, Podowski RM, et al. The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature. 1998;396:133-40.

(7.) Ogata H, Audic S, Renesto-Audiffren P, Fournier PE, Barbe V, Samson D, et al. Mechanisms of evolution in Rickettsia conorii Rickettsia co·no·ri·i
n.
A bacterium that causes boutonneuse fever in humans.
 and R. prowazekii. Science. 2001;293:2093-8.

(8.) Achtman M, Zurth K, Morelli G, Torrea G, Guiyoule A, Carniel E. Yersinia pestis, the cause of plague, is a recently emerged clone of Yersinia pseudotuberculosis Yersinia pseu·do·tu·ber·cu·lo·sis
n.
A bacterium that causes acute mesenteric lymphadenitis in humans. Also called Pasteurella pseudotuberculosis.
. Proc Natl Acad Sci U S A. 1999;96:14043-8.

(9.) Guiyoule A, Grimont F, Iteman 1, Grimont PA, Lefevre M, Carniel E. Plague pandemics investigated by ribotyping of Yersinia pestis strains. J Clin Microbiol. 1994;32:634-41.

(10.) Mollet C, Drancourt M, Raoult D. rpoB sequence analysis as a novel basis for bacterial identification. Mol Microbiol. 1997;26:1005-11.

(11.) Kanehisa M, Goto S, Kawashima S, Nakaya A. The KEGG databases at GenomeNet. Nucleic Acids Nucleic acids
The cellular molecules DNA and RNA that act as coded instructions for the production of proteins and are copied for transmission of inherited traits.
 Res. 2002;30:42-6.

(12.) Rozen S, Skalestky HJ. Totowa (NJ): Humana Press; 2000. p. 365-86.

(13.) Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST PSI-BLAST Position Specific Iterated Basic Local Alignment Search Tool : a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389-402. *** (14.) Kumar S, Tamura K, Jakobsen IB, Nei M. MEGA 2: molecular evolutionary genetics Evolutionary genetics is the broad field of studies that attempts to account for evolution in terms of changes in gene and genotype frequencies within populations and the processes that convert the variation with populations into more or less permanent variation between species.  analysis software, 2001. Tempe (AZ): Arizona State University Arizona State University, at Tempe; coeducational; opened 1886 as a normal school, became 1925 Tempe State Teachers College, renamed 1945 Arizona State College at Tempe. Its present name was adopted in 1958. ; 2001.

(15.) Felsenstein J. PHYLIP-Phylogeny Inference Package (version 3.2). Cladistics cladistics (klədĭs`tĭks) or phylogenetic systematics (fī'lōjənĕt`ĭk) . 1989;5:164-6.

(16.) Castex D, Friess M. In: Kemkes-Grottenthaler A, Henke W, editors. Pein n. 1. See Peen.  und Plagcn. Aspekte einer Historischen Epidemiologie. Francfort: Archaea archaea: see Archaebacteria.
archaea

A group of prokaryotes whose members differ from bacteria, the most prominent prokaryotes, in certain physical, physiological, and genetic features. The archaea may be aquatic or terrestrial microorganisms.
, Epidemiologic; 1998.

(17.) Cabezuelo U, Castex D. Dolmens, sarcophages et pierces tombales. Chartres: Maison de l'Arch6ologie;1994, p. 68-70.

(18.) Raoult D, A boudharam G, Crubezy E, Larrouy G, Ludes B, Drancourt M. Molecular indentification by "suicide PCR" of Yersinia pestie as the agent of medieval Black Death. Proc Natl Acad Sci U S A. 2000;97:1280-3.

(19.) Drancourt M, Aboudharam G, Signoli M, Dutour O, Raoult D. Detection of 400-year-old Yersinia pestis DNA in human dental pulp: an approach to the diagnosis of ancient septicemia septicemia (sĕptĭsē`mēə), invasion of the bloodstream by virulent bacteria that multiply and discharge their toxic products. The disorder, which is serious and sometimes fatal, is commonly known as blood poisoning. . Proc Natl Acad Sci U S A. 1998;95:12637-40.

(20.) Golenberg EM. Ancient DNA. New York New York, state, United States
New York, Middle Atlantic state of the United States. It is bordered by Vermont, Massachusetts, Connecticut, and the Atlantic Ocean (E), New Jersey and Pennsylvania (S), Lakes Erie and Ontario and the Canadian province of
: Springer-Velag; 1994. p. 237-56.

(21.) Guiyoule A, Rasoamanana B, Buchrieser C, Michel P, Chanteau S, Carniel E. Recent emergence of new variants of Yersinia pestis in Madagascar. J Clin Microbiol. 1997;35:2826-33.

(22.) Lucier TS, Brubaker RR. Determination of genuine size, macrorestriction pattern polymorphism polymorphism, of minerals, property of crystallizing in two or more distinct forms. Calcium carbonate is dimorphous (two forms), crystallizing as calcite or aragonite. Titanium dioxide is trimorphous; its three forms are brookite, anatase (or octahedrite), and rutile. , and nonpigmentation-specific deletion in Yersinia pestis by pulsed-field gel electrophoresis. J Bacteriol. 1992;174:2078-86.

(23.) Portnoy DA, Falkow S. Virulence-associated plasmids from Yersinia enterocolitica Yersinia en·ter·o·co·lit·i·ca
n.
A bacterium that causes yersiniosis.
 and Yersinia pestis. J Bacteriol. 1981;148:877-83.

(24.) Protsenko OA, Filippov AA, Kutyrev VV. Integration of the plasmid encoding the synthesis of capsular antigen capsular antigen
n.
An antigen found only in the capsules of certain microorganisms.
 and murine murine /mu·rine/ (mur´en) pertaining to, derived from, or characteristic of mice or rats.

mu·rine
adj.
 toxin into Yersinia pestis chromosome. Microb Pathog. 1991;11:123-8.

(25.) Filippov AA, Oleinikov PV, Motin VL, Protsenko OA, Smirnov GB. Sequencing of two Yersinia pestis IS elements, IS285 and IS100. Contrib Microbiol Immunol. 1995; 13:306-9.

(26.) Simonet M, Riot B, Fortineau N, Berche P. Invasin production by Yersinia pestis is abolished by insertion of an IS200-like element within the inv gene. Infect Immun. 1996;64:375-9.

(27.) Odaert M, Devalckenaere A, Trieu-Cuot P, Simonet M. Molecular characterization of IS 1541 insertions in the genome of Yersinia pestis. J Bacteriol. 1998;180:178-81.

(28.) McDonough KA, Hare JM. Homology homology (hōmŏl`əjē), in biology, the correspondence between structures of different species that is attributable to their evolutionary descent from a common ancestor.  with a repeated Yersinia pestis DNA sequence IS100 correlates with pesticin sensitivity in Yersinia pseudotuberculosis. J Bacteriol. 1997;179:2081-5.

(29.) Motin VL, Georgescu AM, Elliott JM, Hu P, Worsham PL, Ott LL, et al. Genetic variability Introduction
Genetic Variability
The amount by which individuals in a population differ from one another due to their genes, rather than their environment. The study of genetic variability is that of population genetics.
 of Yersinia pestis isolates as predicted by PCR-based IS100 genotyping and analysis of structural genes encoding glycerol-3-phosphate dehydrogenase (glpD). J Bacteriol. 2002; 184:1019-27.

(30.) Klevytska AM, Price LB, Schupp JM, Worsham PL, Wong J. Keim P. identification and characterization of variable-number tandem repeats in the Yersinia pestis genuine. J Clin Microbiol. 2001;39: 3179-85.

(31.) Adair DM, Worsham PL, Hill KK, Klevytska AM, Jackson PJ, Friedlander AM, et al. Diversity in a variable-number tandem repeat from Yersinia pestis. J Clin Microbiol. 2000;38:1516-9.

(32.) Gilbert MT, Cuccui J, White W, Lynnerup N, Titball RW, Cooper A, et al. Absence of Yersinia pestis-specific DNA in human teeth from five European excavations of putative plague victims. Microbiology. 2004;150:341-54.

Dr. Drancourt is professor of microbiology at Marseille Medical School. His specialties are molecular identification and paleomicrobiology.

Michel Drancourt, * Veronique Roux Roux , Pierre Paul Émile 1853-1933.

French bacteriologist. His work with the diphtheria bacillus led to the development of antitoxins to neutralize pathogenic toxins.
, * La Vu Dang dang  
interj.
Used to express dissatisfaction or annoyance.

adv. & adj.
Damn.

tr.v. danged, dang·ing, dangs
To damn.

n.
, * Lam Tran-Hung, * Dominique Castex, ([dagger]) Viviane Chenal-Francisque, ([double dagger double dagger
n.
A reference mark () used in printing and writing. Also called diesis.

Noun 1.
]) Hiroyuki Ogata, ([section]) Pierre-Edouard Fournier, * Eric Crubezy, ([paragraph]) and Didier Raoult *

* Universite de la Mediterranee, Marseille, France; ([dagger]) Universite de Bordeaux 1, Talence, France; ([double dagger]) Institut Pasteur, Paris, France; ([section]) Information Genomique et Structurale, Marseille, France; and ([paragraph]) Universite Paul Sabatier
Paul Sabatier is also the name of a Nobel Prize-winning chemist.


Paul Sabatier (August 3, 1858 - March 4, 1928), was a French clergyman and historian who produced the first modern biography of St. Francis of Assisi.
, Toulouse, France

Address for correspondence: Didier Raoult, Unite des Rickettsies, IFR IFR
abbr.
instrument flight rules
 48, Faculte de Medecine, Universite de la Mdditerranee, Marseille, France; fax: 0-33-4-91-38-77-72; email: Didier.Raoult@medecine. univ-mrs.fr
COPYRIGHT 2004 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2004, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research
Author:Raoult, Didier
Publication:Emerging Infectious Diseases
Geographic Code:1USA
Date:Sep 1, 2004
Words:5608
Previous Article:Genetic divergence and dispersal of yellow fever virus, Brazil.(Research)
Next Article:Rotavirus serotype G9P[8] and acute gastroenteritis outbreak in children, northern Australia.(Research)
Topics:



Related Articles
Plagues, healers and patients in early modern Europe.
Lessons Learned from a Full-Scale Bioterrorism Exercise.
AIDS Has Arrived in India and China.(speculation on an AIDS pandemic)(Statistical Data Included)
Biological warfare at the 1346 Siege of Caffa. (Historical Review).
Tackling bioterrorism one protein at a time. (EH Update).(Brief Article)
Planning against biological terrorism: lessons from outbreak investigations. (Perspective).
Yersinia pestis genotyping.(LETTERS)
Pneumonic plague cluster, Uganda, 2004.(RESEARCH)
Zoonotic focus of plague, Algeria.(DISPATCHES)
Yersinia pestis Orientalis in remains of ancient plague patients.(DISPATCHES)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles