Printer Friendly
The Free Library
21,419,978 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Genetic variability of West Nile virus in US blood donors, 2002-2005.

West Nile virus West Nile virus, microorganism and the infection resulting from it, which typically produces no symptoms or a flulike condition. The virus is a flavivirus and is related to a number of viruses that cause encephalitis.  (WNV WNV West Nile Virus
WNV World Net Visions
) was detected in the United States United States, officially United States of America, republic (2005 est. pop. 295,734,000), 3,539,227 sq mi (9,166,598 sq km), North America. The United States is the world's third largest country in population and the fourth largest country in area.  in 1999, has reoccurred every summer since, and has become endemic. Transfusion transmission was documented in 2002, and screening of blood donations for WNV began in 2003. We investigated genetic variation of WNV in human isolates obtained from specimens collected from 30 infected blood donors who tested positive for WNV RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 during 2002-2005. Complete genomic sequences of 8 isolates and structural gene sequences from 22 additional isolates were analyzed. We found some genetic diversity in isolates from different geographic regions and genetic divergence Genetic divergence is the process of one species diverging over time into more than one species. Passing small random advantages characteristic changes over time from one generation to the next generations.  from reported sequences from epidemics in 1999-2001. Nucleotide divergence of structural genes showed a small increase from 2002 (0.18%) to 2005 (0.37%), suggesting absence of strong selective pressure and limited genetic evolution of WNV during that period. Nevertheless, WNV has continued to diverge from precursor isolates as geographic distribution of the virus has expanded.

**********

West Nile virus (WNV) is a small, enveloped en·vel·op  
tr.v. en·vel·oped, en·vel·op·ing, en·vel·ops
1. To enclose or encase completely with or as if with a covering: "Accompanying the darkness, a stillness envelops the city" 
, positive-strand RNA virus RNA virus
n.
Any of a group of viruses whose nucleic acid core is composed of RNA, including the picornaviruses, retroviruses, and paramyxoviruses.
 of the genus Flavivirus and a member of the Japanese encephalitis Japanese Encephalitis Definition

Japanese encephalitis is an infection of the brain caused by a virus. The virus is transmitted to humans by mosquitoes.
 serocomplex. The plus-sense RNA genome is [approximately equal to] 11 kb and contains a single open reading frame flanked by 5' and 3' untranslated regions (UTRs). The encoded polyprotein is processed into 3 structural and 7 nonstructural (NS) proteins that are essential for viral replication Viral replication is the term used by virologists to describe the propagation of biological viruses during the infection process in the target host cells. When used in the strictest sense, the term refers specifically to the amplification of the viral genome , assembly, and release. WNV is maintained in nature by transmission between mosquitoes and birds but can also infect humans and other mammals (1) and reptiles (2). Most human infections are asymptomatic (70%-80%); symptomatic cases range from flulike illness to severe neurologic disease (>1% of cases) (3-5).

The first US outbreak of WNV occurred in 1999 in New York City New York City: see New York, city.
New York City

City (pop., 2000: 8,008,278), southeastern New York, at the mouth of the Hudson River. The largest city in the U.S.
; 68 human infections, mostly as meningoencephalitis meningoencephalitis /me·nin·go·en·ceph·a·li·tis/ (me-ning?go-en-sef?ah-li´tis) inflammation of the brain and meninges.

toxoplasmic meningoencephalitis
, were confirmed, resulting in 7 deaths. Since 1999, WNV epidemics have reoccurred yearly with 23,975 reported human cases of disease and 962 deaths through 2006 (www.cdc.gov/ncidod/dvbid/westnile).

In 2002, the virus spread westward and the number of reported human cases increased dramatically. The North American North American

named after North America.


North American blastomycosis
see North American blastomycosis.

North American cattle tick
see boophilusannulatus.
 epidemics of 2002 and 2003 represent the largest WNV outbreaks ever reported (6). Additional modes of WNV transmission were identified in 2002, including human-to-human transmissions from mother to child, organ transplantation The transfer of organs such as the kidneys, heart, or liver from one body to another.

The transplantation of human organs has become a common medical procedure. Typical organs transplanted are the kidneys, heart, liver, pancreas, cornea, skin, bones, and lungs.
, and blood transfusion blood transfusion, transfer of blood from one person to another, or from one animal to another of the same species. Transfusions are performed to replace a substantial loss of blood and as supportive treatment in certain diseases and blood disorders.  (7-9). The quick spread of the virus raised questions regarding viral adaptation and prompted a detailed investigation of the genetic evolution of the virus.

The prototype WNV isolate, NY99-flamingo382-99 (WN-NY99; GenBank accession no. AF196835) was obtained from a flamingo infected during the 1999 outbreak in New York New York, state, United States
New York, Middle Atlantic state of the United States. It is bordered by Vermont, Massachusetts, Connecticut, and the Atlantic Ocean (E), New Jersey and Pennsylvania (S), Lakes Erie and Ontario and the Canadian province of
. This isolate belongs to lineage I and is most closely related to the Israel-98 goose isolate AF481864 (IS-98) (6,10). Phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 comparisons of partial and complete nucleotide sequences from US isolates collected between the 1999 and 2000 epidemics with WN-NY99 isolate showed a high degree of genetic similarity with >99.8% nucleotide homology homology (hōmŏl`əjē), in biology, the correspondence between structures of different species that is attributable to their evolutionary descent from a common ancestor.  and >99.9% amino acid amino acid (əmē`nō), any one of a class of simple organic compounds containing carbon, hydrogen, oxygen, nitrogen, and in certain cases sulfur. These compounds are the building blocks of proteins.  homology (11-14). A study of 22 different WNV isolates from 2001 and 2002 showed genetic variation of 0.35% (mean 0.18%) in the premembrane (preM) and envelope (env) genes compared with WN-NY99 (15).

Subsequently, 2 distinct genotypes were detected in strains obtained from Texas in 2002 (15). One new genetic variant widely spread over the United States diverged from the original WN-NY99 strain by several conserved nucleotide mutations and 1 aa substitution in the env protein. Recent studies have highlighted the emergence of a new WNV dominant genotype, named WN02, which has been increasingly prevalent in the United States since 2002 (16-19). Although 13 nt mutations became fixed in the new dominant genotype compared with the WN-NY99 prototype, the highest nucleotide sequence divergence of WNV strains isolated after 2002 is still in the range of 0.4%-0.5% (18,20). The reason for displacement of the WN-NY99 genotype by a new dominant genotype in North America North America, third largest continent (1990 est. pop. 365,000,000), c.9,400,000 sq mi (24,346,000 sq km), the northern of the two continents of the Western Hemisphere.  is not clear, but could have been caused by differences in transmission efficiency of domestic mosquitoes that may offer a selective advantage for the newly emerged genotype (20,21).

Several studies on the genetic variation of WNV have been published (12,15,17,19,21,22). However, continuous monitoring of variability is needed because sensitivity of blood donor screening and diagnostic assays may be affected, producing a negative effect on public health. Genetic variability Introduction
Genetic Variability
The amount by which individuals in a population differ from one another due to their genes, rather than their environment. The study of genetic variability is that of population genetics.
 could also affect viral pathogenesis Viral pathogenesis is the study of how biological viruses cause diseases in their target hosts, usually carried out at the cellular or molecular level. It is a specialized field of study in virology. See also
  • pathogen
  • pathogenesis
, development of vaccines, and development of efficacious therapeutic agents.

This study reports the genomic variation of WNV observed in clinical isolates obtained in the continental United States United States territory, including the adjacent territorial waters, located within North America between Canada and Mexico. Also called CONUS.  during 4 consecutive years (2002-2005). We observed an increase in the number of mutations in the full WNV genome from 0.18% in 2002 to 0.37% in 2005. It should be noted that 80% of the nucleotide changes in structural regions are transitions (T [left and right arrow] C) and 75% are silent mutations. Thus, WNV has continued to slowly diverge from precursor isolates as geographic distribution of the virus expanded.

Materials and Methods

Study Samples

This study included 30 plasma specimens (Table 1) obtained from blood donor units positive for WNV by nucleic acid nucleic acid, any of a group of organic substances found in the chromosomes of living cells and viruses that play a central role in the storage and replication of hereditary information and in the expression of this information through protein synthesis.  tests used to screen blood donations under Food and Drug Administration (FDA FDA
abbr.
Food and Drug Administration


FDA,
n.pr See Food and Drug Administration.

FDA,
n.pr the abbreviation for the Food and Drug Administration.
)--approved nationwide clinical trials; the specimens were collected in 13 states in the continental United States. All samples were collected under Institutional Review Board-approved informed consent provided by each of the institutions performing donor screening.

Virus Isolation in Vero Cells

Vero cells were plated in T75 flasks and grown to 85% confluence in Eagle minimal essential medium (GIBCO GIBCO Grand Island Biological Company (tissue culture media enterprise)  BRL BRL

In currencies, this is the abbreviation for the Brazilian Real.

Notes:
The currency market, also known as the Foreign Exchange market, is the largest financial market in the world, with a daily average volume of over US $1 trillion.
, Gaithersburg, MD, USA) containing 5% fetal bovine serum Fetal bovine serum ( or foetal bovine serum) is serum taken from the fetuses of cows. Fetal Bovine Serum (or FBS) is the most widely used serum in the culturing of cells. In some papers the expression foetal calf serum is used.  (Hyclone, Logan, UT, USA) and 10 [micro]g/mL of penicillin/streptomycin (GIBCO-BRL). For viral isolation, medium was removed, and 500 [micro]L of each plasma sample was added to individual flasks and the volume was adjusted to 5 mL with fresh medium. Cultures were incubated for 2 hours with the plasma, either at room temperature with gentle rocking or at 37[degrees]C with sporadic mixing. A total of 10 mL of fresh medium was then added and cultures were incubated at 37[degrees]C in an atmosphere of 5% C[O.sub.2]. Cultures were observed daily for cytopathic effect Cytopathic effect (CPE) refers to degenerative changes in cells (especially in tissue culture) associated with the multiplication of certain viruses. When in tissue culture, the spread of virus is restricted by an overlay of agar (or other suitable substance) and thus the  under phase microscopy. Supernatants were harvested when an extensive cytopathic effect was observed, centrifuged to remove cell debris, and frozen at -70[degrees]C until further analysis.

RNA Extraction, Reverse Transcription reverse transcription
n.
The process by which DNA is synthesized from an RNA template.
, and PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 

RNA extracts were obtained from 1-mL plasma samples by using Trizol reagent (Invitrogen, Carlsbad, CA, USA), and extracts were resuspended in 20 [micro]L of water. RNA samples from viral passages were isolated from 140 [micro]L of culture supernatants by using the QiaAMP viral RNA extraction kit (QIAGEN, Valencia, CA, USA) according to according to
prep.
1. As stated or indicated by; on the authority of: according to historians.

2. In keeping with: according to instructions.

3.
 the manufacturer's protocol. RNA extracts were stored at -70[degrees]C until further analysis. Reverse transcription reactions were performed in a final volume of 20 [degrees]L that contained 10 [degrees]L of RNA and specific WNV reverse primers by using SuperScript Any letter, digit or symbol that appears above the line. For example, 10 to the 9th power is written with the 9 in superscript (109). Contrast with subscript.  Ill (Invitrogen) according to the manufacturer's instructions. Specific primers used for both PCR amplification and sequencing were designed according to available sequence information in GenBank and based on alignments of published WNV sequences. PCR amplification of overlapping fragments to cover the complete viral genome was performed by using 15 pairs of primers (Table 2). Partial sequences for the structural region were obtained by using primer sets 1, 2, and 3. cDNA specimens were amplified by using the Hi-Fidelity PCR system (Invitrogen) according to the manufacturer's instructions.

DNA Sequencing DNA sequencing

The determination of the sequence of nucleotides in a sample of DNA.
 

PCR products were purified by agarose gel electrophoresis Agarose gel electrophoresis is a method used in biochemistry and molecular biology to separate DNA, RNA, or protein molecules by size. This is achieved by moving negatively charged nucleic acid molecules through an agarose matrix with an electric field (electrophoresis).  by using the MinElute Gel Extraction In molecular biology, gel extraction or gel isolation is a technique used to isolate a desired fragment of intact DNA from an agarose gel following agarose gel electrophoresis.  Kit (QIAGEN) according to the manufacturer's protocol. Both strands were subjected to direct sequencing by using amplifying primers (Table 2) and additional internal sequence primers. Sequencing reactions were performed by using the ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 PRISM BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems Applied Biosystems, Inc. (formerly NASDAQ: ABIO) is the original name of a pioneer biotechnology company founded in 1981 in Foster City, California, among the Silicon Valley cities of the southern San Francisco Bay Area. , Foster City, CA, USA) according to the manufacturer's protocol and analysis by using the ABI Prism 3100 system (Applied Biosystems).

Sequence Analysis

Sequencing data were assembled and analyzed by using the Vector NTI NTI NewTech Infosystems (software company, Irvine, California)
NTI Nuclear Threat Initiative
NTI National Transit Institute (New Brunswick, New Jersey)
NTI Nunavut Tunngavik Incorporated
 Advance 10 software package (Invitrogen). Nucleotide and deduced amino acid sequences from each isolate were aligned by using the Align X program in Vector NTI and compared with prototype WN-NY99 and previously published sequences of isolates from different regions of the United States and other countries. Phylogenetic relationship studies were based on several methods of analysis (distance, parsimony par·si·mo·ny  
n.
1. Unusual or excessive frugality; extreme economy or stinginess.

2. Adoption of the simplest assumption in the formulation of a theory or in the interpretation of data, especially in accordance with the rule of
, and likelihood algorithms) by using MEGA version 3.1 (www.megasoftware.com). All studied isolates were compared with each other, and phylogenetic trees were constructed by using the Kimura 2-parameter method that included transitions and transversions to show genetic relationships of isolates in this study with other WNV isolates in GenBank.

Results

Because of limited volume of plasma specimens available, viruses were isolated from Vero cell cultures for sequence analysis. We assessed the potential of the viral isolation procedure to cause mutations in the viral genome by comparison of sequences of the structural region of 6 specimens and their respective isolates after 3 passages in Vero cells. There were no changes in the RNA sequences obtained in each original plasma sample and the RNA sequences obtained in each of the passages in culture.

We investigated the genetic variability of 30 WNV isolates collected from plasma specimens from nucleic acid amplification testing positive blood donors in 13 states during 2002-2005 (Table 1). Isolates were generated by cultivation in Vero cells. The fragment that encompasses the 5'-UTR, all structural genes, and part of NS1 (bp 1-2,685) from all 30 specimens were subjected to genomic sequencing genomic sequencing  

The sequencing of the entire genome of an organism.

A Closer Look The technique that allows researchers to read and decipher the genetic information found in the DNA of anything from bacteria to plants to animals is
. Eight of 30 isolates were fully sequenced.

The Appendix Table (online Appendix Table, available from www.cdc.gov/EID/content/14/3/436-appT.htm) compares conserved nucleotide mutations and deduced amino acid substitutions identified in structural regions of all 30 isolates with the WN-NY99 isolate (AF196835). Approximately 80% of the nucleotide changes in structural regions were transitions (T [left and right arrow] C) and 75% were silent mutations. All mutations in the preM and membrane (M) regions were silent, and 16 isolates shared the transition 660 C [right arrow] T. Several WNV strains from Europe and Asia, as well as Kunjin virus Kunjin virus

a strain of West Nile virus, generally considered apathogenic but has been isolated from horses with encephalomyelitis. See also encephalitis.
 isolates, also had T at position 660, but both the prototype WN-NY99 and the IS-98 (AF481864) isolates contain 660 C. Twenty-nine of 30 isolates shared 2 conserved nucleotide mutations in the env gene env gene

a gene which encodes a protein precursor for the envelope proteins, found in the retroviral genome.
: 1442 T C (Val 159 [right arrow] Ala) and 2466 C [right arrow] T that differentiates the new dominant genotype, WN02, from the preceding genotype WN99.

Construction of a phylogenetic tree by the maximum parsimony Maximum parsimony, often simply referred to as "parsimony," is a non-parametric statistical method commonly used in computational phylogenetics for estimating phylogenies. Under maximum parsimony, the preferred phylogenetic tree is the tree that requires the least number of  method (Figure 1) showed the degree of divergence of isolates from WN-NY99. The average nucleotide divergence for structural genes has increased from 0.18% in 2002 to 0.37% in 2005.

The env protein has several biologic roles, which include viral entry Viral entry is the earliest stage of infection in the "viral life cycle", as the virus comes into contact with the host cell and introduces viral material into the cell. The major steps involved in viral entry are:[1]
  • 1.
, virion virion

Entire virus particle, consisting of an outer protein shell (called a capsid) and an inner core of nucleic acid (either RNA or DNA). The core gives the virus infectivity, and the capsid provides specificity (i.e., determines which organisms the virus can infect).
 assembly and release, agglutination agglutination, in biochemistry
agglutination, in biochemistry: see immunity.
agglutination, in linguistics
agglutination, in linguistics: see inflection.
 of erythrocytes Erythrocytes
Red blood cells.

Mentioned in: Bartonellosis

erythrocytes (ē·rithˑ·rō·sīts),
n.pl red blood cells.
, and induction of B- and T-cell responses that are associated with protective immunity. Thus, this protein may be involved in WNV evolution. The phylogenetic tree shown in Figure 2 was constructed by maximum parsimony analysis with env gene sequences from US isolates from 1999-2006 in GenBank and sequences of human isolates in our study. The isolates clustered in 2 clades correlated with the parsimony-revealing mutation sites at positions 1442 and 2466.

[FIGURE 1 OMITTED]

Although preM, M, and env sequences show adequate phylogenetic representation, we also analyzed 8 complete genomes of WNV isolates for stronger evidence of evolutionary relationships between isolates and additional mutations that may have implications in phenotypic properties of these isolates. Nucleotide changes and deduced amino acid substitutions of complete genomic sequences from 8 isolates are shown in Tables 3 and 4, respectively. When compared with WN-NY99 sequences, these sequences showed an increased number of nucleotide mutations. FDA/Hu-02 isolated in 2002 showed 20 nt mutations plus 1 insertion at position 10497, and 5 mutations resulted in amino acid substitutions on the basis of deduced sequence of viral polyprotein. ARC 10-02 isolated in 2002 had 22 mutations, 3 of which resulted in amino acid substitutions. These 2 isolates showed [approximately equal to] 0.2% nucleotide divergence.

[FIGURE 2 OMITTED]

The 2003 isolate BSL (language) BSL - A variant of IBM's PL/S systems language. Versions: BSL1, BSL2. 5-03 showed 39 mutations (nucleotide divergence 0.35%), 7 of which were associated with predicted amino acid substitutions. These 3 isolates from 2002 and 2003 had 11 common mutations: 2 were in env (1442 T [right arrow] C resulting in Val 449 [right arrow] Ala and 2466 C T, a silent mutation); 8 were in the NS regions (4146 A [right arrow] G in NS2A; 2 C [right arrow] T transitions at positions 4803 and 6138 in NS3; 6996C [right arrow] T and 7015T [right arrow] C in NS4B; T C transitions at positions 7938 and 8811 and 9352 C [right arrow] T at NS5); and 1 in the 3-'UTR (10851 A [right arrow] G).

The 2004 isolate BSL5-04 had 42 mutations with 7 aa substitutions. The isolates from 2005 were as follows: GCTX1-05 had 56 mutations with 17 aa substitutions; GCTX2-05 had 41 mutations with 3 aa substitutions; BSL2-05 had 44 mutations with 10 aa substitutions plus a deletion of 14 nt (10480 to 10493) in the 3'-UTR; and BSL13-05 had 48 mutations with 8 aa substitutions. Isolates from 2004 and 2005 shared a nucleotide mutation 6721 G [right arrow] A, which resulted in amino acid substitution Ala2209Thr in the NS4A. Four isolates from 3 consecutive years (BSL5-03 from 2003, BSL5-04 from 2004, GCTX1 and BSL13-05 from 2005), shared an amino acid substitution (Lys2842Arg) in NS5. Three isolates from 2005 (GCTX 1-05, BSL2-05 and BSL 13-05) plus 1 isolate from 2004 (BSL5-04) also shared a silent mutation at position 8550 C [right arrow] T.

The overall nucleotide divergence from the WN-NY99 isolates from 2003, 2004, and 2005 showed a steady but small increase (BSL5-03, 035%; BSL5-04, 0.38%; BSL2-05, 0.39%; BSL 13-05, 0.43%; GCTX1-05, 0.5%; and GCTX2-05, 0.37%). These findings suggest relative stasis stasis /sta·sis/ (sta´sis)
1. a stoppage or diminution of flow, as of blood or other body fluid.

2. a state of equilibrium among opposing forces.
 in WNV divergence. The 8 completely sequenced isolates shared conserved nucleotide mutations in the preM, M, env, NS2A, NS3, NS4B, and NS5 genes and the 3'-UTR (Table 4). The largest number of conserved mutations was in the NS3 and NS5 genes. No conserved mutations were observed in the core, M, NS1, and NS2B genes or the 5'-UTR.

Discussion

Our study describes genetic variability observed among 30 clinical isolates of WNV from 13 states in the United States obtained during 2002-2005. Since the initial recognition of WNV in North America in 1999 (10), the virus has spread from the East to the West Coast and has become endemic. Genetic studies have shown that >50% of all WNV isolates in 2002 and >80% of all isolates in 2003 had a new genotype that emerged in the United States in 2001. The new dominant genotype (WN02) was characterized by 2 conserved nucleotide mutations in env (1442 T [right arrow] C and 2466 C [right arrow] T) and 1 deduced amino acid substitution (Val 159 [right arrow] Ala) in the env protein (16-18). Displacement of the initial genotype (WN99) by WN02 has been attributed to differences in efficiency of transmission of the virus by domestic mosquitoes (21). Genetic studies conducted during the early years of WNV activity in the United States identified a small number of mutations and showed no changes suggesting specific adaptations (6,12,15). After the genetic shift in 2001-2002, most nucleotide changes observed were silent transitions (T [left and right arrow] C and A [left and right arrow] G). Limited variability in structural genes observed by our group and others (15,16,18,20,22) suggests the absence of strong immune selective pressure, which led to limited evolution of WNV during 2002-2005. Data in this report show that WNV has continued to diverge from precursor isolates as geographic distribution of the virus expanded.

On the basis of nucleotide sequences, 6 aa substitutions were predicted in the core protein of 5 isolates. Two amino acid substitutions, Ser 11 [right arrow] Asn in isolate BSL 13-05 and Met 21 [right arrow] Thr in isolate FDA-Hu2002, were located within the core hydrophilic hydrophilic /hy·dro·phil·ic/ (-fil´ik) readily absorbing moisture; hygroscopic; having strongly polar groups that readily interact with water.

hy·dro·phil·ic
adj.
 region outside ct helices hel·i·ces  
n.
A plural of helix.
. The other amino acid substitutions (Met 34 [right arrow] Val in isolate BSL06-04, Ala 52 [right arrow] Val in isolate FDA-Hu2002, Ala 77 Val in isolate ARC16-02, and Lys 79 [right arrow] Arg in isolate BSL10-05) were located within [alpha]l, [alpha]2, [alpha]3, and [alpha]4 helices, respectively (23) and were not expected to affect conformation con·for·ma·tion
n.
One of the spatial arrangements of atoms in a molecule that can come about through free rotation of the atoms about a single chemical bond.
, function, or antigenic properties of core protein.

Studies of WNV evolution have focused on the env protein because it plays a major role in immune response immune response
n.
An integrated bodily response to an antigen, especially one mediated by lymphocytes and involving recognition of antigens by specific antibodies or previously sensitized lymphocytes.
 to infection and immunologic pressure could lead to its variation (12,15-21,24,25). A total of 29 of 30 isolates in this study contained 2 conserved nucleotide mutations in env (1442 T [right arrow] C and 2466 C [right arrow] T) that differentiate the dominant genotype from other genotypes and place these isolates in the WN02 clade clade Cladus, subtype Genetics A branch of biological taxa or species that share features inherited from a common ancestor; a single phylogenetic group or line. See Inheritance, Species.  relative to WN-NY99 (Figure 2). The mutation 2466 C [right arrow] T was a silent mutation. Mutation 1442 T [right arrow] C leads to the amino acid substitution Val 159 [right arrow] Ala, located in the variable region close to the glycosylation site. Glycosylation of env protein can influence virus infectivity and has been considered a potential determinant of virulence in a mouse model (26-28).

All 7 isolates from 2004 were from Arizona and had 2 common silent mutations in env: 1320 A [right arrow] G present in all isolates, and 1974 C [right arrow] T, present in 6 of 7 isolates. Mutation 1320 A [right arrow] G is also present in reported attenuated Attenuated
Alive but weakened; an attenuated microorganism can no longer produce disease.

Mentioned in: Tuberculin Skin Test


attenuated

having undergone a process of attenuation.
 strains of WNV (AY532665, AY688948, M12294) (29) and was also reported in human isolate DQ164201 from Arizona in 2004 and in the red-tailed hawk isolate DQ164204 from Colorado in 2003 (18). Mutation 1974 C [right arrow] T, found in isolates from Arizona and Texas, was detected in 2000 in New York (AF404756), which indicated that this mutation occurred at least twice. A Kunjin virus isolate from 2003 (AY274505) and isolate EthAn4766 from Ethiopia (AY603654) also had that mutation.

Phylogenetic analysis of complete genomes of WNV isolates provided stronger evidence of evolutionary relationships between isolates. Eight fully sequenced isolates were compared by phylogenetic analysis with 39 published complete WNV genomes present in the United States during epidemics in 1999-2005 (Figure 3). The phylogenetic tree was constructed by maximum parsimony analyses and rooted by using WN-NY99 and IS-98; it clearly shows that these 2 isolates were the predecessors of other US WNV isolates. Analysis of nucleotide sequence alignment of complete WNV genomes indicated that most mutations that occur each year were not fixed. However, WNV has continued to diverge and the total number of fixed mutations and the overall nucleotide divergence have increased. Some mutations in US isolates may have appeared as a result of native adaptation and genetic drift genetic drift: see genetics.
genetic drift

Change in the pool of genes of a small population that takes place strictly by chance. Genetic drift can result in genetic traits being lost from a population or becoming widespread in a population without
 of parental WNV isolates (18).

Within the WN02 genotype, a sequence from NY 2003 (DQ164189) formed 2 outgroups with moderately strong (96%) bootstrap See boot.

(operating system, compiler) bootstrap - To load and initialise the operating system on a computer. Normally abbreviated to "boot". From the curious expression "to pull oneself up by one's bootstraps", one of the legendary feats of Baron von Munchhausen.
 support (Figure 3). Five of 8 isolates in outgroup 2a were from Arizona and had the 6721 G [right arrow] A mutation resulting in amino acid substitution Ala 209 [right arrow] Thr. This mutation was already present in the 2003 magpie magpie, common name for certain birds of the family Corvidae (crows and jays). The black-billed magpie, Pica pica, of W North America has iridescent black plumage, white wing patches and abdomen, and a long wedge-shaped tail. It is altogether about 20 in.  isolate DQ164203 from Colorado and in the 2004 human isolate DQ164201 from Arizona (18). These isolates also shared silent mutation 8550 C [right arrow] T, which had been reported in the 2004 human isolate DQ164201 from Arizona (18).

Local concentration of closely related isolates in Arizona (Figures 2, 3) or in California (outgroup 1; Figure 3) may have been caused by introduction of 1 or few genetically similar viruses in the area with rapid spread to mosquitoes and local birds, which amplified the original genome. Human infections in that area would therefore result from 1 or a few local WNV-colonizing genotypes and reflect stochastic introduction of 1 or a few infected vectors, followed by rapid localized amplification (19). In contrast, a larger number of different viruses were introduced in other areas, as observed in Texas, which lead to a broader diversity of variants.

Several studies showed that mutations in conserved structures within the 3'-UTR did not affect WNV translation but could affect RNA replication and interaction between cellular protein eEF1A and WNV 3'-UTR, facilitating viral minus-strand synthesis (30-32). Isolate BSL2-05 from South Dakota South Dakota (dəkō`tə), state in the N central United States. It is bordered by North Dakota (N), Minnesota and Iowa (E), Nebraska (S), and Wyoming and Montana (W).  had a 14-nt deletion (10480-10493) and isolate FDA/Hu-02 had 1-nt insertion at position 10497 in the 3'-UTR; the second isolate had larger plaques than WN-NY99. The recently published 2004 human isolate DQ431705 from North Dakota North Dakota, state in the N central United States. It is bordered by Minnesota, across the Red River of the North (E), South Dakota (S), Montana (W), and the Canadian provinces of Saskatchewan and Manitoba (N).  (19) had a 5-nt deletion (10434-10439) in the same 3'-UTR variable region. Previous studies had reported low genetic variation among WNV isolates in North America and emphasized a low frequency of nucleotide variants in the 3'-UTR. Subsequent observations showed that nucleotide changes in the 3'-UTR played a role in rapid spread of this virus in the New World because nucleotide changes in the 3'-UTR had co-evolved with amino acid changes and affected interactions of helicase and RNA polymerase RNA polymerase
n.
A polymerase that catalyzes the synthesis of RNA from a DNA or RNA template.
 with their RNA substrate (33). Mutations in 3'-UTR appear to play a role in production of small-plaque temperature-sensitive variants or mouse-attenuated phenotype variants (34).

[FIGURE 3 OMITTED]

Our study showed limited but continuous genetic variability with amino acid substitutions in WNV strains. We also found insertions and deletions in the 3'-UTR region that should be studied for assessment of their functional role. Phylogenetic studies of WNV isolates are needed to monitor microevolution mi·cro·ev·o·lu·tion
n.
Evolution resulting from a succession of relatively small genetic variations that often cause the formation of new subspecies.
 of WNV that may affect pathogenic properties of the virus and to assess the effectiveness of available commercial donor screening and diagnostic assays for detection of variant strains. Study of genetic variability may also provide insights into the development of vaccines and therapeutic agents.

Acknowledgments

We thank Indira K. Hewlett, Deborah Taylor, and Caren Chancey for helpful discussion and review of the manuscript, and Valerie Winkelman for technical assistance.

This study was partially supported by the FY06-08 National Institute of Allergy and Infectious Diseases infectious diseases: see communicable diseases.  Trans National Institutes of Health/FDA Intramural intramural /in·tra·mu·ral/ (-mu´r'l) within the wall of an organ.

in·tra·mu·ral
adj.
Occurring or situated within the walls of a cavity or organ.
 Biodefense Program.

References

(1.) van der Meulen KM, Pensaert MB, Nauwynck HJ. West Nile virus in the vertebrate vertebrate, any animal having a backbone or spinal column. Verbrates can be traced back to the Silurian period. In the adults of nearly all forms the backbone consists of a series of vertebrae. All vertebrates belong to the subphylum Vertebrata of the phylum Chordata.  world. Arch Virol. 2005;150:637-57.

(2.) Klenk K, Snow J, Morgan K, Bowen R, Stephens M, Foster F, et al. Alligators as West Nile virus amplifiers. Emerg Infect Dis. 2004;10:2150-5.

(3.) Mostashari F, Bunning ML, Kitsutani PT, Singer DA, Nash D, Cooper MJ, et al. Epidemic West Nile West Nile may refer to:
  • West Nile virus
  • West Nile region in Uganda
 encephalitis encephalitis (ĕnsĕf'əlī`təs), general term used to describe a diffuse inflammation of the brain and spinal cord, usually of viral origin, often transmitted by mosquitoes, in contrast to a bacterial infection of the meninges , New York, 1999: results of a household-based seroepidemiological survey. Lancet. 2001;358:261-4.

(4.) Petersen LR, Marfin AA. West Nile virus: a primer for the clinician. Ann Intern Med. 2002;137:173-9.

(5.) Hayes EB, Gubler DJ. West Nile virus: epidemiology and clinical features of an emerging epidemic in the United States. Annu Rev Med. 2006;57:181-94.

(6.) Beasley DW. Recent advances in the molecular biology molecular biology, scientific study of the molecular basis of life processes, including cellular respiration, excretion, and reproduction. The term molecular biology was coined in 1938 by Warren Weaver, then director of the natural sciences program at the Rockefeller  of West Nile virus. Curt Mol Med. 2005;5:835-50.

(7.) Austgen LE, Bowen RA, Bunning ML, Davis BS, Mitchell CJ, Chang GJ. Experimental infection of cats and dogs Cats and Dogs

A slang term referring to speculative stocks that have short or suspicious histories for sales, earnings, dividends, etc.

Notes:
In a bull market analysts will often mention that everything is going up, even the cats and dogs.
 with West Nile virus. Emerg Infect Dis. 2004;10:82-6.

(8.) Pealer LN, Marfin AA, Petersen LR, Lanciotti RS, Page PL, Stramer SL, et al. Transmission of West Nile virus through blood transfusion in the United States in 2002. N Engl J Med. 2003;349:1236-45.

(9.) Sbrana E, Tonry JH, Xiao SY, da Rosa Da Rosa is a Portuguese and Galician family name.

Da Rosa is either:
  • Thiago da Rosa Correa, Brazilian midfielder who plays for the Chicago Fire.
  • Jair da Rosa Pinto, Brazilian footballer who played in the 1950 FIFA World Cup.
 AP, Higgs S, Tesh RB. Oral transmission of West Nile virus in a hamster hamster, Old World rodent, related to the voles, lemmings, and New World mice. There are many hamster species, classified in several genera. All are solitary, burrowing, nocturnal animals, with chunky bodies, short tails, soft, thick fur, and large external cheek  model. Am J Trop Med Hyg. 2005;72:325-9.

(10.) Lanciotti RS, Roehrig JT, Deubel V, Smith J, Parker M, Steele K, et al. Origin of the West Nile virus responsible for an outbreak of encephalitis in the northeastern United States. Science. 1999;286: 2333-7.

(11.) Anderson JF, Vossbrinck CR, Andreadis TG, Beckwith WH, Mayo DR. A phylogenetic approach to following West Nile virus in Connecticut. Proc Natl Acad Sci U S A. 2001;98:12885-9.

(12.) Ebel GD, Dupuis AR Ngo K, Nicholas D, Kauffman EB, Jones SA, et al. Partial genetic characterization of WNV strains isolated in New York State during the 2000 transmission season. Emerg Infect Dis. 2001;7:650-3.

(13.) Huang C, Slater B, Rudd R, Parchuri N, Hull R, Dupuis M, et al. First isolation of West Nile virus from a patient with encephalitis in the United States. Emerg Infect Dis. 2002;8:1367-71.

(14.) Lanciotti RS, Ebel GD, Deubel V, Kerst AJ, Murri S, Meyer R, et al. Complete genome sequences and phylogenetic analysis of West Nile virus strains isolated from the United States, Europe, and the Middle East. Virology virology, study of viruses and their role in disease. Many viruses, such as animal RNA viruses and viruses that infect bacteria, or bacteriophages, have become useful laboratory tools in genetic studies and in work on the cellular metabolic control of gene expression . 2002;298:96-105.

(15.) Davis CT, Beasley DW, Guzman H, Raj R, D'Anton M, Novak RJ, et al. Genetic variation among temporally and geographically distinct West Nile Virus isolates, United States, 2001, 2002. Emerg Infect Dis. 2003;9:1423-9.

(16.) Snapinn KW, Holmes EC, Young DS, Bernard KA, Kramer LD, Ebel GD. Declining growth rate of West Nile virus in North America. J Virol. 2007;81:2531-4.

(17.) Davis CT, Li L, May FJ, Bueno R Jr, Dennett JA, Bala AA, et al. Genetic stasis of dominant West Nile virus genotype, Houston, Texas “Houston” redirects here. For other uses, see Houston (disambiguation).
Houston (pronounced /'hjuːstən/) is the largest city in the state of Texas and the
. Emerg Infect Dis. 2007; 13:601-4.

(18.) Davis CT, Ebel GD, Lanciotti RS, Brault AC, Guzman H, Siirin M, et al. Phylogenetic analysis of North American West Nile virus isolates, 2001-2004: Evidence for the emergence of a dominant genotype. Virology. 2005;342:252-65.

(19.) Herring BL, Bernardin F, Caglioti S, Strainer S, Tobler L, Andrews W, et al. Phylogenetic analysis of WNV in North American blood donors during the 2003-2004 epidemic seasons. Virology. 2007;363:220-8.

(20.) Ebel GD, Carricaburu J, Young D, Bernard KA, Kramer LD. Genetic and phenotypic variation of West Nile virus in New York, 2000-2003. Am J Trop Med Hyg. 2004;71:493-500.

(21.) Jerzak G, Bernard KA, Kramer LD, Ebel GD. Genetic variation in West Nile virus from naturally infected mosquitoes and birds suggests quasispecies structure and strong purifying selection. J Gen Virol. 2005;86:2175-83.

(22.) Beasley DW, Davis CT, Guzman H, Vanlandingham DL, Travassos da Rosa AP, Parsons RE, et al. Limited evolution of West Nile virus has occurred during its southwesterly south·west·er·ly  
adj.
1. Situated toward the southwest.

2. Coming or being from the southwest.



south·west
 spread in the United States. Virology. 2003;309:190-5.

(23.) Dokland T, Walsh M, Mackenzie JM, Khromykh AA, Ee KH, Wang S. West Nile virus core protein; tetramer tet·ra·mer
n.
A polymer consisting of four identical monomers.



tetra·mer
 structure and ribbon formation. Structure. 2004:12:1157-63.

(24.) Bertolotti L. Kitron U, Goldberg TL. Diversity and evolution of West Nile virus in Illinois and the United States, 2002-2005. Virology. 2007;360:143-9.

(25.) Davis CT, Beasley DW, Guzman H, Siirin M, Parsons RE, Tesh RB, et al. Emergence of attenuated West Nile virus variants in Texas, 2003. Virology. 2004;330:342-50.

(26.) Beasley DW, Whiteman MC, Zhang S, Huang CY, Schneider BS, Smith DR, et al. Envelope protein glycosylation status influences mouse neuroinvasion phenotype of genetic lineage 1 West Nile virus strains. J Virol. 2005;79:8339-47.

(27.) Adams SC, Broom AK, Sammels LM, Harnett AC, Howard MJ, Coelen RJ, et al. Glycosylation and antigenic variation Antigenic variation is the process by which an infectious organism alters its surface proteins in order to evade a host immune response. This change in antigenic profile may occur as the pathogen passes through a host population (also called "antigenic diversity") or may take place  among Kunjin virus isolates. Virology. 1995;206:49-56.

(28.) Hanna SL, Pierson TC, Sanchez MD, Ahmed AA, Murtadha MM, Doms RW. N-linked glycosylation of West Nile virus envelope proteins influences particle assembly and infectivity. J Virol. 2005;79:13262-74.

(29.) Yamshchikov G, Borisevich V, Seregin A, Chaporgina E, Mishina M, Mishin V, et al. An attenuated West Nile prototype virus is highly immunogenic im·mu·no·gen·ic
adj.
Producing an immune response.



immunogenic

producing immunity; evoking an immune response.
 and protects against the deadly NY99 strain: a candidate for live WN vaccine development. Virology. 2004;330: 304-12.

(30.) Lo MK, Tilgner M, Bernard KA, Shi PY. Functional analysis of mosquito-borne flavivirus conserved sequence In biology, conserved sequences are similar or identical sequences that may occur within nucleic acids, proteins or polymeric carbohydrates within multiple species of organism or within different molecules produced by the same organism.  elements within 3' untranslated region of West Nile vials by use of a reporting replicon rep·li·con
n.
A genetic element that undergoes replication as an autonomous unit.
 that differentiates between viral translation and RNA replication. J Virol. 2003;77:10004-14.

(31.) Davis WG, Blackwell JL, Shi PY, Brinton MA. Interaction between the cellular protein eEF1A and the 3' terminal stem loop of the West Nile virus genomic RNA facilitates viral RNA minus strand synthesis. J Virol. 2007;81:10172-87.

(32.) Elghonemy S, Davis WG, Brinton MA. The majority of the nucleotides in the top loop of the genomic 3' terminal stem loop structure are cis-acting in a West Nile virus infectious clone. Virology. 2005:331:238-46.

(33.) Hughes AL, Piontkivska H, Foppa I. Rapid fixation of a distinctive sequence motif In genetics, a sequence motif is a nucleotide or amino-acid sequence pattern that is widespread and has, or is conjectured to have, a biological significance. For proteins, a sequence motif is distinguished from a structural motif, a motif formed by the three dimensional  in the 3' noncoding region of the clade of West Nile virus invading North America. Gene. 2007;399:152-61.

(34.) Davis CT, Galbraith SE, Zhang S, Whiteman MC, Li L, Kinney RM, et al. A combination of naturally occurring mutations in North American West Nile virus nonstructural protein genes and in the 3' untranslated region alters virus phenotype. J Virol. 2007;81:6111-6.

Address for correspondence: Maria Rios, Laboratory of Molecular Virology Molecular Virology is the study of viruses at the molecular level. In particular, this includes the analysis of individual viral genes and gene products, and their interaction with host (human, plant or animal) cellular proteins. , Division of Emerging Transfusion Transmitted Diseases, Food and Drug Administration, National Institutes of Health, Bldg 29, Rm 131, 8800 Rockville Pike, Bethesda, MD 20892, USA; email: maria.rios@fda. hhs.gov

Andriyan Grinev, * Sylvester Daniel, * Susan Stramer, ([dagger]) Susan Rossmann, ([double dagger double dagger
n.
A reference mark () used in printing and writing. Also called diesis.

Noun 1.
]) Sally Caglioti, ([section]) and Maria Rids *

* Food and Drug Administration, Bethesda, Maryland Bethesda is an urbanized, but unincorporated, area in southern Montgomery County, Maryland, just Northwest of Washington, D.C. It takes its name from a church located there, the Bethesda Presbyterian Church, built in 1820 and rebuilt in 1850, which in turn took its name from , USA; ([dagger]) American Red Cross American Red Cross: see Red Cross. , Gaithersburg, Maryland, USA; ([double dagger]) Gulf Coast Regional Blood Center, Houston, Texas, USA; and ([section]) Blood System Laboratories, Tempe, Arizona Tempe (pronounced /tɛm.'piː/) is a city in Maricopa County, Arizona, USA, with a population of 169,712 according to 2006 Census Bureau estimates. , USA

Dr Grinev is a visiting associate in the Laboratory of Molecular Virology, Center for Biologics Evaluation and Research The Center for Biologics Evaluation and Research (CBER) is one of six main centers for the Food and Drug Administration, which is in the United States Department of Health and Human Services. , FDA, Bethesda, Maryland. His primary research interests include the molecular epidemiology molecular epidemiology Molecular medicine An evolving field that combines the tools of standard epidemiology–case studies, questionnaires and monitoring of exposure to external factors with the tools of molecular biology–eg, restriction endonucleases,  and pathogenesis of flaviviruses and the evolution of WNV.
Table 1. Sequences of 30 West Nile virus
isolates from the United States *

                                      No.
                                   passages
                                    in Vero     GenBank
                      Geographic     cells      accession
Isolate ID    Year     location    ([dagger])      no.

FDA/HU-02#    2002#      NY#           3#       AY646354#
ARC10-02#     2002#      MI#           1#       AY795965#
ARC12-02      2002        OH           1        DQ666453
ARC13-02      2002        MI           1        DQ666454
ARC15-02      2002        MI           1        DQ666455
ARC 16-02     2002        IN           1        DQ666456
ARC 17-02     2002        GA           1        DQ666457
BSL5-03#      2003#      UT#           1#       D0005530#
BSL-9-03      2003        TX           1        DQ666458
BSL56-03      2003        ND           1        DQ666459
BSL62-03      2003        SD           2        DQ666460
BSL114-03     2003        TX           2        DQ666461
RMS1-03       2003        MN           1        DQ666462
RMS2-03       2003        IN           1        DQ666463
RMS3-03       2003        IN           1        DQ666464
RMS4-03       2003        IA           1        DQ666465
BSL-1-04      2004        AZ           1        DQ666466
BSL-2-04      2004        AZ           1        DQ666467
BSL4-04       2004        AZ           2        D0666468
BSL5-04#      2004#      AZ#           1#       DQ666448#
BSL6-04       2004        AZ           1        DQ666469
BSL7-04       2004        AZ           2        DQ666470
BSI-8-04      2004        AZ           2        DQ666471
GCTX1#        2005#      TX#           1#       DQ666449#
GCTX2#        2005#      TX#           1#       DQ666450#
BSL2-05#      2005#      SD#           1#       DQ666452#
BSI-6-05      2005        AZ           1        DQ666472
BSI-9-05      2005        TX           1        DQ666473
BSL10-05      2005        LA           1        DQ666474
BSL13-05#     2005#      AZ#           1#       DQ666451#

Note: Isolates have been completely sequenced are indicated with #.

* Isolates in boldface have been completely sequenced.

([dagger]) Indicates passage of viral isolate from which
RNA extracts were used to obtain the genomic sequence.

Table 2. Primer sets used for PCR analyses of West Nile
virus and sizes of overlapping amplicons *

Set/location        Amplicon     Name     Sequence (5' [less than
                    size, kb                  or equal to] 3')

1/F1-R1300             1.3        F1      AGTAGTTCGCCTGTGTGAGCTGAC
                                 R1300      TTGGCGCATGTGTCAATGCT

2/F980-R2000           1.0       R980       CTTGGAATGAGCAACAGAGA
                                 R2000      GTTAGGTCGTTCAATGAAGC

3/F1690-R2685          1.0       R1690      GAGACGTTAATGGAGTTTGA
                                 R2370      CTTCACTGCTTCCCACATTTG

4/F2340-R3420          1.1       R2340      TTCGGAGGCATGTCCTGGAT
                                 R3420     CTGATCTCCATACCATACCAACA

5/F3330-R4120          0.8       R3330     GAGAGCTGCGGACACCGTGGACC
                                 R4120     CATAGCAGACTTGCTCCTTTCT

6/F4070-R4950          0.9       R4070      CTGTTGATGGTCGGAATAGG
                                 R4950      CCTGGTTTCGTCTGGACGTT

7/F4810-R5650          0.9       R4810       CGCCTGGACCCATACTGG
                                 R5650      CCATTCGTATCCAGAGTTCCA

8/F5510-R6430          0.9       F5510      AGCATTGCAGCAAGAGGTTA
                                 R6430    TAGTGCCTGGTGATCCGAGTACAC

9/F6290-R6770          0.5       F6290    CGACCGGAGGTGGTGCTTTGATGG
                                 F6770      CCTGGAACTTCAGCCATCCA

10/F6690-R7550         0.9       F6690       CCTCCTCATGCAGCGGAA
                                 R7550      GAGCTTGCTCCATTCTCCCA

11/F7420-R8260         0.9       R7420       CCACACCCATCATGCAGAA
                                 R8260      CGTTGGAGCAGCTCCATCTT

12/F8170-R9050         0.9       R8170      CATAGGACGATTCGGGTCCT
                                 R9050    CTCTTTCCCATCATGTTGTAAATGC

13/F8920-R9810         0.9       R8920       CAGCTTTGGGTGCCATGTT
                                 R9810      GAACCTGCTGCCAATCATACC

14/F9750-R10630        0.9       R9750     TCCTCAATGCTATGTCAAAGGT
                                R10630      GGTCCTCCTTCCGAGACGGT

15/F10550-R11029       0.5      F10550      TGAGTAGACGGTGCTGCCTG
                                R11029    GATCCTGTGTTCTCGCACCACCAG

* Internal sequencing primers were also used and their
sequences are available upon request.

Table 3. Deduced amino acid substitutions in 8 completely sequenced
West Nile virus isolates compared with isolate WN-NY99 *

              Nucleocapsid

Isolate        11     21     52    294    298    342

WN-NY99       Ser    Met    Ala    Leu    Asn    Asn
FDA/HU-02            Thr    Val
ARC10-02
BSI-5-03
BSI-5-04
GCTX1-05                                  Ser
GCTX2-05
BSI-2-05                                  Ser    Ser
BSL13-05      Asn                  Pro

              Residue no.
              Envelope glycoprotein

Isolate       449    472    529    602    663    684

WN-NY99       Val    Glu    Leu    Leu    Ile    Asn
FDA/HU-02     Ala                                Ser
ARC10-02      Ala
BSI-5-03      Ala                         Val
BSI-5-04      Ala
GCTX1-05      Ala
GCTX2-05      Ala
BSI-2-05      Ala    Gly           Ile
BSL13-05      Ala           Phe

              NS1

Isolate       799    895

WN-NY99       Ile    Leu
FDA/HU-02
ARC10-02
BSI-5-03      Val
BSI-5-04
GCTX1-05
GCTX2-05             Phe
BSI-2-05
BSL13-05

Protein       NS2A   NS2B
Residue no.   1169   1438

WN-NY99       Lys    Ser
FDA/HU-02
ARC10-02
BSI-5-03      Arg
BSI-5-04             Asn
GCTX1-05
GCTX2-05
BSI-2-05
BSL13-05

Protein       NS3
Residue no.   1611   1688   1690   1702   1971   1991

WN-NY99       Val    Met    Arg    Gly    Pro    Phe
FDA/HU-02
ARC10-02
BSI-5-03                                  Ser
BSI-5-04
GCTX1-05      Ala    Thr    Lys    Asp
GCTX2-05
BSI-2-05                                         Leu
BSL13-05

Protein       NS4A                               NS4B
Residue no.   2188   2193   2209   2213   2261   2301

WN-NY99       Thr    Phe    Ala    Val    Leu    Ser
FDA/HU-02                                        Gly
ARC10-02                           Ala
BSI-5-03
BSI-5-04      Ser           Thr
GCTX1-05             Leu    Thr           Met
GCTX2-05
BSI-2-05                    Thr
BSL13-05                    Ile

              NS4B   NS5
Isolate       2488   2549   2755   2788   2820
WN-NY99       Ser    Lys    Gly    Asn    Ser

FDA/HU-02
ARC10-02
BSI-5-03
BSI-5-04                    Ser
GCTX1-05                    Arg    Ser    Leu
GCTX2-05
BSI-2-05      Gly    Arg
BSL13-05      Gly

              NS5
Isolate       2826   2842   3056   3104   3132
WN-NY99       Glu    Lys    Pro    Arg    Arg

FDA/HU-02
ARC10-02      Gly
BSI-5-03             Arg
BSI-5-04             Arg
GCTX1-05             Arg           Cys    Ser
GCTX2-05                    Ser
BSI-2-05
BSL13-05             Arg

              NS5
Isolate       3191   3238   3240
WN-NY99       Met    Gin    Pro    Total

FDA/HU-02                           5
ARC10-02                            3
BSI-5-03                            6
BSI-5-04             Lys    Gin     8
GCTX1-05      Thr                   16
GCTX2-05                            3
BSI-2-05                    Gin     10
BSL13-05                    Gin     8

* NS, nonstructural.

Table 4. Nucleotide mutations conserved in fully sequenced
West Nile virus isolates from 2002-2005 epidemics in the
United States compared with isolate WN-NY99

                       Gene or region

Isolate       preM       Env        NS2A     NS3

                         Nucleotide no.

              660    1442   2466    4146    4803

WN-NY99        C      T      C       A       C
FDA/HU-02             C      T       G       T
ARC 10 2002           C      T       G       T
BSL5 2003      T      C      T       G       T
BSL5 2004      T      C      T       G       T
GCTX1 2005     T      C      T       G       T
GCTX2 2005     T      C      T       G       T
BSL2 2005      T      C      T       G       T
BSL13 2005     T      C      T       G       T

                      Gene or region

Isolate               NS3           NS4A

                      Nucleotide no.

              6138   6238   6426    6721

WN-NY99        C      C      C       G
FDA/HU-02      T
ARC 10 2002    T             T
BSL5 2003      T             T
BSL5 2004      T      T      T       A
GCTX1 2005     T      T      T       A
GCTX2 2005     T      T      T
BSL2 2005      T      T      T       A
BSL13 2005     T      T      T       A

              Gene or region

Isolate           NS48      NS5

               Nucleotide no.

              6996   7015   7938

WN-NY99        C      T      T
FDA/HU-02      T      C      C
ARC 10 2002    T      C      C
BSL5 2003      T      C      C
BSL5 2004      T      C      C
GCTX1 2005     T      C      C
GCTX2 2005     T      C      C
BSL2 2005      T      C      C
BSL13 2005     T      C      C

                   Gene or region

Isolate               NS5          3'-UTR

                    Nucleotide no.

              8621   8811   9352   10851

WN-NY99        A      T      C       A
FDA/HU-02             C      T       G
ARC 10 2002           C      T       G
BSL5 2003      G      C      T       G
BSL5 2004      G      C      T       G
GCTX1 2005     G      C      T       G
GCTX2 2005            C      T       G
BSL2 2005             C      T       G
BSL13 2005     G      C      T       G

* preM, premembrane; Env, envelope;
NS, nonstructural; UTR, untranslated region.
COPYRIGHT 2008 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2008 Gale, Cengage Learning. All rights reserved.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:RESEARCH
Author:Grinev, Andriyan; Daniel, Sylvester; Stramer, Susan; Rossmann, Susan; Caglioti, Sally; Rios, Maria
Publication:Emerging Infectious Diseases
Date:Mar 1, 2008
Words:5839
Previous Article:Integrated food chain surveillance system for Salmonella spp. in Mexico (1).
Next Article:Discovering and differentiating new and emerging clonal populations of Chlamydia trachomatis with a novel shotgun cell culture harvest assay.
Topics:



Related Articles
Transfusions and transplants spread West Nile virus. (Biomedicine).
Roche Diagnostics begins installation of West Nile virus blood screening systems for NA clinical trials.
West Nile virus: First Nations join the fight.
West Nile virus infection in nonhuman primate breeding colony, concurrent with human epidemic, Southern Louisiana.
Epidemiology and transmission dynamics of West Nile virus disease.
Virology, pathology, and clinical manifestations of West Nile Virus disease.
Crow deaths caused by West Nile virus during winter.
Risk factors for West Nile virus neuroinvasive disease, California, 2005.
Host-feeding patterns of Culex mosquitoes in relation to trap habitat.
Land use and West Nile virus seroprevalence in wild mammals.

Terms of use | Copyright © 2013 Farlex, Inc. | Feedback | For webmasters | Submit articles