Printer Friendly
The Free Library
19,111,409 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Genetic studies of a cluster of acute lymphoblastic leukemia cases in Churchill County, Nevada.


OBJECTIVE: In a study to identify exposures associated with 15 cases of childhood leukemia, we found levels of tungsten, arsenic, and dichlorodiphenyldichloroethylene in participants to be higher than mean values reported in the National Report on Human Exposure to Environmental Chemicals. Because case and comparison families had similar levels of these contaminants, we conducted genetic studies to identify gene polymorphisms that might have made case children more susceptible than comparison children to effects of the exposures.

DESIGN: We compared case with comparison children to determine whether differences existed in the frequency of polymorphic genes, including genes that code for enzymes in the folate folate /fo·late/ (fo´lat)
1. the anionic form of folic acid.

2. more generally, any of a group of substances containing a form of pteroic acid conjugated with l-glutamic acid and having a variety of substitutions.
 and purine pathways. We also included discovery of polymorphic forms of genes that code for enzymes that are inhibited by tungsten: xanthine xanthine /xan·thine/ (-then) a purine base found in most body tissues and fluids, certain plants, and some urinary calculi; it is an intermediate in the degradation of AMP to uric acid. Methylated xanthine compounds (e.g.  dehydrogenase dehydrogenase /de·hy·dro·gen·ase/ (de-hi´dro-jen-as?) an enzyme that catalyzes the transfer of hydrogen or electrons from a donor, oxidizing it, to an acceptor, reducing it.

de·hy·dro·gen·ase
n.
, sulfite oxidase sulfite oxidase /sul·fite ox·i·dase/ (ok´si-das) an oxidoreductase that catalyzes the oxidation of sulfite to sulfate as well as the detoxification of sulfite and sulfur dioxide from exogenous sources.  (SUOX gene), and aldehyde oxidase.

PARTICIPANTS: Eleven case children were age- and sex-matched with 42 community comparison children for genetic analyses. Twenty parents of case children also contributed to the analyses.

RESULTS: One bilalleleic gene locus in SUOX was significantly associated with either case or comparison status, depending on which alleles the child carried (without adjusting for multiple comparisons).

CONCLUSIONS: Although genetic studies did not provide evidence that a common agent or genetic susceptibility factor caused the leukemias, the association between a SUOX gene locus and disease status in the presence of high tungsten and arsenic levels warrants further investigation.

RELEVANCE: Although analyses of community clusters of cancer have rarely identified causes, these findings have generated hypotheses to be tested in subsequent studies.

KEY WORDS: arsenic, children, cluster, DDE (Dynamic Data Exchange) A message protocol in Windows that allows application programs to request and exchange data between them automatically.

DDE - Dynamic Data Exchange
, enzymes, genetics, leukemia, polymorphism, tungsten. Environ Health Perspect 115: 158-164 (2007). doi: 10.1289/ehp.9025 available via http://dx.doi.org/ [Online 30 November 2006]

**********

The Nevada State Health Division (NSHD NSHD Nevada State Health Division
NSHD Network Service Help Desk
), with assistance from the Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center.  (CDC See Control Data, century date change and Back Orifice.

CDC - Control Data Corporation
), conducted a study to identify environmental exposures in the Churchill County community where 15 cases of childhood leukemia,14 of which were acute lymphoblastic leukemia acute lymphoblastic leukemia
n. Abbr. ALL
Lymphoblastic leukemia occurring mainly in older adults, characterized by rapid onset and progression of symptoms. Also called acute lymphocytic leukemia.
 (ALL), had been diagnosed between 1997 and 2002. State health officials estimated that fewer than 2 cases would have been expected (Steinmaus et al. 2004). The detailed methods, results, and recommendations of this investigation have been documented by Rubin et al. (2007) in this mini-monograph.

Although the investigation found higher levels of potentially toxic substances, including tungsten, arsenic, and the dichlorodiphenyltrichloroethane di·chlo·ro·di·phen·yl·tri·chlo·ro·eth·ane
n.
DDT.
 (DDT DDT or 2,2-bis(p-chlorophenyl)-1,1,1,-trichloroethane, chlorinated hydrocarbon compound used as an insecticide. First introduced during the 1940s, it killed insects that spread disease and feed on crops. ) metabolite metabolite, organic compound that is a starting material in, an intermediate in, or an end product of metabolism. Starting materials are substances, usually small and of simple structure, absorbed by the organism as food.  dichlorodiphenyldichloroethylene (DDE) in residents of Churchill County than the values reported in the National Report on Human Exposure to Environmental Chemicals (CDC 2003b), case and comparison families had similar body burdens of these contaminants. Because the two groups had similar concentrations, CDC, in collaboration with Mary Relling of St. Jude Children's Research Hospital St. Jude Children's Research Hospital, founded in 1962, is a leading pediatric treatment and research facility focused on children's catastrophic diseases. It is located in Memphis, Tennessee.

In 1996, Peter Doherty, Ph.D., of St.
 and with the advice of William Carroll, Head of the Children's Oncology Group (COG) Acute Leukemia acute leukemia Hematology A rapidly progressive malignancy of sudden onset, characterized by an uncontrolled 'clonal' proliferation of immature WBCs which replace BM and spill into the peripheral circulation; untreated AL may be fatal in wks to months.  Disease Committee, conducted genetic studies in an effort to identify gene variants that might have made case children more susceptible than comparison children to adverse effects of the exposures documented in Churchill County. As a result of the high levels of tungsten found in residents of Churchill County, the investigation also included a study to identify variant forms of three genes that code for enzymes that are inhibited by tungsten and may, as a result, affect DNA synthesis, hematopoiesis Hematopoiesis

The process by which the cellular elements of the blood are formed. The three main types of cells are the red cells (erythrocytes), which serve to carry oxygen, the white cells (leukocytes), which function in the prevention of and recovery from
, or detoxification Detoxification Definition

Detoxification is one of the more widely used treatments and concepts in alternative medicine. It is based on the principle that illnesses can be caused by the accumulation of toxic substances (toxins) in the body.
 of contaminants. For a review of current knowledge of tungsten, including environmental chemistry, toxicologic properties, and ongoing investigation into its possible toxicity, see Koutsospyros et al. (2006).

We also attempted to determine whether the frequency and types of cytogenetic cytogenetic /cy·to·ge·net·ic/ (-je-net´ik)
1. pertaining to chromosomes.

2. pertaining to cytogenetics.


cytogenetic

pertaining to or originating from the origin and development of the cell.
 aberrations found in bone marrow specimens from case children were consistent with the frequency of these abnormalities found in the general population of children with ALL enrolled in COG protocols or whether differences in these aberrations provided information that would suggest a common environmental exposure. The following is a report of results of genetic studies conducted on specimens in the Churchill County case-control study case-control study,
n an investigation employing an epidemiologic approach in which previously existing incidents of a medical condition are used in lieu of gathering new information from a randomized population.
.

Materials and Methods

Study participants. We enrolled a total of 205 participants representing 14 (of the 15 eligible) case families and 55 comparison families and asked them to complete mailed questionnaires, participate in personal interviews, and donate biological specimens. We excluded 1 of the 14 cases from the analysis because the child lived in the target area for only a short time before diagnosis. The family of another child declined to participate. A third case was excluded because the diagnosis was acute myelogenous leukemia acute myelogenous leukemia
n. Abbr. AML
Myelogenous leukemia characterized by rapid abnormal increase in the number of myeloblasts and progression of symptoms.
 rather than ALL, leaving 11 case children for our analyses. Community-based reference children were matched to case children on the basis of year of birth and sex. The original goal to match four community-based reference children to each case child was not always achieved. Data from 42 comparison children matched to these 11 case children are also included in our analyses. Twenty parents of case children also provided genetic data. Data from the 2 additional cases excluded from our analysis (because of residency and diagnosis) and the 6 control children matched to them were included in single nucleotide polymorphism Noun 1. single nucleotide polymorphism - (genetics) genetic variation in a DNA sequence that occurs when a single nucleotide in a genome is altered; SNPs are usually considered to be point mutations that have been evolutionarily successful enough to recur in a  (SNP SNP Scottish National Party

Noun 1. SNP - (genetics) genetic variation in a DNA sequence that occurs when a single nucleotide in a genome is altered; SNPs are usually considered to be point mutations that have been evolutionarily
, pronounced "snip") discovery. Blood and cheek-swab specimens were collected for DNA extraction. The study protocol and procedures for written informed consent and assent were reviewed and approved by the CDC Institutional Review Board (IRB IRB

See: Industrial Revenue Bond
; protocol 3195; CDC 2003a) and complied with all applicable requirements of the U.S. regulations. All adult participants signed IRB-approved, written informed consent. Children 7 years of age and older signed written assents, and the parents or legal guardians of children younger than 7 years signed written consents.

Genetic studies. Two types of genetic information were assessed in this case-comparison study: a) We collected and assessed all available information about the gene or chromosomal abnormalities characteristic of a child's leukemia cells that were ascertained at case presentation from bone marrow specimens and used for diagnosis and classification of leukemia. These abnormalities include chromosomal aberrations such as translocations and abnormal numbers of chromosomes (e.g., hyperdiploidy) and gene mutations (Table 1). b) We also assessed inherited genetic variation that may affect susceptibility to leukemia in people exposed to environmental leukemogenic leu·ke·mo·gen·ic
adj.
1. Of or relating to leukemogenesis.

2. Of, relating to, or characterized by a leukemogen.


leukemogenic adjective
 agents (Pui et al. 2004; Smith et al. 2005). This variation includes polymorphisms in genes that code for proteins involved in metabolism of drugs and environmental toxicants, in synthesis of DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
, in innate immunity innate immunity
n.
Immunity that occurs naturally as a result of a person's genetic constitution or physiology and does not arise from a previous infection or vaccination.
, and other enzymes. The most abundant type of polymorphism is a SNP. A locus refers to a particular base pair in the genome. If there is genetic variability at a locus, each variant is referred to as an allele allele (əlēl`): see genetics.
allele

Any one of two or more alternative forms of a gene that may occur alternatively at a given site on a chromosome.
. A person inherits two alleles, one from each parent, at each autosomal Autosomal
Relating to any chromosome besides the X and Y sex chromosomes. Human cells contain 22 pairs of autosomes and one pair of sex chromosomes.

Mentioned in: Ataxia-Telangiectasia, Cutis Laxa, Hemochromatosis
 locus. All loci in this study were biallelic; the majority were SNPs, although one was a deletion and one was a variable number of tandem repeats polymorphism (VNTR VNTR Variable Number of Tandem Repeat(s) ) with two alleles.

We genotyped case and comparison families for genes that code for proteins that may affect, or be affected by, elevated concentrations of tungsten, arsenic, pesticide metabolites Metabolites
Substances produced by metabolism or by a metabolic process.

Mentioned in: Interactions
, or other environmental agents. All gene names, gene symbols, and their accession numbers are from GenBank (http://www.ncbi.nlm.nih.gov/Genbank/). The 13 genes that we focused on include genes in the folate/purine biosynthesis Biosynthesis

The synthesis of more complex molecules from simpler ones in cells by a series of reactions mediated by enzymes. The overall economy and survival of the cell is governed by the interplay between the energy gained from the breakdown of compounds
 pathway: methylene methylene /meth·y·lene/ (meth?i-len) the bivalent hydrocarbon radical —CH2— or CH2dbond.

meth·yl·ene
n.
 tetrahydrofolate reductase reductase /re·duc·tase/ (-tas) a term used in the names of some of the oxidoreductases, usually specifically those catalyzing reactions important solely for reduction of a metabolite.  (MTHFR MTHFR Methylenetetrahydrofolate Reductase (gene mutation) , GenBank accession no. AY338232), serine hydroxymethyltransferase 1 (SHMT1; GenBank accession no. AK223552), reduced folate carrier (SLC (Subscriber Loop Carrier) Lucent's designation for its digital loop carrier (DLC) products. See digital loop carrier. See also 386SLC. 19A1; GenBank accession no. BC003068), thiopurine S-methyltransferase (TPMT TPMT Thiopurine Methyltransferase
TPMT Transaction Processing Monitor Technology
TPMT Total Preventive Maintenance Time
; GenBank accession no. BC009596), and thymidylate synthetase synthetase /syn·the·tase/ (-the-tas) a term used in the names of some of the ligases, no longer favored because of its similarity to synthase and its emphasis on reaction products.

syn·the·tase
n.
 (TYMS TYMS Thymidylate Synthetase ; GenBank accession no. BC083512). We also examined genes involved in xenobiotic xen·o·bi·ot·ic
adj.
Foreign to the body or to living organisms. Used of chemical compounds.

n.
A xenobiotic chemical.



xenobiotic

any substance, harmful or not, that is foreign to the animal's biological system.
 metabolism including ATP-binding cassette, subfamily subfamily /sub·fam·i·ly/ (sub´fam-i-le) a taxonomic division between a family and a tribe.

sub·fam·i·ly
n.
A taxonomic category ranking between a family and a genus.
 B (ABCB ABCB Australian Building Codes Board
ABCB Association of British Certification Bodies
ABCB Alcoholic Beverage Control Board (various US states)
ABCB Air Blast Circuit Breaker
ABCB Air Break Circuit Breaker
1; GenBank accession no. AY910577), glutathione S-transferase pi (GSTP GSTP Global System of Trade Preferences
GSTP Global Straight-Through Processing
GSTP Generalised System of Tariff Preferences (United Kingdom)
GSTP Generic Switching Test Plan
GSTP General Support and Technology Programme
1; GenBank accession no. BT019950), and NAD NAD: see coenzyme. (P)H dehydrogenase, quinone quinone

Any member of a class of cyclic organic compounds comprising a six-membered unsaturated ring (see saturation) to which two oxygen atoms are bonded as carbonyl groups (−C=O; see functional group).
 1 (NQO1; GenBank accession no. BC007659). In addition, we genotyped polymorphisms in the vitamin D vitamin D

Any of a group of fat-soluble alcohols important in calcium metabolism in animals to form strong bones and teeth and prevent rickets and osteoporosis. It is formed by ultraviolet radiation (sunlight) of sterols (see steroid) present in the skin.
 receptor gene (VDR VDR Video Disk Recorder
VDR Vitamin D Receptor
VDR Voyage Data Recorder (Shipborne Black Box)
VDR Virtual Data Room (due diligence excercises)
VDR Voltage Dependent Resistor
VDR VHF Data Radio
; GenBank accession no. AB002168), which plays a role in cell differentiation, and the gene coding for mannose-binding lectin lectin /lec·tin/ (lek´tin) any of a group of hemagglutinating proteins found primarily in plant seeds, which bind specifically to the branching sugar molecules of glycoproteins and glycolipids on the surface of cells.  (protein C) 2 (MBL MBL Mobile
MBL Marine Biological Laboratory
MBL Macquarie Bank Limited
MBL Mannose-Binding Lectin
MBL Marine Boundary Layer
MBL Member Business Lending (credit unions)
MBL Movimiento Bolivia Libre
2; GenBank accession no. BC096181), an important mediator component of the innate immune defense system.

We also performed SNP discovery in three genes that code for enzymes inhibited by tungsten [xanthine dehydrogenase (XDH XDH Xanthine DeHydrogenase ; EC1.1.1.204, National Center for Biotechnology Information The National Center for Biotechnology Information (NCBI) is part of the United States National Library of Medicine (NLM), a branch of the National Institutes of Health. The NCBI is located in Bethesda, Maryland and was founded in 1988.  (NCBI) geneID: 7498, GenBank accession no. NM_000379.3), aldehyde oxidase (AOX AOX Alternative Oxidase
AOx Alcohol Oxidase
AOX Adsorbable Organic Halides
AOX Armies of Exigo (computer game)
AOX Alstria Office REIT AG
AOX Adsorbable Organohalogens
AOX Army of Xena
AOX Automated Optical Cross-Connect
1; EC1.2.3.11; probably identical to retinaldehyde oxidase oxidase /ox·i·dase/ (ok´si-das) any enzyme of the class of oxidoreductases in which molecular oxygen is the hydrogen acceptor.

ox·i·dase
n.
, EC1.2.3.1, NCBI geneID: 316, GenBank accession no. NM_001159.3), and sulfite oxidase (SUOX; EC1.8.3.1, NCBI geneID: 6821, GenBank accession no. NM_000456.2)], using specimens from 11 case children and 24 matched comparison children. The comparison children were selected by randomly sampling two (or in two instances, three) of the comparison children matched to each case child. In addition, to characterize variation in these genes as a resource for future studies, we also included in our SNP discovery 52 specimens from the Human Variation Panels of the Human Genetic Cell Repository (sponsored by the National Institute of General Medical Sciences The U.S. National Institute of General Medical Sciences is one of the National Institutes of Health (NIH), the principal biomedical research agency of the Federal Government.  and deposited with the Coriell Institute for Medical Research). Briefly, amplification primers were designed, and an amplicon tiling model spanning both coding and regulatory regions was developed. Polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) amplicons covering all intron/exon borders, full exon Exon

In split genes, a portion that is included in the ribonucleic acid (RNA) transcript of a gene and survives processing of the RNA in the cell nucleus to become part of a spliced messenger RNA (mRNA) or structural RNA in the cell cytoplasm.
 sequences, known promoter sequences, and 3' untranslated regions (UTRs) of each of the three genes were amplified, and amplicons were sequenced bidirectionally using Big Dye version 3.1 (Applied Biosystems, Foster City, CA) terminator chemistry in conjunction with ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 3700 /3730xl DNA analyzers (Applied Biosystems). For these three genes, we used computer modeling with the freely available programs PolyPhen (http://genetics.bwh.harvard.edu/pph/; Ramensky et al. 2002) and SIFT (sorting intolerant from tolerant) (http://blocks.fhcrc.org/sift/SIFT.html; Ng and Henikoff 2001) to predict which SNPs would cause functional changes in the proteins for which the genes coded.

The polymorphisms and their dbSNP (Single Nucleotide Polymorphism database; http://www.ncbi.nlm.nih.gov/SNP/) identifier, if available, are listed below. Polymorphisms in TYMS 28-bp tandem repeat and TPMT variants 460G[right arrow]A (rs1800460) and 719A[right arrow]G (rs28933403) were genotyped as described by Relling et al. (2004). We genotyped SLC19A1 80A[right arrow]G polymorphism (rs1051266) by direct sequencing, using primers AGTGTCAC CTTCGTCCCCTC (forward and sequencing) and CTCCCGCGTGAAGTTCTT (reverse). We genotyped the SHMT1 1420C[right arrow]T polymorphism (rs1979277) by a modification of a Taqman assay (http://snp500cancer.nci.nih.gov; SNP500 assay number 003_1859), using amplification primers ATTTGTGAAGAAAACATGAA AAA AAA: see American Automobile Association.


(Triple A) A common single-cell battery used in a myriad of electronic devices of all variety. Like its double A (AA) cousin, it provides 1.5 volts of DC power. When used in series, the voltage is multiplied.
 (forward) and AGACTGGCAGGG GATAAGTA (reverse). The GSTP1 313A[right arrow]G (rs1695), NQO1 609C[right arrow]T (rs1800566), MBL2 codon codon: see nucleic acid.  54A[right arrow]G (rs1800450), ABCB1 3435C[right arrow]T (rs1045642), MTHFR 677C[right arrow]T (rs1801133), and VDR start codon FokI polymorphism (rs2228570) were genotyped by DNAPrint Genomics (Sarasota, FL) in a multiplex PCR followed by single base extension.

Statistical analysis. We performed a (univariate) matched logistic regression analysis using data from each locus listed in Tables 2 and 3. Note that all loci are bi-allelic. For all analyses, we used a co-dominant model that treated the number of minor alleles at the locus of interest as the risk factor. For each locus, the "minor" allele is the less common allele. We calculated point estimates, 95% (exact) confidence intervals (CIs) and (exact) p-values using SAS (1) (SAS Institute Inc., Cary, NC, www.sas.com) A software company that specializes in data warehousing and decision support software based on the SAS System. Founded in 1976, SAS is one of the world's largest privately held software companies. See SAS System.  PROCLOGISTIC (version 9.3.1; SAS Institute Inc., Cary, NC). Analyses of AOX1, SUOX, and XDH included data from 11 case children and 24 comparison children matched with the case children who were included in the SNP discovery. Analyses of all other loci included data from 11 case children and 42 matched comparison children.

For loci in AOX1, SUOX, and XDH, we also considered variables that summarize the effect of several loci. Specifically, we compared the ratio of minor alleles with the total number of alleles genotyped between case children and comparison participants. A "minor" allele was declared "rare" if there were two or fewer copies of that allele observed in the Churchill County study population, and a locus was called a rare-allele locus if the minor allele was rare. We also compared the ratio of rare alleles with the total number of alleles at rare-allele loci genotyped between case children and comparison participants. Finally, we compared case and comparison participants' potentially deleterious alleles (as determined by PolyPhen or SIFT). A locus was called a deleterious-allele locus if the minor allele was considered deleterious. We compared the ratio of deleterious alleles with the total number of alleles at the deleterious-allele loci genotyped between case children and comparison participants. For this analysis, we used both the PolyPhen and SIFT determinations of what alleles were deleterious. These summary variables were also analyzed using exact conditional logistic regression for matched sets and were calculated using SAS version 9.1.3.

In addition, for AOX1, SUOX and XDH, we compared the distribution of groups of variants that are inherited together on the same chromosome (haplotypes). When constructing haplotypes, we considered only loci for which the minor allele was not rare. For AOX1, the 6-locus haplotypes using loci 78499A[right arrow]G, 86558A[right arrow]G (rs3731722), 87950T[right arrow]G, 88099G[right arrow]A (rs1050887), 88169A[right arrow]delA, and 88248G[right arrow]T were thus considered. For SUOX we considered a 2-locus haplotype haplotype /hap·lo·type/ (-tip) the group of alleles of linked genes, e.g., the HLA complex, contributed by either parent; the haploid genetic constitution contributed by either parent.

hap·lo·type
n.
 using loci -628G[right arrow]A (rs7297662) and -586T[right arrow]A (rs773126). We did not conduct haplotype analyses for XDH, as all loci had rare minor alleles. The common gene variant is denoted as "0" and the minor variant as "1". For example, for SUOX, the haplotype 10 corresponds to having the minor variant at locus -628, A, and the common variant at locus -586, T. For each gene, we tested the association between haplotypes and disease status assuming a co-dominant model for each haplotype with frequency > 5% in the study population, using the robust score test in CHAPLIN (Epstein and Satten 2003; Satten and Epstein 2004; see http://www.genetics.emory.edu/labs/epstein/software/chaplin/index.html). For each gene we also calculated the (marginal) effect of each haplotype with frequency > 5% on the odds of disease. For these univariate analyses, we considered co-dominant, dominant, and recessive recessive /re·ces·sive/ (re-ses´iv)
1. tending to recede; in genetics, incapable of expression unless the responsible allele is carried by both members of a pair of homologous chromosomes.

2.
 models.

We determined genotypes of available parents of case children for each gene listed in Table 3. We conducted transmission-disequilibrium tests (TDTs) for linkage and association. To include data from two case children with only one available parent, we used the 1-TDT (Sun et al. 1999).

Results

Case children (7 boys and 4 girls) ranged in age from 2 to 19 years at diagnosis and from 3 to 20 years at time of sample collection. Characteristics of the leukemias of 11 case children on which specimens were received are presented in Table 1. The distribution of immunophenotypes (T-cell vs. B-cell leukemia determined by flow cytometry flow cytometry (flōˑ sī·tˑ·m ) among case children was similar to what is seen in the general population of children with ALL in the United States (COG, personal communication). The TEL-AML1 translocation translocation /trans·lo·ca·tion/ (trans?lo-ka´shun) the attachment of a fragment of one chromosome to a nonhomologous chromosome. Abbreviated t.  t(12;21), found in about 25% of patients with ALL (Romana et al. 1995), was identified in the cells of two children between the ages of 2 and 10 years. Hyperdiploidy, another cytogenetic aberration common in ALL, was found in cells from a third child between the ages of 2 and 10 years. In all three instances, chromosomal aberrations were found in association with precursor B-cell ALL cases. The frequency of cytogenetic chromosomal aberrations, such as translocations and hyperdiploidy in this group of leukemia cases, could not be compared with the frequency of these aberrations found in the general population of children with ALL because, in most cases, bone marrow was not stored, testing was not done, or cells did not divide for metaphase metaphase /meta·phase/ (met´ah-faz) the second stage of cell division (mitosis or meiosis), in which the chromosomes, each consisting of two chromatids, are arranged in the equatorial plane of the spindle prior to separation.  analysis.

Polymorphism discovery by DNA sequencing was performed to detect variant forms of genes that code for enzymes inhibited by tungsten. A total of 125 variations in AOX1, 29 variations in SUOX, and 124 variations in XDH were identified, of which 8 AOX1 loci, 7 SUOX loci, and 5 XDH loci were polymorphic in our study population. Analysis was restricted to polymorphisms in the coding regions of the genes (cSNPs) that resulted in amino acid amino acid (əmē`nō), any one of a class of simple organic compounds containing carbon, hydrogen, oxygen, nitrogen, and in certain cases sulfur. These compounds are the building blocks of proteins.  substitutions or those in potential regulatory regions, including the promoter, exon/intron boundaries, and 3' UTR UTR Untranslated Region (genetics)
UTR Unicode Technical Report
UTR Unique Taxpayer Reference (UK Inland Revenue)
UTR Unable to Reach
UTR Unable to Reproduce
UTR University Technical Representative
 (Table 2). Minor allele frequencies for all loci found to be polymorphic in our study population are listed in Tables 2 and 3.

We found no differences in frequencies of minor alleles between case and comparison participants for 10 genes that code for proteins involved in the folate/purine biosynthesis pathway, in xenobiotic metabolism, in cell differentiation, or in innate immunity (Table 3).

Univariate logistic regression (Tables 4 and 5) identified only one locus (SUOX-628G[right arrow]A) that was significantly associated with disease status (p = 0.007). All 11 case children had at least one copy of the minor allele (A); no child carrying a GG genotype had leukemia. Fifty-five percent of the case children and 25% of the comparison children were homozygous ho·mo·zy·gous
adj.
Having the same alleles at one or more gene loci on homologous chromosome segments.


Homozygous
Identical genes controlling a specified inherited trait.
 for the minor allele (A). Forty-six percent of the comparison children were homozygous for the G allele. The proportion of minor SUOX alleles also differed significantly between case and comparison children (p = 0.001); this proportion was not significantly different for AOX1 or XDH. The proportion of rare gene variants was borderline significantly different between case and comparison children for AOX1 (mid-p-value for exact score was 0.06); this is because 2 of the 11 case children, but none of 24 comparison children, had a rare AOX1 allele. No significant differences between rare allele frequencies in case and comparison children were found for XDH or SUOX. Further, the proportion of deleterious alleles, as determined by the PolyPhen and SIFT programs, was not significantly different between case and comparison children (mid-p-values for exact score test were 0.58 for PolyPhen and 0.66 for SIFT). Finally, the TDT revealed no locus in linkage or association with a trait locus (Table 6).

Aldehyde oxidase and sulfite oxidase haplotype analyses. The haplotypes estimated to have non-zero frequency in the AOX1 and SUOX genes calculated using the expectation-maximization (EM) algorithm are given in Table 7. Using the robust score test for haplotype effect, AOX1 had p = 0.38, based on 3 degrees of freedom (df), and SUOX had p = 0.05, based on 3 df. We also examined individual haplotype models for each haplotype with a frequency of at least 5% in the study population. For each haplotype, we compared the null hypothesis null hypothesis,
n theoretical assumption that a given therapy will have results not statistically different from another treatment.

null hypothesis,
n
 that no haplotypes affect the odds of disease with the alternative hypothesis alternative hypothesis Epidemiology A hypothesis to be adopted if a null hypothesis proves implausible, where exposure is linked to disease. See Hypothesis testing. Cf Null hypothesis.  that the selected haplotype affects the odds of disease. Note that results for the recessive model may be unreliable because of the small number of children having two copies of the risk haplotype. Further, although AOX1 haplotype 100000 (G-A-T-G-A-G) also has a nominally significant p-value under a recessive model, it has a protective effect. SUOX haplotype 10 (A-T A-T Ataxia Telangiectasia (form of muscular weakness) ) has a significant p-value for both co-dominant and dominant models; the first position corresponds to the only locus significantly associated with case status in univariate analyses (Table 4). SUOX haplotype 00 (A-T) is close to borderline significant but protective for the co-dominant and recessive models. In general, the sign of the haplotype effect in SUOX tracks the genotype at the first locus, suggesting this locus alone accounts for the observed association.

Discussion

Investigators understood from the outset that finding a cause of leukemia in this study was unlikely because of the small number of case children. Nonetheless, we decided to perform genetic testing Genetic Testing Definition

A genetic test examines the genetic information contained inside a person's cells, called DNA, to determine if that person has or will develop a certain disease or could pass a disease to his or her offspring.
 because the results from this study may be useful in generating hypotheses for subsequent leukemia clusters and because of the possibility of performing meta-analysis on data from this and subsequent studies to elucidate causal mechanisms.

We studied two types of genetic information: a) the cytogenetic and molecular changes that are found in bone marrow cells from ALL case children at diagnosis and b) the normal genetic variations that occur in people that might make some more susceptible than others to the effects of environmental chemicals.

With regard to cytogenetic studies, no evidence was found to suggest that a common environmental exposure caused the leukemias, although this possibility could not be ruled out. Cytogenetic studies on pretreatment pretreatment,
n the protocols required before beginning therapy, usually of a diagnostic nature; before treatment.

pretreatment estimate,
n See predetermination.
 bone marrow specimens suggested that the chromosomal aberrations and cell immunophenotypes were present in approximately the same proportion as in the general population of childhood ALL cases in the United States, although this could not be confirmed for chromosomal aberrations because testing was not performed in many cases and bone marrow was not stored for later testing.

For normal variation, we compared the distributions of gene variants in case and comparison families for genes that code for four groups of proteins: enzymes that are inhibited by tungsten, folate pathway enzymes, proteins involved in cell differentiation, and enzymes that activate or detoxify de·tox·i·fy
v.
1. To counteract or destroy the toxic properties of a substance.

2. To remove the effects of poison from something, such as the blood.

3.
 carcinogens Carcinogens
Substances in the environment that cause cancer, presumably by inducing mutations, with prolonged exposure.

Mentioned in: Colon Cancer, Rectal Cancer
. We also studied a gene variant in a protein involved in innate immunity.

Three mammalian enzymes--xanthine dehydrogenase, sulfite oxidase, and aldehyde aldehyde (ăl`dəhīd) [alcohol + New Lat. dehydrogenatus=dehydrogenated], any of a class of organic compounds that contain the carbonyl group, and in which the carbonyl group is bonded to at least one hydrogen; the general  oxidase--require molybdenum molybdenum (məlĭb`dənəm) [Gr.,=leadlike], metallic chemical element; symbol Mo; at. no. 42; at. wt. 95.94; m.p. about 2,617°C;; b.p. about 4,612°C;; sp. gr. 10.22 at 20°C;; valence +2, +3, +4, +5, or +6.  as a cofactor cofactor

An atom, organic molecule, or molecular group that is necessary for the catalytic activity (see catalysis) of many enzymes. A cofactor may be tightly bound to the protein portion of an enzyme and thus be an integral part of its functional structure, or it may
 (Garner and Stewart 2002). Tungsten readily replaces molybdenum as a cofactor in these enzymes, thus inactivating them (L'vov et al. 2002). Tungsten has also been shown to prevent incorporation of molybdenum without itself being incorporated into xanthine dehydrogenase. Sulfite oxidase has also been shown to be inhibited by arsenite in vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment.

in vi·tro
adj.
In an artificial environment outside a living organism.
 (Gardlik and Rajagopalan 1991). Although it is not clear how inhibition of these enzymes might affect risk for leukemia, plausible mechanisms can be hypothesized. For example, aldehyde oxidase (probably identical to retinaldehyde oxidase) irreversibly converts retinaldehyde to retinoic acid retinoic acid /ret·i·no·ic ac·id/ (ret?i-no´ik) an oxidized derivative of retinol, believed to be the form of vitamin A that plays a role in the development and growth of bone and in the maintenance of normal epithelial structures. , which mediates hematopoiesis and progenitor cell differentiation through its effects on Hox gene expression during embryogenesis Embryogenesis

The formation of an embryo from a fertilized ovum, or zygote. Development begins when the zygote, originating from the fusion of male and female gametes, enters a period of cellular proliferation, or cleavage.
 (Look 1997; Tocci et al. 1996).

A comprehensive survey of the polymorphisms found in the coding and regulatory regions of these three genes revealed only one locus (SUOX -628) was significantly associated with disease status. If we adjusted for the number of comparisons made in the univariate logistic regression analyses, this locus would no longer be significant. However, the pattern of genotypes is noteworthy (all children with leukemia carried at least one copy of the A allele; no child having the GG genotype had leukemia).

Sulfite oxidase is required for the physiologically essential oxidation of sulfite sulfite /sul·fite/ (sul´fit) any salt of sulfurous acid.

sul·fite
n.
A salt or ester of sulfurous acid.
 to sulfate sulfate, chemical compound containing the sulfate (SO4) radical. Sulfates are salts or esters of sulfuric acid, H2SO4, formed by replacing one or both of the hydrogens with a metal (e.g., sodium) or a radical (e.g., ammonium or ethyl). , the final step in the oxidative breakdown of the amino acids cysteine cysteine (sĭs`tēn), organic compound, one of the 20 amino acids commonly found in animal proteins. Only the l-stereoisomer participates in the biosynthesis of mammalian protein.  and methionine methionine (mĕthī`ənēn), organic compound, one of the 20 amino acids commonly found in animal proteins. Only the L-stereoisomer appears in mammalian protein. . Deficiency of sulfite oxidase due to mutations in the human SUOX gene causes severe neurologic deficits resulting in death at an early age or mental retardation [for a review, see Tan et al. (2005)].

We found nothing in the scientific literature about the effect of the SUOX -628G[right arrow]A variant on sulfite oxidase activity. This polymorphism is in the 5' UTR, between untranslated exons and the first translated exon. Although the physiologic consequences of polymorphisms in untranlsated regions remain to be fully elucidated, these polymorphisms may regulate gene expression through effects on mRNA stability, localization Customizing software and documentation for a particular country. It includes the translation of menus and messages into the native spoken language as well as changes in the user interface to accommodate different alphabets and culture. See internationalization and l10n. , and translational efficiency (Gebauer and Hentze 2004). If this variant were to express less sulfite oxidase protein or code for an enzyme with decreased sulfite oxidase activity, it is possible that exposure to tungsten, arsenic, or both could further decrease activity, thus creating a situation wherein people are vulnerable to adverse effects of decreased sulfite oxidase activity. Many of the comparison children living in Churchill County had this gene variant as well as tungsten and arsenic exposure but did not develop leukemia. For this reason, we think that exposure to additional chemicals would be required to cause adverse health effects.

Whether and how the SUOX-628 locus genotype in the 5' UTR might affect the availability of sulfite oxidase need to be studied further. At this point, we have no evidence to suggest that any genotype at this locus of SUOX affects the concentration or activity of sulfite oxidase. Population stratification (case and comparison groups coming from genetically diverse populations thereby showing spurious associations) probably does not explain the finding of an association at the -628 locus with disease status because 95% of case and comparison children identified as white, with the two groups having similar ethnicity. Because of the large number of comparisons made, there are several possible explanations for these associations. They may be because of chance alone; alternatively, carrying the GG genotype may be protective or carrying an A allele may increase risk. Last, the locus we found to be associated with disease status may be in linkage disequilibrium with another unrelated locus. Although the finding of an association is interesting and warrants further research, the genotype at the SUOX-628 locus is currently not predictive of any clinical outcome nor does it have any known use in clinical care.

Regarding tungsten mutagenicity mutagenicity /mu·ta·ge·nic·i·ty/ (-je-nis´it-e) the property of being able to induce genetic mutation.

mutagenicity

the property of being able to induce genetic mutation.
, in a study by Miller et al. (2001), exposure of a nontumorigenic, human osteoblast-like cell line to heavy metal-tungsten alloys, dense heavy metal composite materials comprising tungsten (91-93%), nickel (3-5%), and either cobalt or iron (2-4%) resulted in a significant increase in transformation frequency (8.9- [+ or -] 0.93-fold). The mechanism for transformation appeared to be increased DNA breakage or chromosomal aberrations. However, tungsten alone did not cause DNA breaks in these cells.

Although the National Toxicology Program National Toxicology Program Environment A program that conducts toxicologic tests on substances frequently found at the EPA's National Priorities List sites, which have the greatest potential for human exposure  (NTP (Network Time Protocol) A TCP/IP protocol used to synchronize the real time clock in computers, network devices and other electronic equipment that is time sensitive. It is also used to maintain the correct time in NTP-based wall and desk clocks. ) found no evidence from a literature review that tungsten is carcinogenic carcinogenic

having a capacity for carcinogenesis.
 (NTP 2003), it is now studying short-, intermediate-, and long-term exposure effects of tungsten using a variety of toxicologic end points including carcinogenicity carcinogenicity /car·ci·no·ge·nic·i·ty/ (kahr?si-no-je-nis´i-te) the ability or tendency to produce cancer.

carcinogenicity

the ability or tendency to produce cancer.
. Rats and mice of both sexes will be exposed to sodium tungstate dihydrate in their drinking water for periods ranging from 2 weeks to 2 years. Despite the lack of evidence in the literature, the ability of tungsten to inhibit three enzymes that may affect hematopoiesis or detoxification could conceivably alter risk for mutations or chromosomal aberrations.

In previous studies, rats fed high tungsten and molybdenum-free diets were XDH-deficient, which inhibits conversion of purines to uric acid. Because imbalances among deoxynucleotide pools have been linked to mutagenesis mutagenesis /mu·ta·gen·e·sis/ (mu?tah-jen´e-sis)
1. the production of change.

2. the induction of genetic mutation.


mu·ta·gen·e·sis
n. pl.
, it is plausible that tungsteninduced derangements in purines could be involved in leukemogenesis leu·ke·mo·gen·e·sis
n.
Induction, development, and progression of a leukemic disease.



leukemogenesis

the process of generation of myeloid cell lines in bone marrow and extramedullary sites; a critical feature in myeloproliferative
 (James et al. 1994; Kunz and Kohalmi 1991).

Other studies have shown that molybdenum-deficient rats fed tungsten had decreased sulfite oxidase and xanthine oxidase activities. Although these rats appeared healthy, they were more susceptible than control rats to bisulfite bi·sul·fite
n.
1. The univalent inorganic acid group HSO3.

2. A salt of sulfurous acid containing this group.
 toxicity. The lethal dose for intraperitoneal bisulfite was approximately 2.6 times lower for the tungsten-treated animals (Cohen cohen
 or kohen

(Hebrew: “priest”) Jewish priest descended from Zadok (a descendant of Aaron), priest at the First Temple of Jerusalem. The biblical priesthood was hereditary and male.
 et al. 1973). Sulfite oxidase is also inactivated inactivated

rendered inactive; the activity is destroyed.


inactivated viruses
treated so that they are no longer able to produce evidence of growth or damaging effect on tissue.
 by arsenite, although by a mechanism different than tungsten inactivation inactivation /in·ac·ti·va·tion/ (in-ak?ti-va´shun) the destruction of biological activity, as of a virus, by the action of heat or other agent. . Arsenite binds to sulfhydryl groups of molybdopterin and in doing so ultimately displaces molybdenum (Gardlik et al. 1991).

Case and comparison specimens were also genotyped for polymorphic forms of genes that code for enzymes in the folate/purine biosynthesis pathway. The folate pathway is essential to single-carbon metabolism, which is critical in DNA synthesis and repair, regulation of gene expression Gene modulation redirects here. For information on therapeutic regulation of gene expression, see therapeutic gene modulation.
For vocabulary, see Glossary of gene expression terms


.
, and protein and polyamine polyamine /poly·am·ine/ (-am´en) any compound, e.g., spermine or spermidine, containing two or more amino groups.

pol·y·a·mine
n.
 synthesis (Smith et al. 2005). We studied polymorphic forms of folate/purine pathway enzymes including MTHFR, TYMS, SLC19A1, TPMT, and SHMT1 and found no differences in distribution of polymorphisms between case and comparison families. However, Skibola et al. (1999) found a significant association between two polymorphic forms of MTHFR, including the 677C[right arrow]T polymorphism, and decreased risk for ALL. Skibola et al. (2002) also reported that two other polymorphic genes in the folate pathway conferred decreased risk for ALL: the 5' UTR polymorphism of TYMS and the 1420C[right arrow]T polymorphism of SHMT1. An association between the 677C[right arrow]T substitution in MTHFR and hyperdiploidy, a common cytogenetic aberration in childhood ALL, has also been demonstrated (Pui et al, 2004).

Finally, we genotyped specimens to determine the relative frequencies of polymorphic forms of the gene coding for the carcinogen-metabolizing enzyme NQO1 (EC1.6.992). NQO1 protects against oxidative stress by catalyzing the two-electron reduction of quinones to hydroquinones. The 609C[right arrow]T polymorphism codes for an enzyme with low activity and has been associated with increased risk for ALL in children (relative risk, 1.7; 95% CI, 1.2-2.4) (Krajinovic et al. 2002). Frequencies of the high-risk polymorphism were not significantly different between Churchill County case and comparison children. Our failure to replicate results from previous studies of genetic polymorphisms associated with ALL might be because of the small size of our study population, false positive findings in the original studies (type 1 error), or differences among the genetic make up of the background populations sampled in this and other studies.

Although childhood leukemia has a shorter latency than most solid tumors occurring later in life, exposures that can no longer be documented may have occurred years before the disease was manifested. In the case of leukemia, in utero exposures are especially important. Cytogenetic translocations and hyperdiploidy noted in diagnostic bone marrow cells of children with leukemia have been found in the children's neonatal blood spots, thus indicating that they are induced in utero (McHale and Smith 2004). Latency periods have been noted, in some cases, to exceed 10 years. The mechanism for generation of most of the translocations has been suggested to be aberrant repair following abortive apoptosis rather than V(D)J recombination recombination, process of "shuffling" of genes by which new combinations can be generated. In recombination through sexual reproduction, the offspring's complete set of genes differs from that of either parent, being rather a combination of genes from both parents.  or exposure to topoisomerase topoisomerase

an enzyme involved in DNA replication that introduces a single-strand nick in the DNA enabling it to swivel and thereby relieve the accumulated winding strain generated during unwinding of the double helix.
 II inhibitors (McHale and Smith 2004).

The environmental and genetic factors that we focus on in this article, the SUOX-628 locus and exposure to tungsten and arsenic, were present before an increase of incidence of childhood ALL was reported and continued to be present after leukemias were no longer occurring at an elevated rate, thus weakening the case for their having a role in causality. As a result of this investigation, water treatment has been improved and exposure to tungsten and arsenic reduced, although any effects of removing these chemicals have not had time to be manifested.

Conclusions

From the information obtained in this study and in consultation with members of the COG, limited conclusions can be drawn. The distribution of types of leukemia in Churchill County (for example, the ratio of pre-B-cell to T-cell leukemias and the ratio of standard-risk to high-risk cases) is what one would expect in comparison to the larger population of leukemias studied by the COG in the United States. Although genetic studies did not provide evidence that a common agent or genetic susceptibility factor had caused the leukemias, the association between the SUOX-628 genotype and ALL, possibly interacting with high tungsten or arsenic levels, warrants further investigation. We are studying the prevalence of these variants in a larger population of children with ALL. We assume that there was no major change in the prevalence of alleles or exposure in the Churchill County population in the years preceding this investigation. We cannot rule out the possibility that exposures not accounted for in this investigation might have been associated with cases of leukemia either in conjunction with the documented exposures or unrelated to them; however, the findings of this study and those of Rubin et al. (2007) do not support an association of the known exposures with the temporal increase in the incidence of leukemia in Churchill County, Nevada Churchill County is a county located in the southwestern U.S. state of Nevada. As of the 2000 census, the population was 23,982. Its population in 2006 was estimated to be 27,371. .

REFERENCES

CDC. 2003a. Cross-Sectional Exposure Assessment of Environmental Contaminants in Churchill County, Nevada-Appendix C Investigation Protocol. Atlanta, GA: Centers for Disease Control and Prevention.

CDC. 2003b. The National Report on Human Exposure to Environmental Chemicals. Atlanta, GA: Centers for Disease Control and Prevention. Available: http://www.cdc.gov/exposurereport/ [accessed 31 May 2006].

Cohen HJ, Drew RT, Johnson JL, Rajagopalan KV. 1973. Molecular basis of the biological function of molybdenum. The relationship between sulfite oxidase and acute toxicity of bisulfite and [SO.sub.2]. Proc Natl Acad Sci 70: 3655-3659.

Epstein MP, Satten GA. 2003. Inference on haplotype effects in case-control studies using unphased genotype data. Am J Hum Genet genet: see civet.  73; 1316-1329.

Gardlik S, Rajagopalan KV. 1991. The mechanisms of inactivation of sulfite oxidase by periodate Per`i´o`date

n. 1. (Chem.) A salt of periodic acid.
 and arsenite. J Biol Chem 266: 16627-16632.

Garner CD, Stewart LJ. 2002. Tungsten-substituted molybdenum enzymes. In: Molybdenum and Tungsten: Their Roles in Biological Processes (Sigel H, Sigel A, eds). Metal Ions in Biological Systems, Vol 39. New York: Marcel Dekker, 699-726.

Gebauer F, Hentze M. W. 2004. Molecular mechanisms of translational control. Nature Rev Mol Cell Biol 5: 827-835.

James SJ, Basnakian AG, Miller BJ. 1994. In vitro folate deficiency induces deoxynucleotide pool imbalance, apoptosis, and mutagenesis in Chinese hamster ovary cells. Cancer Res 54: 5075-5080.

Koutsospyros A, Braida W, Christodoulatos C, Dermatas D, Strigul N. 2006. A review of tungsten: from environmental obscurity to scrutiny. J Hazard Mater 136: 1-19.

Krajinovic M, Sinnett H, Richer C, Labuda D, Sinnett D. 2002. Role of NQO1, MPO MPO myeloperoxidase.
MPO Myeloperoxidase, see there
 and CYP CYP

In currencies, this is the abbreviation for the Cyprus Pound.

Notes:
The currency market, also known as the Foreign Exchange market, is the largest financial market in the world, with a daily average volume of over US $1 trillion.
2E1 genetic polymorphisms in the susceptibility to childhood acute lymphoblastic leukemia. Int J Cancer 97: 230-236.

Kunz BA, Kohalmi SE. 1991. Modulation of mutagenesis by deoxyribonucleotide deoxyribonucleotide /de·oxy·ri·bo·nu·cleo·tide/ (-noo´kle-o-tid) a nucleotide having a purine or pyrimidine base bonded to deoxyribose, which in turn is bonded to a phosphate group.  levels. Annu Rev Genet 25: 339-359.

Look AT. 1997. Oncogenic oncogenic /on·co·gen·ic/ (-jen´ik) giving rise to tumors or causing tumor formation; said especially of tumor-inducing viruses.

on·co·gen·ic or on·cog·e·nous
adj.
 transcription factors in the human acute leukemias. Science 278: 1059-1064.

L'vov NP, Nosikov AN, Antipov AN. 2002. Tungsten-containing enzymes. Biochemistry 67: 196-200.

McHale MC, Smith MT. 2004. Prenatal origin of chromosomal translocations in acute childhood leukemia: implications and future directions. Am J Hematol 75: 254-257.

Miller AC, Mog S, McKinney L, Luo L, Allen J, Xu J, et al. 2001. Neoplastic neoplastic /neo·plas·tic/ (ne?o-plas´tik)
1. pertaining to a neoplasm.

2. pertaining to neoplasia.


neoplastic

pertaining to neoplasia or a neoplasm.
 transformation of human osteoblast osteoblast /os·teo·blast/ (os´te-o-blast?) a cell arising from a fibroblast, which, as it matures, is associated with bone production.

os·te·o·blast
n.
 cells to the tumorigenic tu·mor·i·gen·ic
adj.
Capable of causing tumors.
 phenotype by heavy metal-tungsten alloy particles: induction of genotoxic genotoxic /ge·no·tox·ic/ (je´no-tok?sik) damaging to DNA: pertaining to agents known to damage DNA, thereby causing mutations, which can result in cancer.

ge·no·tox·ic
adj.
 effects. Carcinogenesis car·ci·no·gen·e·sis
n.
The production of cancer.



carcinogenesis

production of cancer.


biological carcinogenesis
viruses and some parasites are capable of initiating neoplasia.
 22: 115-125.

Ng PC, Henikoff S. 2001. Predicting deleterious amino acid substitutions. Genome Res 11: 863-874. Available: http://blocks.fhcrc.org/sift/SIFT.html [accessed 31 May 2006]

NTP. Tungsten and Selected Tungsten Compounds. Review of Toxicological Literature. 2003. Research Triangle Park Research Triangle Park, research, business, medical, and educational complex situated in central North Carolina. It has an area of 6,900 acres (2,795 hectares) and is 8 × 2 mi (13 × 3 km) in size. Named for the triangle formed by Duke Univ. , NC: National Institute of Environmental Health Sciences The National Institute of Environmental Health Sciences (NIEHS) is one of 27 Institutes and Centers of the National Institutes of Health (NIH),which is a component of the Department of Health and Human Services (DHHS). The Director of the NIEHS is Dr. David A. Schwartz. , National Toxicology Program. Available: http://ntp.niehs.nih.gov/ntp/htdocs/Chem_Background/ExSumPdf/tungsten.pdf [accessed 31 May 2006].

Packer BR, Yeager M, Burdett L, Welch R, Beerman M, Qi L, et al. 2006. SNP500Cancer: a public resource for sequence validation, assay development, and frequency analysis for genetic variation in candidate genes. Nucleic Acids Res 1: 34 Database issue:D617-D621. Available: http://snp500cancer.nci.nih.gov [accessed 2 June 2006]

Pui C-H, Relling MV, Downing JR. 2004. Acute lymphoblastic leukemia. N Engl J Med 350: 1535-1548.

Ramensky V, Bork P, Sunyaev S. 2002. Human non-synonymous SNPs: server and survey. Nucleic Acids Res 30:3894-900. Available: http://genetics.bwh.harvard.edu/pph/ [accessed 31 May 2006]

Relling MV, Yang W, Sas S, Cook EH, Rosner GL, Neel M, et al. 2004. Pharmacogenetic risk factors for osteonecrosis osteonecrosis /os·teo·ne·cro·sis/ (os?te-o-ne-kro´sis) necrosis of a bone.

os·te·o·ne·cro·sis
n.
Necrosis of bone.
 of the hip among children with leukemia. J Clin Oncol 22: 3930-3936.

Romana SP, Poirel H, Leconiat M, Flexor flexor /flex·or/ (flek´ser)
1. causing flexion.

2. a muscle that flexes a joint.


flexor retina´culum  see entries under retinaculum.
 MA, Mauchauffe M, Jonveaux P, et al. 1995. High frequency of 1(12; 21) in childhood B-lineage acute lymphoblastic leukemia. Blood 86: 4263-4269.

Rubin CS, Holmes AK, Belson MG, Jones RL, Flanders WD, Kieszak SM, et al. 2007. Investigating childhood leukemia in Churchill County, Nevada. Environ Health Perspect 115: 151-157.

Satten GA, Epstein MP. 2004. Comparison of prospective and retrospective methods for haplotype inference in casecontrol studies. Genet Epidemiol 27: 192-201.

Skibola CF, Smith MT, Hubbard A, Shane B, Roberts AC, Law GR, et al. 2002. Polymorphisms in the thymidylate synthase and serine hydroxymethyltransferase genes and risk of adult acute lymphocytic leukemia acute lymphocytic leukemia
n.
See acute lymphoblastic leukemia.


acute lymphocytic leukemia Acute lymphoblastic leukemia, ALL A malignant lymphoproliferative process that commonly affects children and young adults
. Blood 99: 3786-3791.

Skibola CF, Smith MT, Kane E, Roman E, Rollinson S, Cartwright RA, et al. 1999. Polymorphisms in the methylenetetrahydrofolate reductase gene are associated with susceptibility to acute leukemia in adults. Proc Natl Acad Sci USA 96: 12810-12815.

Smith MT, McHale CM, Wiemels JL, Zhang L, Wiencke JK, Zheng S, et al. 2005. Molecular biomarkers for the study of childhood leukemia. Toxicol Appl Pharmacol 206: 237-245.

Steinmaus C, Lu M, Todd RL, Smith AH. 2004. Probability estimates for the unique childhood leukemia cluster in Fallon, Nevada, and risks near other U.S. military aviation facilities. Environ Health Perspect 112: 766-771.

Sun FZ, Flanders WD, Yang Q, Khoury MJ. 1999. Transmission disequilibrium test The transmission disequilibrium test (TDT) was proposed by Spielman, McGinnis & Ewens (1993) as a family-based association test to test for the presence of genetic linkage between a genetic marker and a trait.  (TDT) when only one parent is available: the 1-TDT. Am J Epidemiol 150: 97-104.

Tan W-H, Eichler FS, Hoda S, Lee MS, Baris H, Hanley CA, Grant PE, Krishnamoorthy KS, Shih VE. 2000. Isolated sulfite oxidase deficiency: a case report with a novel mutation and review of the literature. Pediatrics 116: 757-66.

Tocci A, Parolini I, Gabbianelli M, Testa U, Luchetti L, Samoggia P, et al. 1996. Dual action of retinoic acid on human embryonic/fetal hematopoiesis: blockade of primitive progenitor pro·gen·i·tor
n.
1. A direct ancestor.

2. An originator of a line of descent.



progenitor

ancestor, including parent.


progenitor cell
stem cells.
 proliferation and shift from multipotent/erythroid/monocytic to granulocytic granulocytic

pertaining to granulocytes.


granulocytic leukemia
see myelocytic leukemia.

granulocytic sarcoma
extramedullary growth of multiple, focal granulocytic neoplasm. They may be neutrophilic or eosinophilic.
 differentiation program. Blood 87: 1728-1736.

Karen K. Steinberg, (1) Mary V. Relling, (2) Margaret L. Gallagher, (1) Christopher N. Greene, (1) Carol S. Rubin, (3) Deborah French, (2) Adrianne K. Holmes, (3) William L. Carroll, (4) Deborah A. Koontz, (1) Eric J. Sampson, (1) and Glen A. Satten (1)

(1) Division of Laboratory Sciences, National Center for Environmental Health, Centers for Disease Control and Prevention, Atlanta, Georgia, USA; (2) Pharmaceutical Sciences, St. Jude Children's Research Hospital, Memphis, Tennessee, USA; (3) Division of Environmental Hazards and Health Effects, National Center for Environmental Health, Centers for Disease Control and Prevention, Atlanta, Georgia, USA; (4) Hassenfeld Children's Center, New York University New York University, mainly in New York City; coeducational; chartered 1831, opened 1832 as the Univ. of the City of New York, renamed 1896. It comprises 13 schools and colleges, maintaining 4 main centers (including the Medical Center) in the city, as well as the  School of Medicine, New York, New York, USA

This article is part of the mini-monograph "Cancer Cluster Activities at the Centers for Disease Control and Prevention."

Address correspondence to K. Steinberg, Coordinating Center for Health Promotion, 2877 Brandywine Rd., Mailstop-K88, Koger Center, Williams Building, Room 3809, Chamblee, GA 30341 USA. Telephone: (770) 488-6067. Fax: (770) 488-6448. E-mail: kks1@cdc.gov

We express our appreciation for the guidance and advice of the Children's Oncology Group and K.V. Rajagopalan, Department of Biochemistry, Duke University.

This work was supported by National Cancer Institute grant CA 51001 and National Institutes of Health grant CA21765; by a Center of Excellence grant from the State of Tennessee; and by American Lebanese Syrian Associated Charities The American Lebanese Syrian Associated Charities (ALSAC) has been the exclusive fund-raising organization of St. Jude Children's Research Hospital since 1957. ALSAC is the third largest healthcare related charity in the United States. .

The authors declare they have no competing financial interests.

Received 18 January 2006; accepted 19 July 2006.
Table 1. Eleven cases of ALL in Churchill County, Nevada, by age group,
diagnosis, WBC count, and cytogenetic studies.

Age group at
diagnosis
(years)       Diagnosis             WBC count

12-20         Precursor B-cell ALL   63,700
12-20         T-cell ALL             84,000
2-10          Precursor B-cell ALL    6,800
2-10          Precursor B-cell ALL  216,500
2-10          Precursor B-cell ALL    3,900
2-10          Precursor B-cell ALL    2,400
2-10          Precursor B-cell ALL    7,200
2-10          Precursor B-cell ALL    9,800
2-10          Precursor B-cell ALL    2,600
2-10          Precursor B-cell ALL  Pancytopenia
2-10          Precursor B-cell ALL  Not obtained

Age group at
diagnosis
(years)       Cytogenetic results

12-20         No marrow stored
12-20         Metaphase cells show male karyotype with no clonal
                abnormality reported
2-10          Metaphase cells show normal male karyotype on GTG banding
2-10          Cells did not divide for metaphase analysis
2-10          Metaphase cells show male karyotype with no clonal
                abnormality reported
2-10          Metaphase cells show normal male karyotype
2-10          Abnormal karyotype consistent with ALL. T (12; 21)
                TEL-AML1 positive; MLL negative; E2A-PBX negative,
                BCR-ABL negative.
                Chromosome 12p aberration in association with chromosome
                13q aberration
2-10          Metaphase cells show male karyotype with no clonal
                abnormality reported
2-10          Metaphase cells show abnormal female karyotype.
                Hyperdiploid clone in ~75% of cells
2-10          TEL-AML1 positive; MLL negative; E22A-PBX-1 negative;
                BCR-ABL negative
2-10          Not obtained

WBC, white blood cell.
Note: When translocations are not reported, neither the
reverse-transcriptase polymerase chain reaction nor fluorescence in situ
hybridization was done.

Table 2. Coding/regulatory region polymorphism discovery results for
aldehyde oxidase, sulfate oxidase, and xanthine dehydrogenase.

                              Gene      Amino        Minor allele
Polymorphism (a)              position  acid change  case group

AOX1 37630T[right arrow]A     Exon 17   I598N        0.050 (20)
AOX1 67888A[right arrow]G     Exon 26   L957R        0.050 (20)
AOX1 78499A[right arrow]G     Exon 30   N1135S       0.091 (22)
AOX1 86558A[right arrow]G     Exon 34   H1297R       0.167 (12)
AOX1 87950T[right arrow]G     3' UTR    NA           0.063 (16)
AOX1 88099G[right arrow]A     3' UTR    NA           0.056 (18)
AOX1 88169[right arrow]delAT  3' UTR    NA           0.556 (18)
AOX1 88248G[right arrow]T     3' UTR    NA           0.056 (18)
SUOX-628G[right arrow]A       5' UTR    NA           0.773 (22)
SUOX-619G[right arrow]A       5' UTR    NA           0.071 (14)
SUOX-586T[right arrow]A       5' UTR    NA           0.357 (14)
SUOX-429T[right arrow]C       5' UTR    NA           0 (14)
SUOX-317G[right arrow]A       5' UTR    NA           0 (16)
SUOX 1642G[right arrow]A      Exon 6    E159L        0.056 (18)
SOUX 1796C[right arrow]T      Exon 6    P210L        0 (18)
XDH 26391G[right arrow]A      Exon 7    G172R        0 (20)
XDH 42390T[right arrow]A      Exon 17   N602L        0 (14)
XDH 42404G[right arrow]A      Exon 17   R607Q        0 (14)
XDH 44269A[right arrow]G      Exon 18   I646V        0.046 (22)
XDH 75118A[right arrow]T      Exon 34   I1238F       0 (18)

                                                    Predicted protein
                              Frequencies           phenotype
Polymorphism (a)              comparison group (b)  PolyPhen (c)

AOX1 37630T[right arrow]A     0 (42)                Probably damaging
AOX1 67888A[right arrow]G     0 (48)                Benign
AOX1 78499A[right arrow]G     0.119 (42)            Benign
AOX1 86558A[right arrow]G     0.029 (34)            Benign
AOX1 87950T[right arrow]G     0.053 (38)            NA
AOX1 88099G[right arrow]A     0.043 (46)            NA
AOX1 88169[right arrow]delAT  0.413 (46)            NA
AOX1 88248G[right arrow]T     0.048 (42)            NA
SUOX-628G[right arrow]A       0.396 (48)            NA
SUOX-619G[right arrow]A       0 (46)                NA
SUOX-586T[right arrow]A       0.435 (46)            NA
SUOX-429T[right arrow]C       0.022 (46)            NA
SUOX-317G[right arrow]A       0.018 (40)            NA
SUOX 1642G[right arrow]A      0 (42)                Benign
SOUX 1796C[right arrow]T      0.024 (42)            Probably damaging
XDH 26391G[right arrow]A      0.045 (44)            Benign
XDH 42390T[right arrow]A      0.029 (34)            Probably damaging
XDH 42404G[right arrow]A      0.029 (34)            Benign
XDH 44269A[right arrow]G      0 (48)                Benign
XDH 75118A[right arrow]T      0.022 (46)            Benign

                              Predicted protein phenotype
Polymorphism (a)              SIFT (d)

AOX1 37630T[right arrow]A     Not tolerated (0.02)
AOX1 67888A[right arrow]G     Tolerated (0.16)
AOX1 78499A[right arrow]G     Tolerated (1.00)
AOX1 86558A[right arrow]G     Tolerated (0.22)
AOX1 87950T[right arrow]G     NA
AOX1 88099G[right arrow]A     NA
AOX1 88169[right arrow]delAT  NA
AOX1 88248G[right arrow]T     NA
SUOX-628G[right arrow]A       NA
SUOX-619G[right arrow]A       NA
SUOX-586T[right arrow]A       NA
SUOX-429T[right arrow]C       NA
SUOX-317G[right arrow]A       NA
SUOX 1642G[right arrow]A      Tolerated (0.15)
SOUX 1796C[right arrow]T      Not tolerated (0.00)
XDH 26391G[right arrow]A      Not tolerated (0.05)
XDH 42390T[right arrow]A      Not tolerated (0.02)
XDH 42404G[right arrow]A      Not tolerated (0.04)
XDH 44269A[right arrow]G      Tolerated (0.64)
XDH 75118A[right arrow]T      Tolerated (0.56)

NA, not applicable.
(a) Genomic DNA position coordinates are relative to Start ATG codon for
each gene. Variations present in NCBI dbSNP database
(http://www.ncbi.nlm.nih.gov/SNP/): AOX1 86558A[right arrow]G
(rs3731722), AOX1 87950T[right arrow]G (rs1050884),AOX1
88099G[right arrow]A (rs1050887), AOX1 88169A[right arrow]delAT
(rs34427902), SUOX-628G[right arrow]A (rs7297662),
SUOX-586T[right arrow]A (rs773126), SUOX-317G[right arrow]A(rs7963590),
XDH 44269A[right arrow]G (rs17323225). (b) The number of sequenced
chromosomes from the 11 case children and the 24 matched comparison
children is in parentheses. (c) PolyPhen prediction of functional effect
of human nsSNPs (http://genetics.bwh.harvard.edu/pph/). (d) SIFT values
< 0.05 are predicted to be deleterious.

Table 3. Gene characteristics and minor allele frequencies for
polymorphisms (excluding AOX1, SUOX, and XDH).

                                                   Minor allele
                                                   frequency (a)
Polymorphism                  Amino acid change    Case group

GSTP1 313A[right arrow]G      Ile[right arrow]Val  0.25 (20)
MBL2 codon 54A[right arrow]G  Asp[right arrow]Gly  0.23 (22)
ABCB1 3435C[right arrow]T     Synonymous           0.35 (20)
MTHFR 677C[right arrow]T      Ala[right arrow]Val  0.41 (22)
NQO1 609C[right arrow]T       Pro[right arrow]Ser  0.20 (20)
SLC19A1 80A[right arrow]G     His[right arrow]Arg  0.45 (22)
SHMT1 1420C[right arrow]T     Leu[right arrow]Phe  0.36 (22)
TPMT 460G[right arrow]A       Ala[right arrow]Thr  0.00 (22)
TPMT 719A[right arrow]G       Tyr[right arrow]Cys  0.00 (22)
VDR start codon FokI                               0.40 (20)
TYMS 28-bp repeat                                  0.41 (22)

                              Minor allele
                              frequency (a)
Polymorphism                  Comparison group

GSTP1 313A[right arrow]G      0.36 (84)
MBL2 codon 54A[right arrow]G  0.21 (84)
ABCB1 3435C[right arrow]T     0.52 (84)
MTHFR 677C[right arrow]T      0.40 (84)
NQO1 609C[right arrow]T       0.25 (84)
SLC19A1 80A[right arrow]G     0.48 (84)
SHMT1 1420C[right arrow]T     0.21 (84)
TPMT 460G[right arrow]A       0.06 (84)
TPMT 719A[right arrow]G       0.06 (84)
VDR start codon FokI          0.42 (84)
TYMS 28-bp repeat             0.43 (84)

(a) The number of sequenced chromosomes from the 11 case children and
the 42 matched comparison children is in parentheses. Variations present
in NCBI dbSNP database: TPMT 460G[right arrow]A (rs1800460) and
719A[right arrow]G (rs28933403), SLC19A1 80A[right arrow]G (rs1051266),
SHMT1 1420C[right arrow]T (rs1979277), GSTP1 313A[right arrow]G
(rs1695), NQO1 609C[right arrow]T (rs1800566), MBL2 codon
54A[right arrow]G (rs1800450), ABCB1 3435C[right arrow]T (rs1045642),
MTHFR 677C[right arrow]T (rs1801133), and the VDR start site
polymorphism (rs2228570).

Table 4. Univariate matched conditional logistic regression analyses for
SNP loci in AOXI, SUOX, and XDH.

                                               95% CI (b)
Polymorphism                     Estimate (a)  Lower

AOX1 37630T [right arrow] A      [infinity]    0.05
AOX1 67888A [right arrow] G      [infinity]    0.05
AOX1 78499A [right arrow] G      0.43          0.01
AOX1 86558A [right arrow] G      [infinity]    0.23
AOX1 87950T [right arrow] G      1.0           0.02
AOX1 88099G [right arrow] A      1.14          0.02
AOX1 88196A [right arrow] delAT  1.79          0.38
AOX1 88248G [right arrow] T      1.14          0.02
SUOX -628G [right arrow] A       6.81          1.28
SUOX -619G [right arrow] A       [infinity]    0.05
SUOX -586T [right arrow] A       0.74          0.13
SUOX -429T [right arrow] C       0             0
SUOX -317G [right arrow] A       -- (d)        -- (d)
SUOX 1642G [right arrow] A       [infinity]    0.03
SUOX 1796C [right arrow] T       0             0
XDH 26391G [right arrow] A       0             0
XDH 42390T [right arrow] A       0             0
XDH 42404G [right arrow] A       0             0
XDH 44269A [right arrow] G       [infinity]    0.05
XDH 75118A [right arrow] T       0             0

                                 95% CI (b)
Polymorphism                     Upper       p-Value (c)

AOX1 37630T [right arrow] A      [infinity]  0.17
AOX1 67888A [right arrow] G      [infinity]  0.17
AOX1 78499A [right arrow] G        6.15      0.46
AOX1 86558A [right arrow] G      [infinity]  0.17
AOX1 87950T [right arrow] G       19.2       0.78
AOX1 88099G [right arrow] A       22.1       0.78
AOX1 88196A [right arrow] delAT   11.0       0.42
AOX1 88248G [right arrow] T       22.1       0.78
SUOX -628G [right arrow] A       257         0.007
SUOX -619G [right arrow] A       [infinity]  0.17
SUOX -586T [right arrow] A         2.99      0.66
SUOX -429T [right arrow] C        78.0       0.67
SUOX -317G [right arrow] A       -- (d)      -- (d)
SUOX 1642G [right arrow] A       [infinity]  0.75
SUOX 1796C [right arrow] T       117         0.63
XDH 26391G [right arrow] A        13.1       0.33
XDH 42390T [right arrow] A        78.0       0.67
XDH 42404G [right arrow] A        78.0       0.67
XDH 44269A [right arrow] G       [infinity]  0.17
XDH 75118A [right arrow] T       117         0.63

(a) Point estimate of odds ratio of each copy of the minor allele on the
odds of disease, obtained using matched conditional logistic regression.
Values of [infinity] (0) correspond to loci where the case (comparison)
children had at least as many copies of the minor allele as the
comparison (case) children in every informative stratum. (b) Exact 95%
CI values. (c) Mid-P corrected p-value for the score test. (d) For the
SUOX -317G[right arrow]A locus, there were no informative matched sets
(i.e., no instances in which a case and at least one matched control had
measured genotypes that were different).

Table 5. Univariate matched conditional logistic regression analyses for
loci for all genes except AOX1, SUOX and XDH.

                                            95% CI (b)
Polymorphism                  Estimate (a)  Lower  Upper  p-Value (c)

GSTP1 313A[right arrow]G      0.56          0.15   1.68   0.30
MBL2 codon 54A[right arrow]G  1.11          0.28   3.77   0.89
ABCB1 3435C[right arrow]T     0.43          0.11   1.40   0.16
MTHFR 677C[right arrow]T      1.05          0.35   3.31   0.90
NQO1 609C[right arrow]T       0.75          0.17   2.63   0.68
SLC19A1 80A[right arrow]G     0.91          0.30   2.71   0.90
SHMT1 1420C[right arrow]T     1.95          0.64   6.87   0.17
TPMT 460G[right arrow]A       0             0      4.36   0.43
TPMT 719A[right arrow]G       0             0      4.36   0.43
VDR start codon Fokl          0.93          0.26   2.97   0.90
TYMS 28-bp repeat             0.95          0.24   3.25   0.89

(a) Point estimate of odds ratio of each copy of the minor allele on the
odds of disease, obtained using matched conditional logistic regression.
Values of 0 correspond to loci where the comparison children had at
least as many copies of the minor allele as the case children in every
informative stratum. (b) Exact 95% CI values. (c) Mid-P corrected
p-value for the score test.

Table 6. Transmission disequilibrium analysis.

                                  p-Value
                              Standard             Intact trios
                              TDT (a)   1-TDT (b)  B (c)  C (d)

GSTP1 313A[right arrow]G      1.0       0.65       2      2
MBL2 codon 54A[right arrow]G  0.71      0.71       3      4
ABCB1 3435C[right arrow]T     0.26      0.26       2      5
MTHFR 677C[right arrow]T      0.32      0.21       6      3
NQO1 609C[right arrow]T       0.65      0.65       2      3
SLC19A1 80A[right arrow]G     0.26      0.74       5      2
SHMT1 1420C[right arrow]T     0.48      0.74       3      5
TPMT 460G[right arrow]A       0.32      0.32       0      1
TPMT 719A[right arrow]G       0.16      0.16       0      2
VDR start codon Fokl          0.26      0.48       5      2
TYMS 28-bp repeat             0.48      0.21       3      5

                              Children with only one
                              Available parent (dyads)
                              D (e)  E (f)

GSTP1 313A[right arrow]G      0      1
MBL2 codon 54A[right arrow]G  0      0
ABCB1 3435C[right arrow]T     0      0
MTHFR 677C[right arrow]T      1      0
NQO1 609C[right arrow]T       0      0
SLC19A1 80A[right arrow]G     0      2
SHMT1 1420C[right arrow]T     1      0
TPMT 460G[right arrow]A       0      0
TPMT 719A[right arrow]G       0      0
VDR start codon Fokl          0      1
TYMS 28-bp repeat             0      2

(a) Standard TDT is [(B - C).sup.2]/(B + C). (b) 1-TDT including data
from trios and dyads is [(B + D - C - E).sup.2]/ (B + D + C + E)*. (c)
Number of times a heterozygous parent transmitted the minor allele. (d)
Number of times a heterozygous parent transmitted the major allele. (e)
Number of times the case child had more minor alleles than the available
parent. (f) Number of times the case child had fewer minor alleles than
the available parent.

Table 7. Hapotype analysis for common SNP loci in AOX1 (a) and SUOX (b).

                                      [beta] (p-value) for model
Haplotpye                  Frequency  Co-dominant

AOX1 (a)
  000000 (A-A-T-G-A-G)     0.38       -0.59(0.25)
  000010 (A-A-T-G-delA-G)  0.46        0.64(0.20)
  011101 (A-G-G-A-A-T)     0.05        0.16(0.09)
  100000 (G-A-T-G-A-G)     0.09       -1.94(0.17)
  110000 (G-G-T-G-A-G)     0.02       -- (b)
SUOX
  00 (G-T) (c)             0.29       -1.42(0.05)
  01 (G-A)                 0.19       -1.56(0.07)
  10 (A-T)                 0.29        1.63(0.02)
  11 (A-A)                 0.23        0.80(0.23)

                           [beta] (p-value) for model
Haplotpye                  Dominant     Recessive

AOX1 (a)
  000000 (A-A-T-G-A-G)     -0.35(0.74)  -[infinity](0.02)
  000010 (A-A-T-G-delA-G)   1.50(0.09)   0.21(0.82)
  011101 (A-G-G-A-A-T)      0.20(0.88)  -[infinity](0.39)
  100000 (G-A-T-G-A-G)     -2.10(0.18)  -[infinity](0.19)
  110000 (G-G-T-G-A-G)     -- (b)       -- (b)
SUOX
  00 (G-T) (c)             -1.50(0.11)  -[infinity](0.05)
  01 (G-A)                 -1.67(0.10)  -[infinity](0.12)
  10 (A-T)                  2.61(0.01)   1.61(0.32)
  11 (A-A)                  1.24(0.18)  -0.93(0.86)

(a) AOX1 alleles with minor allele frequency of > 0.05 create a six
maker haplotype of 78499A[right arrow]G, 86558A[right arrow]G,
87950T[right arrow]G, 88099G[right arrow]A, 88169A[right arrow]delA and
88248G[right arrow]T. (b) Analysis not performed because the haplotype
was too infrequent. (c) SUOX alleles with minor allele frequency of
> 0.05 form a two marker haplotype of -628G[right arrow]A and
-586T[right arrow]A.
COPYRIGHT 2007 National Institute of Environmental Health Sciences
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2007, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Mini-Monogragp
Author:Satten, Glen A.
Publication:Environmental Health Perspectives
Date:Jan 1, 2007
Words:8742
Previous Article:Investigating childhood leukemia in Churchill County, Nevada.
Next Article:An update on cancer cluster activities at the Centers for Disease Control and Prevention.
Topics:



Related Articles
T cells cure leukemic mice.
New Drug Thwarts a Chronic Leukemia.
Increased prevalence of malignant diseases in the close neighborhood of children with cancer. (Features).
Overlooked in Fallon?
Mother's pre-pregnancy diet may influence child cancer risk.
Risk factors for acute leukemia in children: a review.
Infectious etiologies of childhood leukemia: plausibility and challenges to proof.
An update on cancer cluster activities at the Centers for Disease Control and Prevention.
Incidence of leukemia, lymphoma, and multiple myeloma in Czech uranium miners: a case-cohort study.

Terms of use | Copyright © 2012 Farlex, Inc. | Feedback | For webmasters | Submit articles