Printer Friendly
The Free Library
14,715,918 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Genetic divergence and dispersal of yellow fever virus, Brazil.


An analysis of 79 yellow fever virus yellow fever virus
n.
An arbovirus of the genus Flavivirus that causes yellow fever and is transmitted by mosquitoes.
 (YFV YFV Yellow Fever Virus ) isolates collected from 1935 to 2001 in Brazil showed a single genotype (South America I) circulating in the country, with the exception of a single strain from Rondonia, which represented South America genotype II. Brazilian YFV strains have diverged into two clades; an older clade clade Cladus, subtype Genetics A branch of biological taxa or species that share features inherited from a common ancestor; a single phylogenetic group or line. See Inheritance, Species.  appears to have become extinct and another has become the dominant lineage in recent years. Pairwise nucleotide diversity between strains ranged from 0% to 7.4%, while amino acid divergence ranged from 0% to 4.6%. Phylogenetic analysis indicated traffic of virus variants through large geographic areas and suggested that migration of infected people may be an important mechanism of virus dispersal. Isolation of vaccine virus from a patient with a fatal case suggests that vaccine-related illness may have been misdiagnosed in the past.

**********

Yellow fever virus (YFV) is transmitted by the bite of infected mosquitoes and produces a severe hemorrhagic fever in humans. Despite a safe and effective vaccine (17D), YFV continues to be a public health problem in tropical areas of Africa and South America (1-3). A recent upsurge in YFV activity in Brazil and the reinfestation of urban areas with the vector mosquito Aedes aegypti have stretched disease surveillance and control resources to their limits. During 2000, YFV occurred near Brasilia, the capital city (4); in 2001, YFV spread to new areas of Minas Gerais outside the currently recognized enzootic en·zo·ot·ic
adj.
Prevalent among or restricted to animals of a specific geographic area. Used of a disease.

n.
An enzootic disease.



enzootic

peculiar to or present constantly in a location. See also endemic.
 zone (5).

In South America, YFV is maintained in enzootic cycles involving monkeys and forest-canopy mosquitoes of the genera Haemagogus and Sabethes (6,7). In Brazil, three geographic zones have been defined where YFV circulates (7) (Figure 1): 1) the region of endemicity, in which the virus is maintained in mobile monkey populations and where human cases are sporadic and rare; 2) transitional zones of emergence, in which contact is frequent between monkey and human populations (and infected mosquito vectors); and 3) regions of epidemicity where the density of susceptible human populations and competent vector species are both high, and the potential for explosive urban outbreaks is great. Brazil currently has a population of about 176 million; approximately 30 million people live in the YFV-endemic zone, 18 million live in the zone of emergence, and 128 million reside along the Atlantic coast in the YFV-free zone (8,9).

[FIGURE 1 OMITTED]

Many aspects of the molecular epidemiology and transmission cycles of YFV in the forests of South America are poorly understood, and previous studies of YFV in South America were limited to a relatively small number of isolates. We examined the genetic diversity of 79 YFV strains isolated from Brazil over 67 years and mapped the distribution of variants to investigate patterns of virus divergence and dispersal.

Material and Methods

Study Area

Brazil is a country of enormous size and diversity, covering 8,512,000 [km.sup.2]. The country is divided into 26 states and the Federal District. These make up five major geographic regions, characterized by broadly different climate and vegetation zones and a highly variable distribution of the human population. The five regions (Figure 1) consist of the northern Amazon region, northeastern region (caatinga, very dry), central-western region (swamp and savannah Savannah, city, United States
Savannah, city (1990 pop. 137,560), seat of Chatham co., SE Ga., a port of entry on the Savannah River near its mouth; inc. 1789.
), southeastern region (most heavily populated with an extensive system of roads and railways), and the more temperate southern region bordering Argentina and Paraguay (10).

Virus Strains

Strain-specific data such as geographic locality, passage history, source of isolate, and clinical outcome (for selected human cases) for the 79 Brazilian YFV strains used in this study are provided in the online Appendix (http://www.cdc.gov/ncidod/eid/vo110no9/040197app.htm). All strains were originally isolated in suckling suckling

In mammals, the drawing of milk into the mouth from the nipple of a mammary gland. In human beings, it is referred to as nursing or breast-feeding. The word also denotes an animal that has not yet been weaned—that is, whose access to milk has not yet been
 mice and cultured once in C6/36 cells to produce seed stocks (online Appendix) at the Instituto Evandro Chagas (IEC (International Electrotechnical Commission, Geneva, Switzerland, www.iec.ch) An organization that sets international electrical and electronics standards founded in 1906. It is made up of national committees from over 60 countries.

IEC - International Electrotechnical Commission
), Belem, Brazil. Methods for cell culture and virus growth have been previously described (11-13), and standard laboratory precautions within biosafety level 3 facilities were undertaken to prevent cross-contamination of strains. Thirty-eight (48%) virus strains were from humans (24 from patients who died); 7 (9%) were from monkeys; and 34 (43%) were from mosquito pools, mainly Haemogogus janthinomys. Viruses represented a period of 67 years, but with unequal sample distribution: 15% of strains were obtained from 1935 to 1969, 43% were obtained from 1970 to 1989, and 42% were obtained from 1990 to 2001. The year of virus isolation is indicated in the sequence identification (e.g., Brazil35, isolated in 1935). Isolates were from 12 states: Amapa (n = 1), Bahia (n = 1), Federal District (n = 1), Goias (n = 10), Maranhao (n = 6), Minas Gerais (n = 7), Mato Grosso (n = 4), Mato Grosso do Sul Mato Grosso do Sul (pron. IPA: ['ma.tu 'gɾo.su du suw] [1]) is one of the states of Brazil. Neighbouring states are (from north clockwise) Mato Grosso, Goiás, Minas Gerais, São Paulo and Paraná.  (n = 5), Para (n = 39), Rondonia (n = 2), Roraima (n = 1), and Tocantins (n = 2).

Phylogenetic Analysis

Supernatants of YFV-infected Vero cells were obtained, and viral RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 was extracted by using a commercial kit (Qiagen, Valencia, CA) and processed according to the manufacturer's instructions. RNA obtained was stored at -70[degrees]C. The genomic-sense degenerate primer EMF emf: see electromotive force.


(1) (ElectroMagnetic Field) See electromagnetic radiation.

(2) (Enhanced MetaFile) See Windows metafile.
 (5' TGGATGACSACKGARGAYAT) and genomic-complementary primer VD8 (5' GGGTCTCCTCTAACCTCTAG) were used for reverse transcription-polymerase chain reaction amplification of a 595-bp fragment comprising 255 nucleotides of NS5 and 340 nucleotides of 3'NCR (14,15). PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 products were screened by agarose gel electrophoresis Agarose gel electrophoresis is a method used in biochemistry and molecular biology to separate DNA, RNA, or protein molecules by size. This is achieved by moving negatively charged nucleic acid molecules through an agarose matrix with an electric field (electrophoresis). . Bands were recovered with a gel extraction kit (Qiagen) and directly sequenced with an AB automatic sequencer See MIDI sequencer.

(music) sequencer - Any system for recording and/or playback of music via a programmable memory which stores music not as audio data, but as some representation of notes.
 at the University of Texas Medical Branch "UTMB" redirects here. For other system schools, see University of Texas System.
The University of Texas Medical Branch (UTMB) is a component of the University of Texas System located in Galveston, Texas, about 50 miles (80 km) southeast of downtown Houston.
 protein chemistry core facility.

Sequence editing and alignments were performed with Vector NTI NTI NewTech Infosystems (software company, Irvine, California)
NTI Nuclear Threat Initiative
NTI National Transit Institute (New Brunswick, New Jersey)
NTI Nunavut Tunngavik Incorporated
 (Informax, Frederick, MD), and additional manual editing of alignments was performed with the GCG GCG Genetics Computer Group
GCG Glucagon
GCG Good Corporate Governance
GCG Global Consumer Group
GCG Global Church of God
GCG Generalized Conjugate Gradient
GCG Global Change Game
GCG Geological Curators' Group
GCG Giant-Cell Granuloma
 Wisconsin Package Version 10.3 (Accelrys, San Diego, CA). The PAUP PAUP Phylogenetic Analysis Using Parsimony  * program (16) was used to infer phylogenetic trees by the neighbor-joining method with Kimura 2-parameter distance corrections. Support for individual clades was determined by nonparametric bootstrapping with 1,000 replicates. The tree was rooted with a sequence of the prototype West African YFV strain Asibi (17) and the 17DD substrain vaccine virus (18).

Results

Genetic Diversity of Brazilian YFV Strains

Sequence data were obtained for a genomic region spanning the terminal portion of NS5 and proximal region of the 3'NCR for 54 Brazilian YFV strains. In addition to the sequence data generated in this study, partial or complete 3'NCR sequences were available for an additional 25 Brazilian YFV isolates (13,14), which yielded the full dataset of 79 YFV strains from 12 states (alignment length, 576 nt). The NS5/3'NCR sequences contained 148 variable sites, of which 89 were informative. Thirty-two of the informative sites (36%) fell within the NS5 coding portion of the sequence, and 57 (64%) fell within the 3'NCR. Amino acid pairwise divergence among the partial NS5 sequences (85 amino acids in length) ranged from 0% to 4.7% (mean 2.2%).

A phylogenetic tree of the 79 Brazilian YFV sequences is shown in Figure 2. The tree is rooted with the homologous region of the Asibi prototype strain (parental virus to the 17D vaccine), isolated in Ghana in 1927 (17). Mosquito- and vertebrate-derived sequences were distributed randomly throughout the phylogenetic tree. With the exception of one 1983 isolate from Rondonia (BeH 413820) and one 1975 isolate from Aripuana in Mato Grosso (BeH 291597), all Brazilian YFV strains formed a single monophyletic monophyletic /mono·phy·let·ic/ (mon?o-fi-let´ik) descended from a common ancestor or stem cell.

mon·o·phy·let·ic
adj.
1. Descended or derived from one original stock or source.
 clade. Two major subclades were evident: a subclade comprising isolates from Para dating from 1954 to 1968 and a subclade containing all remaining isolates from 1969 to 2001.

[FIGURE 2 OMITTED]

Variation within the Dominant Subclade

Genetic variation within the dominant subclade of Brazilian YFV strains showed a complex pattern of relationships that demonstrated both geographic and temporal associations. Varying levels of bootstrap support were evident for four clusters (groups 1A-1D) (Figure 2): group 1A included isolates from the 1972-1973 outbreak in Goias and a 1984 isolate from Para, group 1B represented sporadic human cases and samples obtained during routine surveillance in western and central regions from 1984 to 1996, group 1C consisted of isolates from sporadic cases and surveillance in eastern central states from 1971 to 1998, and group 1D represented epizootic ep·i·zo·ot·ic
adj.
Affecting a large number of animals at the same time within a particular region or geographic area. Used of a disease.



ep
 activity from 1998 to 2001. The phylogenetic position of 12 additional isolates from Para (10), Amapa (1), and Mato Grosso (1) was not easily resolved (Figure 2), so relationships among these strains require further sequence analysis.

The four isolates from the 1972-1973 epidemic in Goias (group 1A, Brazil73a, 73b, 73c, and 73d) differed by 2-3 nt (0.34%-0.5%) over the length of the NS5/3'NCR fragment (595 nt). One isolate obtained 11 years later (Brazil84e) from a pool of Haemagogus janthinomys mosquitoes collected in far northern Para (Faro Faro, town, Portugal
Faro (fä`rō), town (1991 pop. 31,966), capital of Faro dist. and of Algarve, S Portugal. The southernmost town in Portugal, it is a seaport from which fish, fruit (especially dried figs), wine, and cork are
), was nearly identical to the 1973 Goias strains (2-3 nt difference).

Group 1B consisted of 11 isolates. These included two isolates from patients who died (Brazil84h and Brazil91 b), isolates from patients in Mato Grosso do Sul (Brazil92c) and Maranhao (Brazil93a), isolates from Haemagogus mosquitoes in western Para (Brazil84d) and Rondonia (Brazil96a), and four isolates obtained in 1992 from mosquito pools (Brazil92a, 92b, 92d, and 92e). Although most strains in group 1B were identified in western and central regions (over a distance as large as 3,500 [km.sup.2]), one isolate identified in this cluster was from the northeast region in Barra do Corda, Maranhao (Brazil93a). Isolates collected from contemporaneous Haemagogus and Sabethes mosquito pools (Brazil92a, 92b, 92d, and 92e) were 100% identical.

Group 1C formed the largest cluster, with 22 strains diverging by 0% to 3.8% (0-27 nt, bootstrap 80%). These variants were distributed during an extended period from 1971 to 1994 throughout the northern Amazon region (Para: Brazil87, 91a, 84c, 84g, 71, 78a, 84b, 94e, and 98a; Maranhao: Brazil80c, 82a, 93b, 94f, and 95), in central Goias (Brazil88a, 80a, and 91c), and near the edge of the enzootic zone in Minas Gerais (Brazil89, 88b, 94d, 94b, and 94a). A pair of Minas Gerais isolates (Brazil94b and 94a) obtained from Haemagogus and Sabethes mosquito pools showed a 100% match across the length of the sequence fragment.

With one exception (Brazil98a), all isolates collected during 1998 to 2001 fell within a single cluster (group 1D) that had 0%-2.7% (0-16 nt) divergence. Although group 1D consistently clustered on neighbor-joining mad parsimony par·si·mo·ny  
n.
1. Unusual or excessive frugality; extreme economy or stinginess.

2. Adoption of the simplest assumption in the formulation of a theory or in the interpretation of data, especially in accordance with the rule of
 trees, bootstrap support was low (53%). The distribution of samples collected during this period closely reflected the southward dispersal of epizootic activity. In 1998, a large number of YF cases occurred in northern Brazil, especially in Para. In 1999 through 2000, a few cases were reported in Bahia and Tocantins, but the largest number were in central Goias (19). In 2001, YF cases were detected in the transitional zone of Minas Gerais and further east. The isolate from Tocantins collected in 2000 (Brazil2000a) was characterized by an exceptionally large number of substitutions in the 3'NCR region. A single isolate (Brazil98a) collected from a howler monkey howler monkey

Any of several species of slow-moving tropical American monkeys (genus Alouatta) noted for their roaring cries, which carry over a distance of 2–3 mi (3–5 km).
 in Afua, Para, during the early period of the epizootic did not cluster with the other group 1D strains.

Subclade of Older Para Strains

A group of ten isolates from Para dating from 1954 through 1968 differed from all other Brazilian strains by 5.7% [- or +] 1.6%. These results confirmed previous observations based on analysis of prM/E gene sequences (14), indicating 7.8% [+ or -] 2.0% divergence for this group of older Patti isolates. To date, 29 YFV strains from Para dating from 1969 through 1999 have been examined; none of these more recent strains cluster with the earlier clade. Sequence divergence of the older Para strains approached the threshold level used to define separate YFV genotypes (8% 9%) (20). Alignment of previously published sequences for the structural gene region (223 codons of prM/E) (14) showed that 8 of the 10 older Para strains had one or more mutations within the fusion peptide of the E protein (Figure 3) that is highly conserved among all flaviviruses; it is located in domain II (E98-E110) and plays a role in mediating the acid-catalyzed fusion of virions with target cell membranes (22). Three strains from 1968 (Brazil68a, 68c, and 68d) showed a C [right arrow] F substitution at E105, eliminating one of the disulfide bonds that forms the structural architecture of domain 11 (22). Brazil68b had a D [right arrow] G mutation at E98, and Brazil54 and Brazil68a shared an R [right arrow] K mutation at E99. Three of the strains (Brazil55c, Brazil60, Brazil62b) had a G [right arrow] S substitution at E100. The functional importance of these mutations is unknown. Of the older Patti strains, only Brazil55b and Brazil62a had the consensus sequence for the fusion peptide (Figure 3). In addition, 12 non-Para subclade strains exhibited substitutions in the fusion peptide sequence.

[FIGURE 3 OMITTED]

Preliminary phenotypic differences among three of the older Para strains (Brazil55b, Brazil60, and Brazil68c) in the standard mouse neuroinvasiveness model (i.e., intraperitoneal injection of 8-day-old suckling mice) (23) indicated that the strains with substitutions in the fusion peptide were less lethal (average lethal dose-50 [L[D.sub.50]] for Brazil60 and Brazil68c = 5.5 logt0 tissue culture infective dose-50 [TCI (Trustworthy Computing Initiative) An umbrella term from Microsoft for its efforts to improve security in Windows. TCI was announced in 2002 after viruses such as Code Red and Nimda had succeeded in attacking numerous Windows computers. [D.sub.50]]) than the strain with the consensus sequence (Brazil55b) (L[D.sub.50] = 0.1 [log.sub.10] TCI[D.sub.50]). Average survival times of the infected mice were 9.2, 11, and 8.8 days, respectively, for the three strains. All three strains achieved titers 6-7 [log.sub.10] TCI[D.sub.50]/mL when grown in Vero cell culture. Brazil55b had a longer passage history than other YFV strains (4 passages in suckling mouse brain) (online Appendix); thus the altered phenotype may be partly attributed to selection during repeated mouse passage.

Additional Brazilian Isolates

Two Brazilian strains (Brazil83 from Rondonia and Brazil75 from Mato Grosso) failed to group within either of the two major subclades. Brazil83 appears to represent South American genotype 11, as it matched 97.2% to the homologous NS5/3'NCR region of Peruvian YFV strains (14) and diverged from other Brazilian strains by 6.2% to 13.8% (mean 10.2%). Brazil75 was a vaccine virus, as it matched the 17DD vaccine virus by 99.8%. Sequence comparison of 17DD with Brazil75 revealed a single mutation (C [right arrow] T) at position 16 of the 3'NCR (13).

Discussion

Brazil accounts for approximately 25% of all YF cases reported from South America (4). YFV activity has been reported from each of the five regions in the country (2,24). From 1950 to 2003, no single region consistently produced the highest number of YF cases; however, YFV activity in the dry northeast was rare (Figure 4). Overall, the largest number of cases was reported from Goiais (central-western) and Para (northern) regions.

[FIGURE 4 OMITTED]

Previous studies of the genetic relationships among global variants of YFV have indicated that divergence across the length of the [approximately equal to] 11-kb genome is relatively uniform, and the 3'NCR contains useful markers for subtype-specific distinctions (13,25). Our data showed a single genotype of YFV circulating in Brazil (South American genotype I), with the exception of a single strain from Rondonia (South America genotype II). The Brazilian strains made up two subclades: a group of older strains from Para from 1954 to 1968 and a larger group dating from 1969 to the present. The clear genetic distinction between strains isolated before 1968 (10 in total) and all subsequent strains suggests that the older Para strains have been replaced by a dominant new lineage. Several members of the older Para subclade had one or more mutations within the fusion peptide region of the E protein, including substitutions that disrupted conserved disulfide bridges (Figure 3). Although the functional importance of these substitutions is unknown, changes in the fusion peptide would affect protein folding and conformation and binding interactions with target membranes (22). Continued sampling and surveillance of YFV strains from Para are necessary to confirm whether the variants represented in this subclade have truly become extinct or whether they are being maintained in cycles that have yet to be identified.

At least three articles in the past 50 years have reported YFV epizootics that began in northern and western Amazonian regions and then spread south into Parana, Santa Catarina, and Rio Grande do Sul Rio Grande do Sul (rē` grän`dĭ th s . The first was a large epidemic that swept south from Goias in the 1930s and 1940s (26). The second was in 1963, when an epizootic started in Mato Grosso and extended eventually as far south as Missiones and Corrientes Provinces in northern Argentina by 1966 (27). In 1972 to 1973, an outbreak occurred in Goias, and although investigations at the time suggested the epizootic was highly localized (28), cases reported from Paraguay in the following years were attributed to spread of viruses from Goias. Virus maintenance and dispersal have presumably pre·sum·a·ble  
adj.
That can be presumed or taken for granted; reasonable as a supposition: presumable causes of the disaster.
 involved sequential infections of migrating groups of monkeys (29-32). Four isolates collected during the 1972-1973 Goias outbreak were included in this study; these isolates (group 1A, Brazil73a-d) had nearly identical (99.6%) NS5/3'NCR sequences, and a filth isolate with a highly similar sequence was obtained 10 years later from Faro, in northern Para. Other than the single Faro isolate (Brazil84e), no additional descendents have been identified of those outbreak strains.

YFV transmission was particularly active during the rainy season in Maranhao in 1993 to 1994 (33). Serologic se·rol·o·gy  
n. pl. se·rol·o·gies
1. The science that deals with the properties and reactions of serums, especially blood serum.

2.
 studies of rural and urban populations at the time indicated an overall attack rate of 75 per 1,000; incidence of clinical disease was 3.5 per 1,000 persons in urban areas and 4.2 per 1,000 in rural areas. Five of the six Maranhao isolates from this time were in group 1C (Figure 2), whereas one isolate from a patient with a fatal case (Brazil93a) appeared to be related to group 1B (Figure 2). In addition to the 1993 1994 outbreak in Maranhao, the subclade of group 1C strains was also associated with sporadic cases throughout 1971 to 1998 in Para, Minas Gerais, and Goias.

The most recent increase in epizootic YFV activity in Brazil occurred from 1998 to 2001, with cases distributed over a large region covering eight states (4). Several human cases were reported to have originated from the Chapada dos Veadeiros National Park Brazil's Chapada dos Veadeiros National Park is located in the Chapada dos Veadeiros, an ancient plateau with an estimated age of 1.8 billion years[1]. The Park was created in 1961 by President Juscelino Kubitscheck, and listed as a World Heritage Site by Unesco , a tourist canyon located near Brasilia, Goias. The proximity to major cities raised alarm, and reports at the time designated Goias as the epicenter of the outbreak (4). The phylogenetic evidence presented here indicates that YFV activity in 1998 in Para, in 2000 in Goias, and in 2001 in Minas Gerais was all part of one continuous epizootic, which dispersed genetic variants from the 1D group of viruses (Figure 2).

Investigations in 2000 and 2001 indicated that YFV activity had expanded beyond the typical borders of the enzootic zone, into areas where the virus had not been reported for >100 years. The appearance of nearly identical variants across very large distances over short periods (e.g., group 1D spanning >3,000 km within 1 month, group 1B strains with isolates >2,000 km apart within 1 year) suggests that humans, rather than other primates or mosquitoes, may be partly responsible for the spread of YFV variants. Because Haemagogus mosquitoes are forest species and are relatively fragile, patterns of traffic and commerce would not likely lead to translocation translocation /trans·lo·ca·tion/ (trans?lo-ka´shun) the attachment of a fragment of one chromosome to a nonhomologous chromosome. Abbreviated t.  of infected mosquitoes. From 1998 to 2001, the virus may have been transported from Para (34) to Goias (4) and then to Minas Gerais by asymptomatic carriers or viremic persons in the prodromal prodromal

the stage of premonitory signs presaging the onset of disease or of specific clinical signs such as seizures.
 phase. The general trend in the southward movement of the virus (group 1D, Figure 2) could be interpreted to reflect the pattern of labor migration from less populated areas of the northern Amazon to cities of the southeast. However, humans are not believed to play a major role in either virus maintenance or dispersal within South America, because human contact with the forest species Haemagogus janthinomys is infrequent, and the length of the viremic period in infected humans is brief (34 days).

The identification of one strain from western Rondonia (Brazil83) with high identity to South American genotype II strains (from Peru and Bolivia) suggests that the two South American YFV genotypes cocirculate in regions of western Brazil. The genetic divergence and distribution of YFV are similar that of Oropouche virus (an Orthobunyavirus transmitted by midges midges

see ceratopogonidae and culicoides.
). Like YFV, Oropouche virus has split into two distinct genotypes in South America with separate eastern and western regions of circulation, and the only region where the two genotypes have been found to cocirculate is in western Brazil, in Rondonia (35). The ecologic correlates for these patterns remain uncertain; however, they suggest that surveys of the border regions between Brazil, Peru, and Bolivia may identify additional YFV genotypes.

One unanticipated result of this study was identifying a vaccine virus (Brazil75) from what had been presumed to be a case of natural exposure to wild-type YFV. This isolate was obtained from the blood of a patient who died in Aripuana, Mato Grosso; this patient had been vaccinated 5 days before becoming ill and died 9 days postvaccination. Serious adverse effects resembling wild-type YF (viscerotropic viscerotropic /vis·cer·o·tro·pic/ (-tro´pik) primarily acting on the viscera; having a predilection for the abdominal or thoracic viscera.

vis·cer·o·trop·ic
adj.
 disease) have only recently been reported (19,36,37). The complete genomic sequence of Brazil75 is currently being sought to address the question of vaccine reversion. Although no controlled studies have examined the safety or efficacy of YF vaccination in immunosuppressed Immunosuppressed
A state in which the immune system is suppressed by medications during the treatment of other disorders, like cancer, or following an organ transplantation.

Mentioned in: Fifth Disease
 patients, these findings underscore the importance of evaluating patient history before delivering vaccine and also suggest that other cases of vaccine-related illness may have been misdiagnosed in the past.

In summary, we describe considerable genetic variability among YFV variants circulating in Brazil and identify clusters of strains associated with epizootics in different geographic regions. Brazilian YFV strains have diverged into two subclades, one of which has become the dominant lineage in recent years. We suggest a potential role for human migration in mediating virus dispersal. Expansion of YFV outside the enzootic zone presents an ongoing risk for reintroduction of the virus to urban areas and highlights the need for continued surveillance and control.

Acknowledgments

We thank Zouraide Guerra Costa for sharing important unpublished data.

This study was financially supported by CNPq (Brazilian Agency for Scientific and Technologic Development, process 302770/02-0) and the National Institutes of Health (grant AI 50175). P.F.C. Vasconcelos was supported by The Lancet Publishing Group through the 2002 Lancet International Fellowship Award at Galveston. The contributions of J.E. Bryant were supported by the Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center.  Fellowship Training Program in Vector-Borne Infectious Diseases, grant no. T01/CCT622892.

References

(1.) Monath TP. Epidemiology of yellow fever: current status and speculations on future trends. In: Saluzzo JF, Dodet B, editors, Amsterdam: Elsevier; 1997. p. 143-65.

(2.) Robertson SE, Hull BP, Tomori O, Bele O, LeDuc JW, Esteves K. Yellow lever: a decade of reemergence. JAMA JAMA
abbr.
Journal of the American Medical Association
. 1996;276: 1157-62.

(3.) Vainio J, Cutts F. Yellow fever. Global programme for vaccines and immunization immunization: see immunity; vaccination. . WHO/EPI/GEN/98.11. Geneva Geneva, canton and city, Switzerland
Geneva (jənē`və), Fr. Genève, canton (1990 pop. 373,019), 109 sq mi (282 sq km), SW Switzerland, surrounding the southwest tip of the Lake of Geneva.
: World Health Organization; 1998.

(4.) Vasconcelos PFC PFC
abbr.
private first class

Noun 1. PFC - a powerful greenhouse gas emitted during the production of aluminum
perfluorocarbon
, Costa ZG, Travassos da Rosa ES, Luna E, Rodrigues SG, Barros VLRS VLRS Variable-Length Re-Writing System , et al. Epidemic of jungle yellow lever in Brazil, 2000: implications of climatic alterations in disease spread. J Med Virol. 2001;65:598-604.

(5.) Filippis AM, Schatzmayr HG, Nicolai C, Baran M, Miagvstovich MP, Sequeira PC, et al. Jungle yellow fever, Rio de Janeiro Rio de Janeiro, city, Brazil
Rio de Janeiro (rē`ō də zhänā`rō, Port. rē` thĭ zhənĕē`r
. Emerg Infect Dis. 2001;7:484-5,

(6.) Degallier N, Travassos da Rosa AP, Herve JP, Travassos da Rosa JFS See journaled file system and Joliet file system. , Vasconcelos PFC, Silva CJM CJM Canadian Journal of Mathematics
CJM Corporate Jet Management
CJM Congregation of Jesus and Mary (religious order)
CJM Contemporary Jewish Museum of San Francisco
CJM Chantiers Jeunes Maroc
, et al. A comparative study of yellow fever in Africa and Sooth sooth   Archaic
adj.
1. Real; true.

2. Soft; smooth.

n.
Truth; reality.



[Middle English, from Old English s
 America. J Braz Assoc Advanc Sci. 1992;44:143-51.

(7.) Mondet B, Travassos da Rosa APA (All Points Addressable) Refers to an array (bitmapped screen, matrix, etc.) in which all bits or cells can be individually manipulated.

APA - Application Portability Architecture
, Vasconcelos PFC. The risk of urban yellow fever outbreaks in Brazil by dengue dengue
 or breakbone fever or dandy fever

Infectious, disabling mosquito-borne fever. Other symptoms include extreme joint pain and stiffness, intense pain behind the eyes, a return of fever after brief pause, and a characteristic rash.
 vectors Aedes aegypti and Aedes albopictus. Bull Soc Pathol Exot. 1996;89:107-13.

(8.) Fundacao National de Saude (FUNASA). Distribuicao de casos confirmados de febre amarela notificados por unidade federativa no Brasil, 1981-2002, Brasilia: Ministerio da Saude; 2003.

(9.) Massad E, Burattini MN, Coutinho FA, Lopez LF, Dengue and the risk of urban yellow fever reintroduction in San Paulo State, Brazil. Rev Saude Publica. 2003;37:477-84.

(10.) Figueiredo LT. The Brazilian flaviviruses. Microbes Infect. 2000;2:1643-9.

(11.) Beaty BJ, Calisher CH, Shope RE. Arboviruses arboviruses (ar´bōvī´rsz),
n.
. In: Lennette EH, Schmidt NJ, editors. Diagnostic procedures for viral, rickettsial rickettsial /rick·ett·si·al/ (ri-ket´se-al) pertaining to or caused by rickettsiae.

rick·ett·si·al
adj.
Relating to, or caused by a member of the genus Rickettsia.
, and chlamydial infections. 6th ed. Washington: American Public Health Association The American Public Health Association (APHA) is Washington, D.C.-based professional organization for public health professionals in the United States. Founded in 1872 by Dr. Stephen Smith, APHA has more than 30,000 members worldwide. ; 1989. p. 797-855.

(12.) Kuno G, Chang G.I, Tsuchiya KR. Karabatsos N, Cropp CB. Phylogeny of the genus Flavivirus. J Virol. 1998;72:73-83.

(13.) Wang E, Weaver SC, Shope RE, Tesh RB, Watts DM, Barrett AD. Genetic variation in yellow fever virus: duplication in the 3' noncoding region of strains from Africa. Virology virology, study of viruses and their role in disease. Many viruses, such as animal RNA viruses and viruses that infect bacteria, or bacteriophages, have become useful laboratory tools in genetic studies and in work on the cellular metabolic control of gene expression . 1996;225:274-81.

(14.) Bryant JE, Barrett ADT (Asynchronous Data Transfer) A transmission technique used in ISDN PBXs that dynamically allocates bandwidth. See also abstract data type.

ADT - abstract data type
. Comparative phylogenies of yellow fever isolates from Peru and Brazil. FEMS Immunol Med Microbiol. 2003;39:103-18.

(15.) Deubel V, Digoutte JP, Monath TP, Girard M. Genetic heterogeneity of yellow fever virus strains from Africa and the Americas. J Gen Virol. 1986;67:209-13.

(16.) Swofford DL. PAU[P.sup.*]. Phylogenetic analysis using parsimony (* and other methods). Sunderland (MA): Sinauer Associates; 1998.

(17.) Hahn CS, Dalrymple JM, Strauss JH, Rice CM. Comparison of the virulent Asibi strain of yellow fever virus with the 17D vaccine strain derived from it. Proc Natl Acad Sci U S A. 1987;84:2019-23.

(18.) Duarte dos Santos CN, Post PR, Carvalho R, Ferreira II, Rice CM, Galler R. Complete nucleotide sequence of yellow fever virus vaccine strains 17DD and 17D-213. Virus Res. 1995;35:35-41.

(19.) Vasconcelos PFC, Luna EJ, Galler R, Silva LJ, Coimbra TL, Barros VLRS, et al. Serious adverse events associated with yellow fever 17DD vaccine in Brazil: a report of two cases [errata er·ra·ta  
n.
Plural of erratum.
 in Lancet. 2001;358:336; Lancet. 2001;358:1018]. Lancet. 2001;358:91-7.

(20.) Mutebi JP, Wang H, Li L, Bryant JE, Barrett AD, Phylogenetic and evolutionary relationships among yellow fever virus isolates in Africa. J Viral. 2001;75:6999-7008.

(21.) Roy FA, Heinz FX, Mandl C, Kunz C, Harrison SC. The envelope glycoprotein from tick-borne encephalitis virus tick-borne encephalitis virus
n.
An arbovirus of the genus Flavivirus that occurs in two subtypes, Central European and Eastern, causing two forms of encephalitis; it is transmitted by ticks.
 at 2 angstrom angstrom (ăng`strəm), abbr. Å, unit of length equal to 10−10 meter (0.0000000001 meter); it is used to measure the wavelengths of visible light and of other forms of electromagnetic radiation, such as ultraviolet  resolution. Nature. 1995;375:291-8.

(22.) Allison SL, Schalich J, Stiasny K, Mahdi CW, Heinz FX. Mutational evidence for an internal fusion peptide in flavivirus envelope protein E. J Virol. 2001;75:4268-75.

(23.) Fitzgeorge R, Bradish CJ. The in vitro differentiation of strains of yellow fever virus in mice. J Gun Virol. 1980;46:1-13.

(24.) Monath TP. Milestones in the conquest of yellow fever. In: Koprowski H, Oldstone MBA MBA
abbr.
Master of Business Administration

Noun 1. MBA - a master's degree in business
Master in Business, Master in Business Administration
, editors. Microbes and man--then and now. Bloomington (IN): Medi-Ed Press; 1996. p. 95-111.

(25.) Heraud JM, Hummel hummel

entire, naturally polled deer.
 D, Hulin A, Deubel V, Poveda JD, Sarthon JL, et al. First case of yellow lever in French Guiana since 1902. Emerg Infect Dis. 1999;5:429-32.

(26.) Super FL. Ventures in world health. Scientific publication no. 355. Washington: Pan American Health Organization The Pan American Health Organization (PAHO) is an international public health agency with 100 years of experience in working to improve health and living standards of the countries of the Americas. It serves as the specialized organization for health of the Inter-American System. ; 1977.

(27.) Monath TR Yellow fever: Victor, Victoria? Conqueror, conquest'? Epidemics and research in the last 40 years and prospects for the future. Am J Trap Med Hyg. 1991;45:1-43.

(28.) Pinheiro FP, Travassas da Rosa APA, Moraes MAP, Almeida Neto JC, Camargo S, Filgueiras JP. An epidemic of yellow fever in central Brazil, 1972-1973.I. Epidemiological studies. Am J Trap Med Hyg. 1978;27:125-32.

(29.) Chippaux A. Deubel V, Moreau JP, Reynes JM. Current situation of yellow fever in Latin America. Bull Sac Pathol Exot. 1993;86:460-4.

(30.) Kiple KF, Cooper DB. Yellow fever. In: Kiple KF, Graham RR, editors. Cambridge: Cambridge University Press Cambridge University Press (known colloquially as CUP) is a publisher given a Royal Charter by Henry VIII in 1534, and one of the two privileged presses (the other being Oxford University Press). ; 1993. p. 1101-7.

(31.) Monath TP. Yellow fever. In: Monath TR editor. The arboviruses--epidemiology and ecology. Vol. 5. Boca Raton (FL): CRC (Cyclical Redundancy Checking) An error checking technique used to ensure the accuracy of transmitting digital data. The transmitted messages are divided into predetermined lengths which, used as dividends, are divided by a fixed divisor.  Press; 1989. p. 139-231.

(32.) Vasconcelos PFC, Travassos da Rosa APA, Pinheiro FP, Rodrigues SG, Travassos da Rosa ES, Cruz ACR See riser card. , et al. Aedes aegypti, dengue, and re-urbanization of yellow fever in Brazil and other South American countries: past and present situation and future perspectives. Dengue Bull. 1999;23:55-66.

(33.) Vasconcelos PFC, Rodrigues SG, Degallier N, Moraes MAP, Travassos da Rosa JFS, Travassos da Rosa ES, et al. Epidemic of sylvatic sylvatic /syl·vat·ic/ (sil-vat´ik) sylvan; pertaining to, located in, or living in the woods.

sylvatic

found in the woods; occurring in animals of the forest.
 yellow fever in southeast region of Maranhao State, Brazil, 1993-1994. Epidemiological and entomological en·to·mol·o·gy  
n.
The scientific study of insects.



ento·mo·log
 findings. Am J Trop Med Hyg. 1997:57:132-7.

(34.) Vasconcelos PFC, Travassos da Rosa APA, Rodrigues SG, Travassos da Rosa ES, Montiero HAO, Cruz ACR, et al. Yellow lever in Para State, Amazon region of Brazil, 1998-1999. Entomological and epidemiological findings. Emerg Infect Dis. 2001;7:565-9.

(35.) Saeed MF, Wang H, Nunes M, Vasconcelos PFC, Weaver SC, Shope RE, et al. Nucleotide sequences and phylogeny of the nucleocapsid nucleocapsid /nu·cleo·cap·sid/ (noo?kle-o-kap´sid) a unit of viral structure, consisting of a capsid with the enclosed nucleic acid.

nu·cle·o·cap·sid
n.
 gene of Oropouche virus. J Gen Virol. 2000;81:743-8.

(36.) Chan RC, Penney DJ, Little D, Carter IW, Roberts JA, Rawlinson WD. Hepatitis and death following vaccination with 17D-204 yellow fever vaccine yellow fever vaccine
n.
A vaccine containing a live attenuated strain of yellow fever virus that has been grown in embryonate fowl eggs, used to immunize against yellow fever.
. Lancet. 2001;358:121-2.

(37.) Martin M, Tsai TF, Cropp B, Chang GJJ GJJ Gracie Jiu-Jitsu , Holmes DA, Tseng J, et al. Fever and multisystem organ failure multisystem organ failure Multiorgan failure, multiple organ dysfunction syndrome Critical care A 'physiologic' shut-down of multiple body systems in the face of critical injury or uncontrolled sepsis  associated with 17D-204 yellow fever vaccination yellow fever vaccination A live attenuated–weakened viral vaccine recommended for people traveling to or living in tropical areas in the Americas and Africa where yellow fever occurs : a report of four eases. Lancet. 2001;358:98-104.

Dr. Vasconcelos is a physician and chief of the Arbovirus arbovirus

Any of a large group of viruses that develop in arthropods (chiefly mosquitoes and ticks). The name derives from “arthropod-borne virus.” The spheroidal virus particle is encased in a fatty membrane and contains RNA; it causes no apparent harm to the
 Department at Evandro Chagas Institute, National Reference Center for Arbovirus, Ministry of Health, Belem, Brazil. His research interests focus on arthropodborne and rodentborne viruses, especially epidemiology, molecular biology, and diagnosis.

Address for correspondence: Pedro F.C. Vasconcelos, Arbovirus Department, Instituto Evandro Chagas, Av. Almirante Barroso, 492, 66090-000, Bolero, Brazil; fax: +55-91-226-1284; email: pedrovasconcelos @iec.pa.gov.br

All material published in Emerging Infectious Diseases is in the public domain and may he used and reprinted without special permission; proper citation, however, is appreciated.
COPYRIGHT 2004 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2004, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research
Author:Barrett, Alan D.T.
Publication:Emerging Infectious Diseases
Geographic Code:1USA
Date:Sep 1, 2004
Words:4890
Previous Article:Silent nucleotide polymorphisms and a phylogeny for mMycobacterium tuberculosis.(Research)
Next Article:Genotyping, orientalis-like Yersinia pestis, and plague pandemics.(Research)
Topics:



Related Articles
First Case of Yellow Fever in French Guiana since 1902.
Yellow Fever Vaccine.
Jungle Yellow Fever, Rio de Janeiro.(Brazil)(Statistical Data Included)(Brief Article)
YELLOW FEVER IMMUNITIES IN WEST AFRICA AND THE AMERICAS IN THE AGE OF SLAVERY AND BEYOND: A REAPPRAISAL.
RESPONSE TO SHELDON WATTS, "YELLOW FEVER IMMUNITIES IN WEST AFRICA AND THE AMERICAS IN THE AGE OF SLAVERY AND BEYOND: A REAPPRAISAL".(in this journal...
RESPONSE TO KENNETH KIPLE.(response to article by Kenneth Kiple in this issue, p. 969)(Brief Article)
Enzootic transmission of yellow fever virus in Peru. (Research).
Yellow fever outbreak, Imatong, Southern Sudan.(Research)
Yellow fever virus infectivity for Bolivian Aedes aegypti mosquitoes.(Dispatches)
Rare case of fatal yellow fever vaccine-associated viscerotropic disease.(Case Report)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles