Genetic characterization of hantaviruses transmitted by the Korean field mouse (Apodemus peninsulae), Far East Russia. (Research).

In an epizootiologic survey of 122 rodents captured in Vladivostok, Russia, antibodies positive for hantavirus were found in Apodemus peninsulae (4/70), A. agrarius (1/39), and Clethrionomys rufocanus (1/8). The hantavirus sequences identified in two seropositive A. peninsulae and two patients with hemorrhagic fever with renal syndrome (HFRS) from the Primorye region of Far East Russia were designated as Solovey and Primorye, respectively. The nucleotide sequences of the Solovey, Primorye, and Amur (obtained through GenBank) sequences were closely related (>92% identity). Solovey and Primorye sequences shared 84% nucleotide identity with the prototype Hantaan 76-118. Phylogenetic analysis also indicated a close relationship between Solovey, Primorye, Amur, and other viruses identified in Russia, China, and Korea. Our findings suggest that the Korean field mouse (A. peninsulae) is the reservoir for a hantavirus that causes HFRS over a vast area of east Asia, including Far East Russia.

**********

Currently, at least 20 serotypes and genotypes of the Hantavirus genus (family: Bunyaviridae) have been identified worldwide. Rodents are the natural reservoir for hantaviruses, although one virus strain has been isolated from the house shrew (Suncus murinus), an insectivore (1). A unique characteristic of hantaviruses is the close association between the virus type and its natural reservoir (2).

Hantaviruses cause two forms of human disease, hemorrhagic fever with renal syndrome (HFRS), and hantavirus pulmonary syndrome (HPS); human infection occurs after the inhalation of aerosolized rodent excreta. HFRS is manifested as high fever, renal dysfunction, and hemorrhage; HPS is characterized by an acute progressive pulmonary edema and a fatality rate of about 40%. Among the hantaviruses that cause HFRS in Eurasia are Hantaan virus (HTNV), Seoul virus (SEOV), Puumala virus (PUUV), and Dobrava-Belgrade virus (DOBV) (3), which are carried by the striped field mouse (Apodemus agrarius), Norway rat (Rattus norvegicus) and black rat (R. rattus), bank vole (Clethrionomys glareolus), and yellow-necked field mouse (A. flavicollis), respectively. DOBV was also found in A. agrarius in Europe (4,5). Sin Nombre virus (SNV), New York virus (NYV), Black Creek Canal virus (BCCV), Bayou virus (BAYV), Andes virus (ANDV), and other related viruses cause HPS in the New World and are carried by the deer mouse (Peromyscus maniculatus), white-footed mouse (P. leucopus), cotton rat (Sigmodon hispidus), marsh rice rat (Oryzomys palustris), and Oligoryzomys longicaudatus, respectively (2,6). Although the known genotypes and serotypes have increased in number with advances in the knowledge of epidemiology and epizootiology of hantavirus infection (2), some still-unidentified hantaviruses carried by specific rodent hosts may exist. HFRS is generally known to be endemic to Far East Russia. However, the genetics of hantaviruses that are pathogenic for humans are not well defined. Reed voles (Microtus fortis) in Far East Russia were found to harbor two novel hantaviruses, Khabarovsk virus (KHAB) and Vladivostok virus (7,8). Another hantavirus, Topografov virus (TOPV), was isolated from brown lemmings (Lemmus sibiricus). The correlation between these three viruses and their pathogenicity for humans are not yet known (9).

A recent study reported two novel hantaviruses, designated as Amur (AMR) and Far East (FE), that were identified from HFRS patients in Far East Russia (10). The natural reservoir of AMR genotype seems to be A. peninsulae, according to a recent study on nucleotide sequence comparisons by Yashina et al. (11).

In 1999, we carried out an epizootiologic survey in a suburb of Vladivostok, Russia, to determine the characteristics of hantaviruses circulating in Far East Russia and to examine the possibility that A. peninsulae is a carrier of pathogenic hantaviruses. We detected antibodies to hantaviruses in A. peninsulae, and the viral genome characteristics were extremely similar to the newly identified genotype, AMR (10). Using phylogenetic analysis to characterize the sequences of viruses identified from HFRS patients and A. peninsulae, we were able to corroborate the assumption of Yashina et al. (11). We also found that A. peninsulae-related viruses are pathogenic for humans and are distributed over a large area of east Asia that includes Far East Russia.

Materials and Methods

We collected sera and organs from wild rodents captured during 1999. We also collected sera and autopsy materials from HFRS patients in two rural villages in the Primorye region of Russia, located 400 km and 600 km from Vladivostok.

Rodent sera were screened for antibodies to HTNV and PUUV or both by indirect immunofluorescent antibody assay (IFA). Vero E6 cells infected with the Hantaan 76-118 strain of HTNV or the Sotkamo strain of PUUV were used as antigen slides. Diluted sera (1:16 and 1:64) were spotted onto the antigen slides and incubated at 37[degrees]C for 1 h. After three washes with phosphate-buffered saline (PBS), protein G-conjugated fluorescein isothiocyanate (FITC) (Zymed Laboratories, Inc., San Francisco, CA) was spotted onto the slides. After incubation at 37[degrees]C for 1 h, the slides were washed and observed by fluorescence microscopy. Scattered, granular fluorescence in the cytoplasm of infected Vero E6 cells was considered a positive reaction. Antibodies in HFRS patient sera were detected by the same protocol, except for the substitution of FITC-conjugated antihuman immunoglobulin (Ig) G (ICN Pharmaceuticals, Inc., Aurora, OH).

Total RNA was extracted from lung tissues of seropositive A. peninsulae with Isogen (Nippon Gene Co., Ltd., Osaka, Japan), which is based on the acid guanidium-phenol-chloroform technique, according to manufacturer's instructions. Similarly, total RNA was extracted from lung, liver, kidney, spleen, and brain tissues of HFRS patients. Reverse transcription (RT) was carried out at 42[degrees]C for 30 min by using Superscript II and random primer (Gibco-BRL, Rockville, MD). Full-length S segments were amplified with Platinum Taq (Gibco-BRL) and HTNV-full S primer for 30 polymerase chain reaction (PCR) cycles of denaturation at 94[degrees]C for 30 s, annealing at 55[degrees]C for 30 s, and extension at 68[degrees]C for 2 min. Amplification of M segments was identical to that of S segments, except for the use of M genome-specific primers (Table 1). Part of the M segment (232 nucleotides) and the entire S segment (except for the 5' and 3' ends) were sequenced with primers specific for HTNV or SEOV or both. Amplification of the partial M segment was achieved only with nested PCR. The PCR-amplified products were separated by using a Rapid Gel Extraction kit (Gibco-BRL) according to the manufacturer's instructions. Purified DNA fragments were cloned into the PCR 2.1 vector provided in the TA cloning kit (Invitrogen Corporation, Carlsbad, CA). The ligated products were transformed into Top 10 competent cells (Invitrogen Corporation) and purified with a. Miniprep kit (QIAGEN GmbH, Hilden, Germany). DNA sequencing was performed with the ABIPRISM Dye Terminator Sequencing kit (Applied Biosystems, Foster City, CA) and an ABI 373-A genetic analyzer.

We used the ClustalX program package (version 1.81; available from: URL: ftp://ftp-igbmc.u-strasbg.fr/pub/ClustalX/) to generate the phylogenetic trees by using the neighbor-joining method with 1000 bootstrap replicates. Hantavirus sequences used in the comparisons were obtained from GenBank. The S and M genome sequences used in this study are listed in Table 2.

Formalin-fixed lung, liver, kidney, and brain tissues from an HFRS patient who died of acute renal failure were observed under light microscopy and subjected to immunohistochemical analysis with monoclonal antibodies against Hantaan virus.

Results

We carried out the epizootiologic survey on 122 rodents captured in a suburb of Vladivostok; results of serologic screening of rodent sera by IFA are shown in Table 3. Identified rodent species included (70) A. peninsulae, (39) A. agrarius, (8) C rufocanus, (3) M. fortis, and (2) Tamias sibiricus. Screening by IFA showed that one A. agrarius (2.5%), four A. peninsulae (5.7%), and one C. rufocanus (12.5%) had antibodies to HTNV or PUUV or both. HTNV-antibody titers ranged from 1:32 to 1:512. All the seropositive rodents, except for C. rufocanus, lacked antibody against PUUV (Table 4). Lung tissues from seropositive A. peninsulae were subjected to RT-PCR to amplify the virus genomes. Two of the four rodents with high IFA titers to HTNV (1:256 and 1:512) were positive by PCR for both the S and M segments of hantavirus.

We obtained the clinical histories of two fatal cases of HFRS in the Primorye region. The patients, who lived in villages 400 km and 600 km from Vladivostok, died 8-13 days after the onset of illness; gastrointestinal bleeding and acute renal failure were the causes of death. Serologic screening showed that both patients were positive for hantaviral antibodies. Antibody titers to HTNV and SEOV were apparently higher than to PUUV. We used lung, liver, kidney, spleen, and brain tissues of these HFRS patients for RT-PCR analysis; the lung and kidney tissues of patient no. 1 and the spleen tissue of patient no. 2 were positive for hantaviral M segment.

To examine the histopathologic changes in HFRS patients, we used light microscopy to examine sections of formalin-fixed lung, liver, kidney, spleen, and brain tissues from patient no. 2, who had died of acute renal failure (Figure 1). The kidney was the only tissue that showed the recognizable histopathologic changes. Salient changes included interstitial edema with mild infiltration of mononuclear cells (Figure 1, small arrow) and degeneration of renal tubules (Figure 1, large arrow) in the cortex (Figure 1, A). Although proteinaceous casts and exudates were observed in the lumina of renal tubules (Figure 1, arrowhead), there were no apparent glomerular changes. In addition, a prominent well-defined necrotic lesion (Figure 1, asterisk) was noted in the medulla (Figure 1, B). Viral antigens were not detected in these specimens by using monoclonal antibodies to HTNV.

[FIGURE 1 OMITTED]

The entire S segments of the viruses from two seropositive A. peninsulae were amplified and sequenced. We designated these segments as Solovey/AP61/1999 and Solovey/AP63/ 1999 based on the name of the village closest to the survey point, the rodent species from which the sample was taken, and the year in which the epizootiologic survey was done. We compared the coding regions of these sequences with those of other hantaviruses (Table 5). The S segments of the two Solovey sequences had 99.0% and 98.8% identities in nucleotide and amino acid sequences, respectively. Solovey sequences and Hantaan viruses had 78.2%-84.5% nucleotide sequence identity and 86.7%-93.3% amino acid sequence identity, regardless of their source or geographical origin. Lower nucleotide sequence identities were seen than in Solovey sequences and other viruses: DOBV (73.6%), SEOV (73.9%), and SNV (63.9%).

To explore the genetic diversity of hantaviruses identified in A. peninsulae in more detail, we sequenced the partial M segment of the G2 region (232 nt). We also sequenced the partial M segments of genetic lineages identified in the two HFRS patients from the Primorye region, designated as Primorye/H1/ 2000 and Primorye/H2/2000. The M segment of Solovey and Primorye sequences were compared with those of other hantaviruses (Table 6). Nucleotide sequence identities among these sequences were between 92.2% and 98.2%; amino acid sequence identities were almost identical (98.7%-100%). We also compared the M segment sequences of Solovey and Primorye with those of AMR genetic lineage, recently identified in HFRS patients and A. peninsulae in Far East Russia (10,11). The nucleotide and amino acid identities between Solovey, Primorye, and AMR lineages were 91.3%-98.3% and 93.5%-98.7%, respectively. The M segment sequences of Solovey, Primorye, and AMR lineages were compared with that of H8205, isolated from an HFRS patient in China. In this case, the nucleotide sequence identities were 93.5%-96.1%, and the amino acid sequence identities were 94.8%-100%. Lower nucleotide identities were seen with HTNV (78.8%-86.2%), SEOV (79.3%-81.4%), and DOBV (75.8%-77.1%). This high level of sequence identity among Solovey, Primorye, AMR, and H8205 sequences suggests that some patients acquired the infection from the Korean field mouse (A. peninsulae) in Far East Russia and China. Our results also suggest that this genetic lineage is widely distributed throughout east Asia.

The M segments of Solovey, Primorye, and AMR sequences formed a common phylogenetic lineage with high bootstrap support values, regardless of viral origin (Figure 2, A). Furthermore, H8205 shared a common lineage with Solovey and Primorye sequences. Another phylogenetic analysis, based on a different region of the M segment, showed that Chinese virus isolates (H8205, H3, H5, and B78) formed a distinct lineage within the Hantaan clade (Figure 2, B). The phylogenetic tree constructed for the S sequences (Figure 3) showed that Solovey sequences formed a single cluster, together with Maajil (a Korean isolate) and B78, in a common lineage with high bootstrap support values within the Hantaan clade.

[FIGURES 2 & 3 OMITTED]

To identify signature amino acids for each virus type, we compared the deduced partial amino acid sequences of their G2 regions using ClustalX multiple-sequence alignment (Figure 4). The presence of leucine or isoleucine at amino acid position (aa) 903 was unique to HTNV except for AMR lineage. The signature amino acids for SEOV were leucine at aa 918 and valine, isoleucine, and serine at aa 955-957. The signature amino acids for AMR lineage were methionine at aa 932 and aspartic acid at aa 967.

[FIGURE 4 OMITTED]

Discussion

Each hantavirus serotype or genotype is generally associated with a specific rodent host, and various rodent species act as reservoir animals and sources of human infection. Since contact between rodents and humans occurs frequently during agricultural and forestry activities, most infections have been reported in rural areas. However, an urban epidemic of HFRS caused by SEOV has also been reported (26). A large number of rodent species may serve as reservoir animals for pathogenic hantaviruses. For example, few researchers suspected that P. maniculatus could transmit highly virulent hantavirus to humans until SNV was identified (27,28). Later studies showed that the other viral agents of HPS such as NYV, BCCV, BAYV, and ANDV, were carried by P. leucopus, S. hispidus (29), O. palustris (30), and O. longicaudatus (31), respectively. We emphasize the importance of discovering the characteristics of hantaviruses found in endemic areas and identifying the primary hosts.

Although Far East Russia has long been considered an HFRS-endemic area,, few reports describe the hantaviral sequences in this region, and information on reservoir animals carrying pathogenic hantaviruses is limited. Our studies therefore focused on determining the genetic characteristics of hantaviruses circulating in this geographic area. We identified A. peninsulae as the natural reservoir rodent for a hantavirus pathogenic for humans in Far East Russia. We

also identified hantavirus sequences designated as Solovey and Primorye in A. peninsulae and HFRS patients, respectively; genetic analysis showed that these sequences were very closely related to each other. This information and the pathological findings from the HFRS case in which Primorye sequence was identified strongly suggest that the virus of Solovey sequence is the causative agent of HFRS. The nucleotide sequence and phylogenetic analysis also showed that Solovey and Primorye sequences were most closely related to AMR and H8205 sequences from patients in Russia and China, but were clearly distinguishable from the prototype of Hantaan virus. Genetic and phylogenetic analysis indicated that Solovey and Primorye sequences were closely related to AMR, Maajil, H8205, and B78 sequences, viruses derived from distant areas. While Solovey sequences were identified in a suburb of Vladivostok and PRI sequences in two villages 400 km and 600 km from Vladivostok, the H8205 and B78 viruses were derived in China, and Maajil was isolated in Korea. A. peninsulae is distributed in the same region where g. agrarius is prevalent in Korea (PW Lee, pets. comm.). Recently, AMR sequences were found in both HFRS patients and A. peninsulae (11). We suggest that some of the viruses circulating in the area of this study cause severe HFRS and are carried by the same host species, g. peninsulae. Comparison of the deduced hantaviral amino acid sequences showed that aspartic acid and methionine represented signature amino acids for AMR genetic lineage, regardless of the region in which the virus was identified or its origin (Figure 4). These signature amino acids may be used to distinguish AMR genetic lineage from other hantaviruses. We conclude from our results that A. peninsulae carries a hantavirus that is pathogenic for humans. Since A. peninsulae is widely distributed in Far East Russia, China, Korea, and Japan, this hantavirus and associated cases of HFRS may also be widely distributed.

In the kidney tissue of one HFRS patient (no. 2) from Primorye region, we detected pathologic changes typical of severe HFRS caused by hantavirus infection (32-35). We also detected and sequenced the partial M segment in the spleen of the same patient. However, we could not detect the viral antigen in the kidney samples, possibly because of low levels of the virus in the kidneys of this patient. Nested PCR allowed the amplification of viral M segments from the spleen, but not from kidney, of this patient.

Through epizootiologic, clinical, pathologic, and sequencing studies, we identified a hantavirus carried by A. peninsulae as one of the causative agents of HFRS. We think that this information may be helpful in preventing human infections in East Asia. Controversy persists over whether A. peninsulae carries a distinct virus type or a subtype of HTNV. A similar question arises with Dobrava/Slovenia and Dobrava/Saaremaa, which are carried by A. flavicollis and A. agrarius, respectively. The S segment identities between Dobrava/Slovenia and Dobrava/Saaremaa (both obtained from GenBank for comparison purposes) were 87.8% (nucleotide) and 92.7% (amino acid). Similarly, the nucleotide and amino acid sequence identities of the S segments of Solovey sequences and HTN 76-118 were 82.7% and 92.2%, respectively. We suggest that Solovey sequences belong to a sublineage within the HTNV clade.

Table 1. Primers used for reverse transcription-polymerase chain
reaction and/or sequencing of S and M genome segments of
hantaviruses

Gene         Primer name       Primer sequence (5'-3')      Position

S segment       M13 Fw             ctggccgtcgttttac
             PEN 215 S Fw        gaattgaaagacaattggc         215-233
               KPS3 (a)           tc(a/c)agcatgaaggc         592-703
                                    (a/t)gaagagat
             PEN 780 SFw         acagaggcaggcagctttag        780-799
            PEN 1042 S Fw        gcaggatatgcggaatacaa       1042-1061
            HTNV 1390 S Fw       attgcactattattatcagg       1390-1409
             HTNV Full S        ttctgcagtagtagtag(t)a
                                     (g)ctccctaa
             PEN 180 S Rv        ttccctgtctgttaatgctc        180-199
             PEN 585 S Rv        tgggcaaggacacatagaga        585-604
              PEN 946 Rv         atgatggtgactcgatgtct        946-965
            PEN 1160 S Rv        gttgtattcccattgactgt       1160-1179
            HTNV 1493 SRv        cacccacaacggattaactg       1493-1512
                M13 Rv            caggaaacagctatgac
M segment      HS1 (a)          ac(a/c)tgtca(c/a)tttgg      2636-2655
                                      (a/t)gaccc
               HS2 (a)       tcaca(g/a)gcctttattga(g/t)gt   3072-3091
               HS3 (a)           t(tc)aggaa(ga)aaatg        2715-2736
                                     (tc)aactttgc
               HS4 (a)       acacc(a/t)gaaccccaggc(a/c)cc   3000-3019
                M13 Fw             ctggccgtcgttttac
                M13 Rv            caggaaacagctatgac

(a) Primers designed by Yashina et al.
Table 2. Hantavirus sequences used in this study (a)

                                                           Country

Virus type      Strain               Source                Region

HTNV         SL/AP61/1999      Apodemus peninsulae     Far East Russia
             SL/AP63/1999         A.peninsulae         Far East Russia
              PRI/H1/2000             Human               Primorye
              PRI/H2/2000             Human               Primorye
                AMR/680           A.peninsulae         Far East Russia
               AMR/1166           A.peninsulae         Far East Russia
               AMR/1169           A.peninsulae         Far East Russia
               AMR/4234               Human            Far East Russia
               AMR/4309               Human            Far East Russia
               AMR/4313               Human            Far East Russia
                 H8205                Human                 China
                HTNV261                --                   China
                  Z10                 Human                 China
                 Chen4                Human                 China
                Maaji1             A. agrarius              Korea
                Maaji-2               Human                 Korea
              HTN 76-118           A. agrarius           South Korea
                  Q32                  --                   China
                 HV114             A. agrarius              China
                  A9               A. agrarius              China
                 Hojo                 Human              South Korea
                FE/7866               Human            Far East Russia
                 NC167       Niviventer confucianus         China
                  H3                  Human                 China
                  H5                  Human                 China
                  A3               A. agrarius              China
                  B78                 Human                 China
                  Q36              A. agrarius              China
                  Q7               A. agrarius              China
                  Q20              A. agrarius              China
              Niongxia-A           A. agrarius              China
                  Q10              A. agrarius              China
                  A16              A. agrarius              China
                  Q37              A. agrarius              China
                  Q33              A. agrarius              China
                 Bao9              A. agrarius              China
                Jiang13            A. agrarius              China
                 Bao14             A. agrarius              China
                 Bao10             A. agrarius              China
                  Lee                 Human              South Korea
                62HTNV                 --                    --
                  6B                   --                    --
HTNV            Vaccine                --                    --
                  H2                   --                North Korea
                HN26-L             A. agrarius              China
                 Luyao                Human                 China
                 B659                 Human                 China
                  Hu                  Human                 China
                  Q83                  --                    --
                 B256                  --                    --
               Thailand         Bandicota indica          Thailand
              Topografov        Lemmus sibericus       Far East Russia
SEOV              L99             Rattus losea              China
                 SR11             R. norvegicus             Japan
                 Gou3               R. rattus               China
                 NM39             R. norvegicus             China
                 HB55                 Human                 China
                  Wan                 Human                 China
                  J12                 Human                 China
                Henan94           R. norvegicus             China
                Shanxi                 --                    --
                HN71-L            R. norvegicus             China
               Guang199                --                    --
              Beijing-Rn          R. norvegicus             China
                  c3                  Human                 China
                Hebei4        Cricetulus barabensis         China
                 SD227                 --                   China
                 SD10             R. norvegicus             China
                 Hbei1                Human                 China
                 Seoul            R. norvegicus          South Korea
             Tchoupitoulas        R. norvegicus         North America
                  B-1             R. norvegicus             Japan
             Girard Point         R. norvegicus         North America
DOBV           DOB/SLOV          A. flavicollis           Slovenia
                DOB/SAA            A. agrarius             Estonia
SNV               SNV        Peromyscus maniculatus     North America
PUUV            PUU/Sot      Clethrionomys glareolus       Finland
                Kamiiso           C. rufocanus              Japan
KHAB          Khabarovsk         Microtis fortis       Far East Russia

               Country         Accession nos.     References

Virus type     Location        M          S

HTNV           Solovey      AB071185   AB071183   This report
               Solovey      AB071186   AB071184   This report
              Cavalerovo    AB071187    -- (b)    This report
              Cavalerovo    AB071188      --      This report
              Khabarvosk    AF332571      --          11
              Khabarvosk    AF332569      --          11
              Khabarvosk    AF332570      --          11
                Amursk      AF172422      --          10
                Amursk      AF172423      --          10
              Korphovsky    AF172424      --          10
                  --        AB030232      --          --
             Heilongjiang      --      AF252259       --
               Zhejiang     AB027076   AB027108       12
                Anhui          --      AB027101       12
                  --           --      AF321094   Lee PW (c)
                  --           --      AF321095   Lee PW (c)
                  --         M14627     M14626       13,14
               Guizhou         --      AB027097       12
                Hubei        L08753    AB027110      12,15
               Jiangsu      AF035831      --          16
                  --         D00376       --          17
              Razdolnoye    AF172439      --          10
                Anhui       AB027115   AB027523       12
                Hubei          --         --          18
             Heilongjiang      --         --          18
               Zhejiang     AB027055      --          12
               Shandong     AB027056   AB027093       12
               Guizhou      AB027057   AB027094       12
               Guizhou      AB02058    AB027095       12
               Guizhou      AB027059   AB027096       12
               Niongxia     AB027060      --          12
               Guizhou      AB027062   AB027098       12
                Sanxi       AB027063   AB027099       12
               Guizhou      AB027064   AB027100       12
               Guizhou      AB027065   AB027102       12
             Heilongjiang   AB027066   AB027103       12
             Heilongjiang   AB027067   AB027104       12
             Heilongjiang   AB027068   AB027105       12
             Heilongjiang   AB027069   AB027106       12
                  --         D00377       --          17
                  --        AB027070      --          12
                  --        AB027071      --          12
HTNV              --        AB027072      --          12
                  --        AB027073   AB027107       12
                Hainan      AB027074      --          12
               Shandong        --      AB027109       12
               Shandong      S72339       --          18
                Hubei       AB027077   AB027111       12
               Guizhou      AB027078      --          12
                  --        AB027079   AB027112       12
                  --         L08756       --          --
               Siberia      AJ011647      --           9
SEOV           Jiangxi      AF035833   AF288299       --
               Sapporo       M34882     M34881        19
               Zhejiang     AB027521   AB027522       12
               Neimeng      AB027080      --          12
                Henan       AF035832      --          17
               Jiangsu      AB027081      --          12
               Jieling      AB027082      --          12
                Henan       AB027083      --          12
                  --        AB027084      --          12
                Hainan      AB027085      --          12
                  --        AB027086      --          12
               Beijing      AB027087      --          12
                Hebei       AB027088      --          12
                Hebei       AB027090      --          12
              Shangdong     AB027091      --          12
              Shangdong     AB027092      --          12
                Hubei        S72343       --          17
                  --         S47716       --          20
                  --         U00473       --          21
                  --         X53861       --          22
                  --         U00464       --          --
DOBV              --         L33685     L41916        23
                  --        AJ009774   AJ009773        4
SNV               --         L25783     L25784        24
PUUV              --         X61034       --          25
               Kamiiso      AB011631      --           8
KHAB          Khabarvosk    AJ011648      --           9

(a) Abbreviations used: HTNV and HTN, Haantan virus; SL, Solovey;
PRI, Primorye; AMR, Amur; SEOV, Seoul virus; DOB and DOBV,
Dobrava-Belgrade virus; SLOV, Slovenia; SAA, Saarema; SNV, Sin
Nombre virus; PUUV, Puumala virus; and KHAB, Khabarovsk virus.

(b) --, not reported/not used in this study.

(c) Pers. comm.
Table 3. Serologic screening by immunofluorescent antibody assay for
Haantan virus and Puumala virus antibodies in rodents, Vladivostok,
Russia (a)

                                                  Positives
                                                  by IFA (%)

Rodent species            No. of sera tested    HTNV     PUUV

Apodemus peninsulae               70           4(5.7)      0
A. agrarius                       39           1(2.5)      0
Clethrionomys rufocanus           8            1(12.5   1(12.5)
Microtus fortis                   3              0         0
Tamias sibiricus                  2              0         0
Total                            122           6(4.9)   1(0.8)

(a) Abbreviations used: IFA, immunofluorescent antibody assay; HTNV,
Haantan virus; PUUV, Puumala virus.
Table 4. Haantan virus and Puumala virus antibody titers determined
by immunofluorescent antibody assay and polymerase chain reaction
results

                                             IFA
                                           antibody
                                             titer

Species                   Sample number   HTNV   PUUV    PCR

Apodemus peninsulae            47         256    <16    - (b)
A. peninsulae                  61         512    <16    + (c)
A. peninsulae                  63         256    <16      +
A. peninsulae                  74          64    <16      -
A. agrarius                    10          32    <16     NA
Clethrionomys rufocanus        32         256    256     ND

(a) Abbreviations used: HTNV, Haantan virus; PUUV, Puumala virus;
IFA, immunofluorescent antibody assay; PCR, polymerase chain
reaction; NA, not available; ND, not done.

(b) -, negative.

(c) +, positive.
Table 5. Comparison of nucleotide (open reading frame) and amino
acid of S genome between those from Apodemus peninsulae and other
hantaviruses (a)

                  Nucleotide and amino acid identities % (b)

             SL/AP61   SL/AP63   HTNV261   Z10    Chen4   Maaji-1

SL/AP61                 99.0      84.5     83.5   83.4     82.9
SL/AP63       98.8                84.2     83.5   83.4     82.9
HTNV261       91.9      91.5               85.6   85.7     83.0
Z10           91.9      91.5      92.9            89.1     83.6
Chen4         93.0      92.5      93.2     96.2            82.8
Maaji-1       91.5      90.8      90.8     91.3   93.0
HTNV76-118    92.2      91.5      94.9     92.9   93.7     91.0
Q32           92.7      92.3      93.7     94.4   96.0     91.8
NC167         87.2      86.7      85.3     85.8   85.3     84.8
SR11          75.0      74.5      74.1     73.9   74.6     74.3
GOU3          75.7      75.5      75.0     74.8   76.2     74.3
Dob/Slo       76.4      76.4      76.8     75.7   77.6     76.6

                 Nucleotide and amino acid identities % (b)

             HTNV 76-118   Q32    NC1167   SR11   GOU3   Dob/Slo

SL/AP61         82.7       82.3    78.3    73.7   73.7    72.9
SL/AP63         82.8       81.5    78.2    73.9   73.8    72.2
HTNV261         88.6       84.7    78.9    74.1   73.6    72.6
Z10             85.9       87.5    79.8    75.3   74.2    73.3
Chen4           85.8       90.3    78.7    73.2   74.2    73.4
Maaji-1         82.9       82.1    78.2    74.2   73.0    74.2
HTNV76-118                 84.4    78.2    74.6   73.8    74.0
Q32             93.2               79.1    73.1   74.3    73.8
NC167           86.9       85.1            75.3   73.6    72.7
SR11            74.8       74.1    77.2           87.8    73.7
GOU3            74.8       76.7    76.7    91.5           73.1
Dob/Slo         75.5       77.2    76.0    73.1   73.1

(a) Values in bold show the close identities between the two
Solovey sequences. Abbreviations used: SL, Solovey; HTNV,
Haantan virus; Dob, Dobrova; Slo, Slovenia.

(b) Values above the diagonal and to the right show nucleotide
identities; those below the diagonal and to the left show
amino acid identities.
Table 6. Comparison of nucleotide (bases 2737-2969) (a) and amino
acid of M genome between those from Primorye patients, Apodemus
peninsulae, and other hantaviruses

                       Nucleotide and amino
                       acid identities % (b)

              SL/    SL/    AMR/   PRI/   PRI/   H8205
              AP61   AP63   1169    H1     H2

SL/AP61 (c)          99.5   97.8   96.1   98.2    94.8
SL/AP63        100          97.8   92.2   94.3    94.8
AMR/1169      94.8   94.8          96.5   98.7    95.6
PRI/H1         100    100   94.8          96.9    93.5
PRI/H2        98.7   98.7   93.5   98.7           94.8
H8205          100    100   94.8    100   98.7
AMR/4313      98.7   98.7   93.4   98.7   97.4    98.7
HV114         93.5   93.5   88.3   93.5   92.2    93.5
A9            93.5   93.5   88.3   93.5   92.2    93.5
HTNV76118     94.8   94.8   89.6   94.8   93.5    94.8
Hojo          94.8   94.8   89.6   94.8   93.5    94.8
FE            92.2   92.2   87.0   92.2   90.9    92.2
NC167         86.8   86.8   80.5   86.8   85.5    86.8
DOB/Slo       88.3   88.3   83.1   88.3   87.0    88.3
SR11          83.1   83.1   79.2   83.1   81.8    83.1
PUUV          53.2   53.2   53.2   53.2   51.9    53.2

                        Nucleotide and amino
                        acid identities % (b)

              AMR/   HV114    A9     HTNV    Hojo    FE
              4313                  76-118

SL/AP61 (c)   94.3    86.2   85.7     84.4   82.7   82.7
SL/AP63       94.3    85.7   85.3     84.0   82.3   83.1
AMR/1169      95.6    86.6   86.2     84.9   83.1   81.4
PRI/H1        92.2    84.0   83.6     83.1   82.3   80.6
PRI/H2        94.3    85.7   85.3     84.0   82.3   81.4
H8205         91.3    83.6   83.1     85.3   84.9   80.6
AMR/4313              85.7   85.3     83.6   81.8   82.7
HV114         92.2           99.5     86.6   84.4   87.9
A9            92.2    98.9            86.2   84.0   87.5
HTNV76118     93.5    97.4   96.1            94.6   88.7
Hojo          93.5    97.4   96.1      100          87.9
FE            90.9    87.9   87.5     97.4   98.7
NC167         85.5    89.5   88.2     90.8   90.8   88.2
DOB/Slo       87.0    88.3   87.0     87.0   87.0   84.4
SR11          81.8    83.1   81.8     81.8   81.8   83.1
PUUV          51.9    62.9   62.5     51.9   61.6   53.2

                Nucleotide and amino
                acid identities % (b)

              NC167   DOB/   SR-    PUUV
                      Slo     11

SL/AP61 (c)    79.3   79.3   79.7   60.3
SL/AP63        78.8   80.1   81.4   60.7
AMR/1169       79.7   80.1   79.3   60.3
PRI/H1         79.3   78.8   79.3   60.3
PRI/H2         78.8   79.3   78.8   59.4
H8205          77.1   79.3   77.1   60.7
AMR/4313       78.0   78.0   78.8   59.9
HV114          78.4   75.8   83.1   51.9
A9             78.0   75.4   81.8   50.6
HTNV76118      79.7   78.4   76.7   59.9
Hojo           78.0   78.8   76.7   51.5
FE             75.8   73.7   78.4   59.9
NC167                 75.4   77.5   49.3
DOB/Slo        81.6          75.0   59.9
SR11           80.3   80.5          56.0
PUUV           61.6   49.4   61.2

(a) Based on Haantan 76-118.

(b) Values above the diagonal and the right show nucleotide
identities; those below the diagonal and to the left show
amino acid identities.

(c) Values in bold show the close identities between those
sequences. Abbreviations used: SL, Solovey; AMR, Amur; PRI,
Primorye; HTNV, Haantan virus; FE, Far East virus; DOB,
Dobrova; Slo, Slovenia; PUUV, Puumala virus

Acknowledgments

We thank Kimiyuki Tsuchiya of Miyazaki Medical College and Masahiro Iwasa and Hitoshi Suzuki of Hokkaido University for providing rodent information.

This study was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Science, Culture, and Sport, Japan (projects 1357529 and 13660311) and by Health Science Grants for Research on Emerging and Re-emerging Infectious Diseases from the Ministry of Health, Labor, and Welfare, Japan.

References

(1.) Tang YW, Xu ZY, Zhu ZY, Tsai TF. Isolation of haemorrhagic fever with renal syndrome virus from Suncus murinus, an insectivore. Lancet 1985;1:513-4.

(2.) Plyusnin A, Vapalahti O, Vaheri A. Hantaviruses: genome structure, expression and evolution. J Gen Virol 1996;77:2677-87.

(3.) Clement J, Heyman P, McKenna P, Colson P, Avsic-Zupanc T. The hantaviruses in Europe: from the bedside to the bench. Emerg Infect Dis 1997;3:205-11.

(4.) Nemirov K, Vapalahti O, Lundkvist A, Vasilenko V, Golovljova I, Plyusnina A, et al. Isolation and characterization of Dobrava hantavirus in the striped field mouse (Apodemus agrarius) in Estonia. J Gen Virol 1999;80:371-9.

(5.) Scharninhausen JJ, Meyer H, Pfeffer M, Davis DS, Honeycutt RL. Genetic evidence of Dobrava virus in Apodemus agrarius in Hungary. Emerg Infect Dis 1999;5:468-70.

(6.) Peters CJ, Gary LS, Levy H. Spectrum of hantavirus infection: Hemorrhagic fever with renal syndrome and hantavirus pulmonary syndrome. Annu Rev Med 1999;50:531-45.

(7.) Horling J, Chizhikov V, Lundkvist A. Khabarovsk virus: a phylogenetically and serologically distinct hantavirus isolated from Microtus fortis trapped in Far East Russia. J Gen Virol 1996;77:687-94.

(8.) Kariwa H, Yoshimatsu K, Sawabe J, Yokota E, Arikawa J, Takashima I, et al. Genetic diversities of hantaviruses among rodents in Hokkaido, Japan and Far East Russia. Virus Res 1999;59:219-28.

(9.) Vapalahti O, Lundkvist A, Fedorov V, Conroy CJ, Hirvonen S, Plyusnina A, et al. Isolation and characterization of hantavirus from Lemmus sibiricus: evidence for host switch during hantavirus evolution. J Virol 1999;73:5586-92.

(10.) Yashina LN, Pastrshev NP, Ivanov LI, Slonova RA, Mishin VP, Kompanez GG, et al. Genetic diversities of hantaviruses associated with hemorrhagic fever with renal syndrome in the far east of Russia. Virus Res 2000;70:31-44.

(11.) Yashina L, Mishin V, Zdanovskaya N, Schmaljohn C, Ivanov L. A newly discovered variant of a Hantavirus in Apodemus peninsulae, Far Eastern Russia. Emerg Infect Dis 2001;7:912.

(12.) Wang H, Yoshimatsu K, Ebihara H, Ogino M, Araki K, Kariwa H, et al. Genetic diversity of hantaviruses isolated in China and characterization of novel hantaviruses isolated from Niviventer confucianus and Rattus rattus. Virology 2000;278:332-45.

(13.) Schmaljohn CS, Jening GB, Hay J, Dalrymple JM. Coding strategy of the S genome segment of Hantaan virus. Virology 1986;155:633-43.

(14.) Schmaljohn CS, Schmaljohn AL, Dalrymple JM. Hantaan virus mRNA: coding strategy, nucleotide sequence, and gene order. Virology 1987;157:31-9.

(15.) Xiao SY, Liang M, Schmaljohn CS. Molecular and antigenic characterization of HV114, a hantavirus isolated from a patient with haemorrhagic fever with renal syndrome in China. J Gen Virol 1993;74:1657-9.

(16.) Shi XH, Liang MF, Hang CS, Gan S, McCaughey C, Eliott RM. Nucleotide sequence and phylogenetic analysis of the medium (M) genomic RNA segments of three hantaviruses isolated in China. Virus Res 1998;56:69-76.

(17.) Schmaljohn CS, Arikawa J, Hasty SE, Rasmussen L, Lee HW, Lee PW, et al. Conservation of antigenic properties and sequences encoding the envelope proteins of prototype Hantaan virus and two virus isolates from Korean haemorrhagic fever patients. J Gen Virol 1988;69:1949-55.

(18.) Liang M, Li D, Xiao SY, Hang C, Rossi CA, Schmaljohn CS. Antigenic and molecular characterization of hantavirus isolates from China. Virus Res 1994;31:219-33.

(19.) Arikawa J, La Penotiere HF, Iacono-Connors L, Wang MG, Schmaljohn CS. Coding properties of the S and the M genome segments of Sapporo rat virus: comparison to other causative agents of hemorrhagic fever with renal syndrome. Virology 1990;176:114-25.

(20.) Antic D, Lim BU, Kang CY. Molecular characterization of the M genomic segment of the Seoul 80-39 virus; nucleotide and amino acid sequence comparison with other hantaviruses reveal the evolutionary pathway. Virus Res 1991;19:47-58.

(21.) Xiao SY, Leduc JW, Chu YK, Schmaljohn CS. Phylogenetic analysis of virus isolates in the genus Hantavirus, family Bunyaviridae. Virology 1994;198:205-17.

(22.) Isegawa Y, Fujiwara Y, Ohshima A, Fukunaga R, Murakami H, Yamanishi K, et al. Nucleotide sequence of the M genome segment of hemorrhagic fever with renal syndrome virus strain B-1. Nucleic Acid Res 1990;18:4936.

(23.) Avsic-Zupanc T, Toney A, Anderson K, Chu YK, Schmaljohn C. Genetic and antigenic properties of Dobrava virus; a unique member of the Hantavirus genus, family Bunyaviridae. J Gen Virol 1995;76:2801-8.

(24.) Chizhikov VE, Spiropoulou CF, Morzunov SP, Monroe MC, Peters CJ, Nichol ST. Complete genetic characterization and analysis and isolation of Sin Nombre virus. J Virol 1995;69:8132-6.

(25.) Vapalahti O, Kallio-Kokko H, Salonen EM, Brummer-Korvenkontio M, Vaheri A. Cloning and sequencing of Puumala virus Sotkamo strain S and M RNA segment: evidence for strain variation in Hantavirus and expression of the nucleocapsid protein. J Gen Virol 1992;73:829-38.

(26.) Lee HW, Lee PW, Tamura M, Tamura T, Okuno Y. Etiological relation between Korean hemorrhagic fever and epidemic hemorrhagic fever in Japan. Biken J 1979;22:41-5.

(27.) Nichol ST, Spiropoulou CF, Morzunov S, Rollin PE, Ksiazek TG, Feldmann H, et al. Genetic identification of a hantavirus associated with an outbreak of acute respiratory illness. Science 1993;262:914-7.

(28.) Childs JE, Ksiazek TG, Spiropoulou CF, Krebs JW, Morzunov S, Maupin GO, et al. Serologic and genetic identification of Peromyscus maniculatus as the primary rodent reservoir for a new hantavirus in the southwestern United States. J Infect Dis 1994;169:1271-80.

(29.) Rollin PE, Ksiazek TG, Elliot LH, Ravkov EV, Martin ML, Morzunov S, et al. Isolation of black creek canal virus, a new hantavirus from Sigmodon hispidus in Florida. J Med Virol 1995;46:35-9.

(30.) Ksiazek TG, Nichol ST, Mills JN, Groves MG, Wozniak A, McAdams S, et al. Isolation, genetic diversity, and geographic distribution of Bayou virus (Bunyaviridae; hantavirus) Am J Trop Med Hyg 1997;57:445-8.

(31.) Schmaljohn C, Hjelle B. Hantaviruses:a global disease problem. Emerg Infect Dis 1997;3:95-104.

(32.) Mustonen J, Helin H, Pietila K, Brummer-Korvenkontio M, Hedman K, Vaheri A, et al. Renal biopsy findings and clinicopathologic correlations in nephropathia epidemica. Clin Nephrol 1994;41:121-6.

(33.) Grcevska L, Polenakovic M, Oncervski A, Zografski D, Gligic A. Different pathohistological presentations of acute renal involvement in Hantaan virus infection: report of two cases. Clin Nephrol 1990:34:197-201.

(34.) Bren AF, Pavlovcic SK, Koselj M, Kovac J, Kandus A, Kveder R. Acute renal failure due to hemorrhagic fever with renal syndrome. Ren Fail 1996;18:635-8.

(35.) Polenakovic M, Grcevska L, Gerasimovska-Tanevska V, Oncevski A, Dzikova S, Cakalaroski K, et al. Hantaan virus infection with acute renal failure. Artif Organs 1995;19:808-13.

Ms. Lokugamage is a doctoral candidate studying the epidemiology of hantaviruses at the Laboratory of Public Health, Graduate School of Veterinary Medicine of Hokkaido University, Sapporo, Japan. She has also served as a faculty lecturer at the School of Veterinary Medicine, University of Peradeniya, Sri Lanka.

Address for correspondence: Hiroaki Kariwa, Laboratory of Public Health, Graduate School of Veterinary Medicine, Hokkaido University, Sapporo, Hokkaido 060-0818, Japan; fax: [phone]; e-mail: [e-mail]

Kumari Lokugamage, * Hiroaki Kariwa, * Daisuke Hayasaka, * Bai Zhong Cui, * Takuya Iwasaki, ([dagger]) Nandadeva Lokugamage, * Leonid I. Ivanov, ([double dagger]) Vladimir I. Volkov, ([double dagger]) Vladimir A. Demenev, ([section]) Raisa Slonova, ([paragraph]) Galina Kompanets, ([paragraph]) Tatyana Kushnaryova, ([paragraph)] Takeshi Kurata, ([dagger]) Kenji Maeda, * Koichi Araki, * Tetsuya Mizutani, * Kumiko Yoshimatsu, (#) Jiro Arikawa, (#) and Ikuo Takashima *

* Hokkaido University, Sapporo, Japan; ([dagger]) National Institute of Infectious Diseases, Tokyo, Japan; ([double dagger]) Plague Control Station, Khabarovsk, Russia; ([section]) Far Eastern Medical Association, Khabarovsk, Russia; ([paragraph]) Russian Academy of Medical Sciences, Vladivostok, Russia; and (#) Hokkaido University School of Medicine, Sapporo, Japan