Genetic characterization of Nipah virus, Bangladesh, 2004.Until 2004, identification of Nipah virus Nip·ah virus n. A single-stranded RNA virus that is transmitted from animals and causes fever and myalgias that can progress to encephalitis in humans. (NV)-like outbreaks in Bangladesh was based on serology Serology The division of biological science concerned with antigen-antibody reactions in serum. It properly encompasses any of these reactions, but is often used in a limited sense to denote laboratory diagnostic tests, especially for syphilis. , We describe the genetic characterization of a new strain of NV isolated during outbreaks in Bangladesh (NV-B) in 2004, which confirms that NV was the etiologic agent responsible for these outbreaks. ********** Nipah virus (NV) and Hendra virus Hen·dra virus n. A paramyxovirus that causes encephalitis in humans and is transmitted from animals. Hendra virus the cause of a highly fatal respiratory virus disease of horses. (HV), the only members of the genus Henipavirus within the family Paramyxoviridae are different from most other paramyxoviruses because they have a broad host range in vivo in vivo /in vi·vo/ (ve´vo) [L.] within the living body. in vi·vo adj. Within a living organism. in vivo adv. and in vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment. in vi·tro adj. In an artificial environment outside a living organism. . Although HV and NV have genetic characteristics and replication strategies similar to those of other paramyxoviruses, the henipaviruses have several unique genetic features (1,2-4). The first outbreak of NV occurred between late 1998 and early 1999 in peninsular Malaysia and Singapore and was associated with respiratory disease Noun 1. respiratory disease - a disease affecting the respiratory system respiratory disorder, respiratory illness adult respiratory distress syndrome, ARDS, wet lung, white lung - acute lung injury characterized by coughing and rales; inflammation of the in swine and acute and febrile febrile /feb·rile/ (feb´ril) pertaining to or characterized by fever. feb·rile adj. Of, relating to, or characterized by fever; feverish. encephalitis encephalitis (ĕnsĕf'əlī`təs), general term used to describe a diffuse inflammation of the brain and spinal cord, usually of viral origin, often transmitted by mosquitoes, in contrast to a bacterial infection of the meninges in humans. Direct contact with sick pigs was the primary source of human infection (1). Of 265 human cases, 108 were fatal. Although NV is excreted in respiratory secretions and urine of patients (1,5), a survey of healthcare workers in Malaysia showed no evidence of human-to-human transmission (6). The reservoir of NV is presumed to be fruit bats, primarily of the genus Pteropus (7,8), and humans are infected through intermediate hosts such as pigs. Recently, NV has been established as the cause of fatal, febrile encephalitis in human patients in Bangladesh during the winters of 2001, 2003, and 2004 (9-12). An NV-like virus was identified as the cause of the outbreaks in 2001 and 2003 on the basis of serologic testing (12). Two outbreaks consisting of 48 cases of NV were detected in 2004 in 2 adjacent districts (30 km apart) of central Bangladesh (Rajbari and Faridpur) with a case-fatality rate of nearly 75%. Because of heightened surveillance, other small clusters and isolated cases (n = 19) were identified during the same period in 7 other districts in central and northwest Bangladesh. Although antibodies to NV were detected in fruit bats from the affected areas in 2004, an intermediate animal host was not identified, which suggests that the virus was transmitted from bats to humans. Human-to-human transmission of NV was also documented during the Faridpur outbreak (10,11). We describe the genetic characteristics of 4 NV isolates from the outbreak in Bangladesh in 2004. The Study Virus isolation was performed in the BSL-4 laboratory at the Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center. in Atlanta. Vero E6 cells were inoculated and observed for characteristic cytopathic effect, syncytium syncytium /syn·cy·ti·um/ (sin-sish´e-um) a multinucleate mass of protoplasm produced by the merging of cells. syn·cy·ti·um n. pl. formation (1,5). NV was isolated from 2 oropharyngeal oropharyngeal /oro·pha·ryn·ge·al/ (-fah-rin´je-al) 1. pertaining to the mouth and pharynx. 2. pertaining to the oropharynx. (SPB SPB Spb Software House SPB Saint Petersburg SPB State Personnel Board SPB Southern Pine Beetle SPB Spindle Pole Body (biology, biochemistry) SPB Special Pathogens Branch (Centers for Disease Control) 200401066, SPB200406506), 1 cerebrospinal fluid cerebrospinal fluid (CSF) Clear, colourless liquid that surrounds the brain and spinal cord and fills the spaces in them. It helps support the brain, acts as a lubricant, maintains pressure in the skull, and cushions shocks. (SPB200401617), and 1 urine specimen (SPB200405758) from human patients, and isolation was confirmed by reverse transcription polymerase chain reaction “RT-PCR” redirects here. For real-time polymerase chain reaction, also called quantitative real time polymerase chain reaction or kinetic polymerase chain reaction, see real-time polymerase chain reaction. (RT-PCR RT-PCR reverse transcriptase-polymerase chain reaction. See PCR1. ). Two isolates were from Rajbari, and 1 was from Faridpur; the fourth isolate, from the Rajshahi district (100 km from Rajbari), was not linked to the other 2 outbreaks. The complete genomic sequence of the first viral isolate (SPB200401066) from Rajbari was derived and submitted to GenBank (accession no. AY988601) as NV-Bangladesh (NV-B). The sequences of the open reading frame (ORF) coding for nucleoprotein nucleoprotein Macromolecular complex consisting of a protein linked to a nucleic acid, either DNA or RNA. The proteins that combine with DNA are generally of characteristic types called histones and protamines. (N) were obtained for the other 3 isolates. The methods used for RT-PCR, sequencing, cDNA cloning, rapid amplification of cDNA ends (RACE), and sequence analysis were previously described (2,3). The genome of NV-B is 18,252 nt in length, 6 nt longer than NV-Malaysia (NV-M), the prototype strain of NV (SPB199901924). The additional 6 nt map to the 5' nontranslated region of the fusion protein (F) gene. The length of the NV-B genome is evenly divisible DIVISIBLE. The susceptibility of being divided. 2. A contract cannot, in general, be divided in such a manner that an action may be brought, or a right accrue, on a part of it. 2 Penna. R. 454. by 6, suggesting that NV-B follows the "rule of six" (3). The gene order and sizes of all the ORFs except V are conserved between NV-B and NV-M (Table, Figure, A). The overall nucleotide homology homology (hōmŏl`əjē), in biology, the correspondence between structures of different species that is attributable to their evolutionary descent from a common ancestor. between the genomes of NV-B and NV-M is 91.8%, but the changes are not uniformly distributed throughout the genome. Nucleotide homologies are higher in the protein coding regions than in the noncoding regions, although the sizes of the nontranslated regions remain highly conserved (Table). The predicted amino acid amino acid (əmē`nō), any one of a class of simple organic compounds containing carbon, hydrogen, oxygen, nitrogen, and in certain cases sulfur. These compounds are the building blocks of proteins. homologies between the proteins expressed by NV-M and NV-B are all >92% (Table). [FIGURE OMITTED] Overall, the predicted amino acid homologies of the surface glycoproteins, F and G, of NV-B and NV-M are high (Table). In the F protein, the predicted cleavage site cleavage site n. See restriction site. , F1 amino-terminal domain, transmembrane domain, and predicted N-glycosylation sites are identical in NV-B and NV-M (2). Four of the 9 predicted amino acid changes occur in the first 11 amino acids (aa) of the precursor of the F protein, F0, which fall within the predicted signal peptide and would be cleaved cleaved (klevd) split or separated, as by cutting. from the mature protein. Within the G proteins, the predicted transmembrane domains, and the positions of all 17 cysteine cysteine (sĭs`tēn), organic compound, one of the 20 amino acids commonly found in animal proteins. Only the l-stereoisomer participates in the biosynthesis of mammalian protein. residues are conserved between NV-B and NV-M. Of 8 predicted N-linked glycosylation sites in the G protein of NV-M, 6 are conserved in NV-B and in HV (2). The coding strategy of the P gene is identical in NV-B and NV-M. In these viruses, the P gene contains the C, V, and W ORFs in addition to the P ORF. Like most other paramyxoviruses, the henipaviruses have a conserved AG-rich region that acts as an editing site to facilitate the addition of nontemplated G residues into the transcripts of the P gene. The edited transcripts encode 2 proteins, V and W, which are co-amino-terminal with P but have unique carboxy termini (2). The addition of 1 G residue generates the mRNA for the V protein, and the addition of 2 G residues produces the mRNA for the W protein. Sequence analysis of multiple cDNA clones containing the editing site of NVB NVB Nederlandse Vereniging van Banken (Dutch Bankers Association) NVB Night Vision Binoculars NVB Nordhorner Versorgungsbetriebe GmbH NVB Nederlandse Vereniging voor Beroepsbeoefenaren NVB Nederlandse Vereniging van Bioscoopexploitanten identified edited transcripts that encoded both the V and W proteins (data not shown). The conserved 20-nt region encompassing the editing site is identical in NV-M, HV, and measles virus measles virus n. An RNA virus of the genus Morbillivirus that causes measles in humans. Also called rubeola virus. (MV) (2); however, the editing of site of NV-M (UGGGUAAUUUUUCCCGUGUC) differs from NV-B (GGGAUAAUUUUUCCCGUGUC) at 2 nt positions (underlined). The functional significance of these 2 substitutions is under investigation. All of the cysteine residues are conserved in the V proteins of NV-B and NVM (Non-Volatile RAM) See NVRAM. ; however, the unique portion of the V protein of NV-B is predicted to be 55 aa, 3 aa longer than the V protein of NV-M. The predicted W protein of NV-B is identical in size and sequence to the W protein of NV-M. Recently, aa 100-160 and 230-237 of the V protein of NV-M have been identified as necessary for inhibition of interferon signaling (14). These regions are highly conserved in the V protein of NV-B, which has 4 predicted amino acids substitutions (1 conservative)between positions 100-160 and no predicted substitutions between positions 230-237. In addition, the V protein of NV-B has 3 predicted amino acid substitutions in the CRMl-dependent nuclear export signal A nuclear export signal (NES) is a short amino acid sequence of 5-6 hydrophobic residues in a protein that targets it for export from the cell nucleus to the cytoplasm through the nuclear pore complex. that was identified between aa 174-193 in the V protein of NV-M (14). The biologic effects of these amino acid substitutions are under investigation. The L proteins of NV-B and NV-M had a high level of predicted amino acid conservation (Table). The 6 highly conserved domains of viral polymerases, originally described by Poch et al. (15) and delineated for NV-M by Harcourt et al (3), remain largely unchanged between NV-B and NV-M. Domains 1, 2, and 5 have 1 conservative amino acid change each and domain 3, which is considered the most conserved domain within the L proteins of paramyxoviruses, has 2 aa changes. The 4 motifs identified in domain 3, including the QGDNE motif, which is assumed to be the active site of the polymerase, are identical between the NV-B and NV-M, as is the predicted nucleotide-binding motif in domain 6. The cis-acting control sequences are highly conserved in the genomes of NV-B and NV-M. As in NV-M, the intergenic sequences in NV-B are GAA GAA Goals Against Average (Hockey) GAA Gaelic Athletic Association GAA Gravure Association of America (Rochester, NY) GAA German Agro Action GAA Global Aquaculture Alliance GAA Gay Activists Alliance , with the exception of the sequence between the G and L genes, UAA UAA ochre codon, one of the three stop codons. , which is unique among the henipaviruses. However, the intergenic sequence between the G and L genes is GAA in the second isolate from Bangladesh. The transcriptional start and stop signals of each gene of NV-B are highly conserved in relation to the other henipaviruses. The 3' leader sequence of NV-B is identical in length to those of all other paramyxoviruses and has nucleotide changes at positions 14 and 47 compared to NV-M. The 5' trailer of NV-B is identical in length and sequence to NV-M. Phylogenetic phy·lo·ge·net·ic adj. 1. Of or relating to phylogeny or phylogenetics. 2. Relating to or based on evolutionary development or history. analysis was used to compare the sequence of the N ORF of NV-B to the sequences of the N ORFs from other members of the subfamily subfamily /sub·fam·i·ly/ (sub´fam-i-le) a taxonomic division between a family and a tribe. sub·fam·i·ly n. A taxonomic category ranking between a family and a genus. Paramyxovirinae. The results confirmed the results of the sequence comparisons, which show that NV-B is most closely related to the henipavirus NV-M, and support the conclusion that NV-B should be regarded as new strain of NV (Figure, B). Phylogenetic analyses conducted with the sequences of the other genes produced similar results (data not shown). The sequences of the N ORFs of 4 NV isolates from Bangladesh share 99.1% nt homology (Figure, C) but exhibited more interstrain nucleotide heterogeneity than the sequences of the human isolates in Malaysia, which were nearly identical (1,8,13). These varying amounts of genetic variability may reflect differences in the mode of transmission of NV in the 2 countries. In Malaysia, molecular evidence suggests that at least 2 introductions of NV into pigs occurred (Figure, C). However, the nearly identical sequences of human and pig isolates from the later phase of the outbreak suggest that only 1 of the variants spread rapidly in pigs and was associated with most human cases (13). In contrast, the sequence heterogeneity observed in Bangladesh may be the result of multiple introductions of NV into humans from different colonies of fruit bats. Conclusions This first look at strain variation in NV indicates that viruses circulating in different areas have unique genetic signatures and suggests that these strains may have coevolved within the local natural reservoirs. Until 2004, identification of NV outbreaks in Bangladesh had been based only on serologic testing. The isolation and genetic characterization of NV-B confirm that NV was the etiologic agent responsible for these outbreaks. Note: After this article was accepted for publication, Nipah virus was isolated from Pteropus lylei in Cambodia (16). Phylogenetic analysis of the N gene sequences demonstrated that this virus is more closely related to Nipah-Malaysia than to Nipah-Bangladesh and represented another lineage of Nipah virus. References (1.) Chua KB, Bellini WJ, Rota PA, Harcourt BH, Tamin A, Lam SK, et al. Nipah virus: a recently emergent deadly paramyxovirus Paramyxovirus A subgroup of myxoviruses that includes the viruses of mumps, measles, parainfluenza, respiratory syncytial (RS) disease, and Newcastle disease. . Science. 2000;288:1432-5. (2.) Harcourt BH, Tamin A, Ksiazek TG, Rollin PE, Anderson LJ, Bellini WJ, et al. Molecular characterization of Nipah virus, a newly emergent paramyxovirus. Virology virology, study of viruses and their role in disease. Many viruses, such as animal RNA viruses and viruses that infect bacteria, or bacteriophages, have become useful laboratory tools in genetic studies and in work on the cellular metabolic control of gene expression . 2000;271:334-49. (3.) Harcourt BH, Tamin A, Halpin K, Ksiazek TG, Rollin PE, Bellini WJ, et al. Molecular characterization of the polymerase gene and genomic termini of Nipah virus. Virology. 2001;287:192-201. (4.) Wang LF, Harcourt BH, Yu M, Tamin A, Rota PA, Bellini WJ, et al. Molecular biology molecular biology, scientific study of the molecular basis of life processes, including cellular respiration, excretion, and reproduction. The term molecular biology was coined in 1938 by Warren Weaver, then director of the natural sciences program at the Rockefeller of Hendra and Nipah viruses. Microbes Infect. 2001;3:279-87. (5.) Chua KB, Lam SK, Goh KJ, Hooi PS, Ksiazek TG, Kamarulzaman A, et al. The presence of Nipah virus in respiratory secretions and urine of patients during an outbreak of Nipah virus encephalitis in Malaysia. J Infect. 2001;42:40-3. (6.) Mounts AW, Kaur H, Parashar UD, Ksiazek TG, Cannon D, Arokiasamy JT, et al. Nipah Virus Nosocomial nosocomial /noso·co·mi·al/ (nos?o-ko´me-il) pertaining to or originating in a hospital. nos·o·co·mi·al adj. 1. Of or relating to a hospital. 2. Study Group. A cohort study of health care workers to assess nosocomial transmissibility trans·mis·si·ble adj. That can be transmitted: transmissible signals. trans·mis of Nipah virus. J Infect Dis. 2001;183:810-3. (7.) Yob JM, Field H, Rashdi AM, Morrissy C, van der Heide B, Rota P, et al. Nipah virus infection in bats (order Chiroptera) in peninsular Malaysia. Emerg Infect Dis. 2001;7:439-41. (8.) Chua KB, Koh CL, Hooi PS, Wee KF, Khong JH, Chua BH, et al. Isolation of Nipah virus from Malaysian island flying-foxes. Microbes Infect. 2002;4:145-51. (9.) ICDDRB ICDDRB International Centre for Diarrhoeal Diseases Research Bangladesh . Nipah encephalitis outbreak over wide area of western Bangladesh. Health Science Bulletin. 2004;2:7-11. (10.) ICDDRB. Person-to-person transmission of Nipah virus during outbreak in Faridpur District. Health Science Bulletin. 2004;2:5-9. (11.) World Health Organization. Nipah virus outbreak(s) in Bangladesh, January-April 2004. Wkly Epidemiol Rec. 2004;79:168-71. (12.) Hsu VP, Hossain MJ, Parashar UD, Ali MM, Ksiazek TG, Kuzmin I, et al. Nipah virus encephalitis reemergence, Bangladesh. Emerg Infect Dis. 2004;10:2082-7. (13.) AbuBakar S, Chang LY, Ali AR, Sharifah SH, Yusoff K, Zamrod Z. Isolation and molecular identification of Nipah virus from pigs. Emerg Infect Dis. 2004;10:2228-30. (14.) Rodriguez JJ, Cruz CD, Horvath CM. Identification of the nuclear export signal and STAT-binding domains of the Nipah virus V protein reveals mechanisms underlying interferon evasion. J Virol. 2004;78:5358-67. (15.) Poch O, Blumberg BM, Bougueleret L, Tordo N. Sequence comparison of five polymerases (L proteins) of unsegmented negative-strand RNA viruses RNA viruses, n See viruses. : theoretical assignment of functional domains. J Gen Virol. 1990;71:1153-62. (16.) Reynes JM, Counor D, Ong S, Faure C, Seng V, Molia S, et al. Nipah virus in Lyle's Flying Foxes, Cambodia. Emerg Infect Dis. 2005:11;1042-1047. Brian H. Harcourt, * Luis Lowe, * Azaibi Tamin, * Xin Liu, * Bettina Bankamp, * Nadine Bowden, * Pierre E. Rollin, * James A. Comer, * Thomas G. Ksiazek, * Mohammed Jahangir Hossain, ([dagger]) Emily S. Gurley, ([dagger]) Robert F. Breiman, * ([dagger]) William J. Bellini, * and Paul A. Rota * * Centers for Disease Control and Prevention, Atlanta, Georgia, USA; and ([dagger]) CDDR CDDR Customary Drinking and Drug Use Record CDDR Cable-Direct-Driven Robot CDDR Cost and Delivery Data Report CDDR Comprehensive Directory of Disability Resources CDDR Contract Data Description Report CDDR Coordinated Design Data Required ,B: Centre for Health and Population Research, Dhaka, Bangladesh Dr Harcourt is a research associate in the Division of Viral and Rickettsial Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention. His research interests include viral pathogenesis and emerging viral diseases. Address for correspondence: Paul A. Rota, Centers for Disease Control and Prevention, Mailstop C22, 1600 Clifton Rd, Atlanta, GA 30333, USA; fax: 404-639-4187; email: prota@cdc.gov
Table. Comparison of gene sequences NV-Malaysia and NV-Bangladesh *
Open reading frame
% amino acid % nucleotide
Length identity homology
Gene Virus ([dagger]) ([double dagger]) ([double dagger])
N Malay 532 98.3 94.3
Bang 532
P Malay 709 92.0 92.0
Bang 709
V Malay 52 92.5 95.7
Bang 55
W Malay 47 100 98.5
Bang 47
C Malay 166 95.2 97.6
Bang 166
M Malay 352 98.9 93.4
Bang 352
F Malay 546 98.4 93.4
Bang 546
G Malay 602 95.5 93.0
Bang 602
L Malay 2,244 98.2 93.4
Bang 2,244
5' nontranslated
% nucleotide
Length homology
Gene Virus ([section]) ([double dagger])
N Malay 57 100
Bang 57
P Malay 105 91.4
Bang 105
V Malay
Bang
W Malay
Bang
C Malay
Bang
M Malay 100 86.0
Bang 100
F Malay 284 83.1
Bang 290
G Malay 233 75.5
Bang 233
L Malay 153 82.4
Bang 153
3' nontranslated
% nucleotide
Length homology
Gene Virus ([section]) ([double dagger])
N Malay 586 90.8
Bang 586
P Malay 469 88.1
Bang 469
V Malay
Bang
W Malay
Bang
C Malay
Bang
M Malay 200 83.5
Bang 200
F Malay 412 79.4
Bang 412
G Malay 504 80.8
Bang 504
L Malay 67 80.6
Bang 67
* NV, Nipah virus.
([dagger]) Length in amino acids.
([double dagger]) Percentage amino acid identity or nucleotide
homology after sequences were aligned by using GAP from GCG.
([section]) Length in nucleotides. NV-Malaysia gene lengths and 5'
and 3' nontranslated sequences and gene lengths were obtained from
GenBank accession no. AF212302. The percentage amino acid identity
does not take into consideration conserved amino acid changes.
|
|
||||||||||||||||||
Printer friendly
Cite/link
Email
Feedback
Reader Opinion