Printer Friendly
The Free Library
14,557,847 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Genetic background of Escherichia coli and extended-spectrum [beta]-lactamase type.


To assess the implication of the genetic background of Escherichia coli Escherichia coli (ĕsh'ərĭk`ēə kō`lī), common bacterium that normally inhabits the intestinal tracts of humans and animals, but can cause infection in other parts of the body, especially the urinary tract.  strains in the emergence of extended-spectrum [beta]-lactamases (ESBL ESBL Extended Spectrum Beta Lactamase
ESBL East Staffordshire Badminton League (UK) 
), 55 TEM-, 52 CTX-M-, and 22 SHV-type ESBL-producing clinical isolates involved in various extraintestinal infections or colonization colonization, extension of political and economic control over an area by a state whose nationals have occupied the area and usually possess organizational or technological superiority over the native population.  were studied in terms of phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 group, virulence factor Virulence factors are molecules produced by a pathogen that specifically influence their host's function to allow the pathogen to thrive. Factors that are used in general life processes, such as metabolism or bacterial cell structural components, may be vital to the pathogen's  (VF) content (pap, sfa/foc, hly, and aer genes), and fluoroquinolone fluoroquinolone /flu·o·ro·quin·o·lone/ (-kwin´o-lon) any of a subgroup of fluorine-substituted quinolones, having a broader spectrum of activity than nalidixic acid.

fluor·o·quin·o·lone
n.
 resistance. A factorial factorial

For any whole number, the product of all the counting numbers up to and including itself. It is indicated with an exclamation point: 4! (read “four factorial”) is 1 × 2 × 3 × 4 = 24.
 analysis of correspondence showed that SHV SHV Shareholder Value
SHV Standard High Volume
SHV Sheave
SHV Steenkolen Handels Vereeniging
SHV Shreveport, LA, USA - Regional Airport (Airport Code)
SHV Sport Horse Versatility
SHV Supersonic/Hypersonic Vehicle
SHV Super Hybrid Vehicle
 type, and to a lesser extent TEM TEM

1. transmission electron microscope.

2. triethylenemelamine.

3. transmissible encephalopathy of mink.
 type, were preferentially observed in B2 phylogenetic group strains that exhibited numerous VFs but were fluoroquinolone-susceptible, whereas the newly emerged CTX-M type was associated with the D phytogenetic group strains that lacked VF but were fluoroquinolone-resistant. Thus, the emergence of ESBL-producing E. coli E. coli: see Escherichia coli.
E. coli
 in full Escherichia coli

Species of bacterium that inhabits the stomach and intestines. E. coli can be transmitted by water, milk, food, or flies and other insects.
 seems to be the result of complex interactions between the type of ESBL, genetic background of the strain, and selective pressures in ecologic niches.

**********

Extended-spectrum [beta]-1actamases (ESBL) that mediate resistance to oxyimino-cephalosporins, such as cefotaxime, aztreonam, and ceftazidime, are now observed worldwide in all species of Enterobacteriaceae (1). Traditionally, ESBLs are derived by point mutation point mutation
n.
A mutation that involves a single nucleotide and may consist of loss of a nucleotide, substitution of one nucleotide for another, or the insertion of an additional nucleotide.
 from the common TEM and SHV-1 [beta]-lactamases. However, recently, new families of ESBLs have been described (2). The CTX-M-type ESBLs have become particularly widespread and are mainly found in strains of Salmonella and Escherichia coli (3,4). These enzymes These Enzymes is an American hardcore/punk band featuring members of the All-American Rejects and Sons of Abraham. Biography
These Enzymes was formed in late 2003 by All-American Rejects members Mike Kennerty (guitar) and Chris Gaylor (drums) along with former Sons of
 probably evolved from chromosomal [beta]-lactamases of Kluyvera spp. by gene transposition transposition /trans·po·si·tion/ (trans?po-zish´un)
1. displacement of a viscus to the opposite side.

2.
 from mobile elements and mutation (5,6). ESBLs are usually described as acquired [beta]-lactamases that are encoded mainly by genes located on plasmids. Some ESBL-encoding genes are located within transposons Transposons

Types of transposable elements which comprise large discrete segments of deoxyribonucleic acid (DNA) capable of moving from one chromosome site to a new location.
 or integrons, which facilitates transfer between organisms. ESBL-producing organisms are responsible for nosocomial infections Nosocomial infections
Infections that were not present before the patient came to a hospital, but were acquired by a patient while in the hospital.

Mentioned in: Enterobacterial Infections, Staphylococcal Infections
, and many hospitals have experienced outbreaks (1,2,7). The lower digestive tract digestive tract
n.
See alimentary canal.


Digestive tract
The organs that perform digestion, or changing of food into a form that can be absorbed by the body.
 of colonized Colonized
This occurs when a microorganism is found on or in a person without causing a disease.

Mentioned in: Isolation
 patients has been recognized as the major source of ESBL-producing organism (2,8). These organisms pose a therapeutic challenge, since they are frequently resistant to other kinds of antimicrobial antimicrobial /an·ti·mi·cro·bi·al/ (-mi-kro´be-al)
1. killing microorganisms or suppressing their multiplication or growth.

2. an agent with such effects.
 drugs, including aminoglycosides, quinolones, and cotrimoxazole (2).

E. coli in humans is a commensal commensal /com·men·sal/ (kom-men´sil)
1. living on or within another organism, and deriving benefit without harming or benefiting the host.

2. a parasite that causes no harm to the host.
 inhabitant INHABITANT. One who has his domicil in a place is an inhabitant of that place; one who has an actual fixed residence in a place.
     2. A mere intention to remove to a place will not make a man an inhabitant of such place, although as a sign of such intention he
 of the gastrointestinal tract gastrointestinal tract
n.
The part of the digestive system consisting of the stomach, small intestine, and large intestine.


Gastrointestinal tract 
. It can also cause various intestinal and extraintestinal diseases (9). Strains causing infections harbor numerous virulence factors encoded on plasmids, bacteriophages, or the bacterial chromosome within pathogenicity islands (9). Several studies have shown that pathogenic E. coli strains may be derived from commensal strains by acquiring chromosomal or extrachromosomal extrachromosomal /ex·tra·chro·mo·so·mal/ (-kro?mo-som´al) outside or not involving the chromosome; as in mitochondrial inheritance, which involves only mitochondrial DNA.  virulence operons (10,11). Phylogenetic analyses have shown that E. coli strains fall into 4 main phylogenetic groups (A, B1, B2, and D) (12,13). Although virulence determinants are considered to be mobile, a link between strain phylogeny and virulence has been reported. Virulent extraintestinal strains belong mainly to group B2 and, to a lesser extent, to group D, whereas most commensal strains belong to groups A and B1. Strains of phylogenetic groups B2 and D often carry virulence determinants that are lacking in group A and B1 strains (10,14-17). In addition, a trade-off between resistance and virulence has been observed. Prevalence of antimicrobial resistance was shown to be greater in non-B2 phylogenetic group strains (18). In urinary tract infections urinary tract infection (UTI),
n infection in one or more of the structures that make up the urinary system. Occurs more often in women and is most commonly caused by bacteria.
, fluoroquinolone-resistant E. coli represented predominantly low-virulence phylogenetic groups A and B1 (19). These resistant strains were also associated with a decrease in the presence or the expression of some virulence factors and a decreased invasive capacity (20,21).

The intrinsic virulence potential of ESBL-producing E. coli is unknown. They may represent traditional virulence clones of extraintestinal pathogenic E. coli (ExPEC) or low-virulence opportunists whose ability to cause disease is largely limited to compromised hosts, in which antimicrobial resistance might provide relevant selective advantage. To assess the relationships between the genetic background of the strains and the presence of an ESBL, we analyzed a collection of ESBL-producing E. coli clinical isolates involved in various extraintestinal infections or in colonization in terms of phylogenetic grouping, virulence determinant content, and fluoroquinolone resistance.

Material and Methods

Bacterial Strains

We collected 157 E. coli isolates from clinical samples on the basis of their positive double-disk synergy test from 1997 to 2002 in different areas in France: Paris area (4 hospitals), Brest, and Amiens. From these isolates 129 strains were analyzed on the basis of 3 criteria: 1) the strains produced an ESBL, 2) the strains were epidemiologically unrelated, and 3) the strains were unambiguously classified as responsible for infection or colonization. ESBLs were characterized by isoelectric focusing isoelectric focusing,
n the ordering and concentration of substances according to their isoelectric points.
 with ceftriaxone ceftriaxone /cef·tri·ax·one/ (cef?tri-ak´son) a semisynthetic, ß–resistant, third-generation cephalosporin effective against a wide range of gram-positive and gram-negative bacteria, used as the sodium salt.  and penicillin as substrates (7), specific polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) amplification, and direct sequencing of PCR products. The oligonucleotide primer sets specific for the [beta]-1actamase gene (bla) amplification and sequencing were taken from the literature ([bla.sub.TEM] and [bla.sub.SHV]) (22) or designed in this study ([bla.sub.CTX-M]) (Table 1). As the family of CTX-M ESBLs belongs to 4 clusters on the basis of their protein sequences, the CTX-M-1 cluster (CTX-M-1, CTX-M-3, CTX-M-10, CTX-M-12, CTX-M-15), the CTX-M-2 cluster (CTX-M-2, CTX-M-4 to CTX-M-7, Toho-1), the CTXM-9 cluster (CTX-M-9, CTX-M-14, CTX-M-16, CTX-M-18, CTX-M-19, Toho-2), and the CTX-M-8 cluster, specific primers for each cluster of the CTX-M family were designed. PCR products of [bla.sub.TEM] were subjected to direct sequencing to identify TEM-ESBLs, only when isolates produced a single [beta]-lactamase indicated by isoelectric focusing. For isolates carrying a second [beta]-1actamase of pI 5.4 or 5.6 shown by penicillin only (putative TEM-1 or TEM-2 [beta]-1actamase), sequences were obtained after plasmid transfer into E. coli K-12 J53-2 [rif.sup.r] (23). PCR product sequences were then compared to reported ESBL sequences and assigned to specific types or clusters. To identify any epidemiologic relationship between the strains, they were compared by using enterobacterial repetitive intergenic consensus (ERIC)-PCR with ERIC1 and ERIC2 as primers (24,25). When strains had identical electrophoretic profiles with both ERIC1 and ERIC2 primers, they were considered identical, and only 1 isolate per electrophoretic profile type was selected for further analysis. Among the collection of 129 strains selected for the study, 86 strains were involved in infections (urinary tract infection [UTI UTI urinary tract infection.

UTI
abbr.
urinary tract infection



UTI

urinary tract infection.

UTI Urinary tract infection, see there
]: 64, bacteriemia: 7, pus pus, thick white or yellowish fluid that forms in areas of infection such as wounds and abscesses. It is constituted of decomposed body tissue, bacteria (or other micro-organisms that cause the infection), and certain white blood cells.  production from miscellaneous infections: 15), and 43 strains were isolated from colonization (rectal samples: 39, gastric aspirate as·pi·rate
v.
To take in or remove by aspiration.

n.
A substance removed by aspiration.


Aspirate
The removal by suction of a fluid from a body cavity using a needle.
: 1, abdominal drainage: 1, vaginal sample: 1, tracheal tracheal

pertaining to or emanating from trachea.


tracheal aspiration
see transtracheal aspiration.

tracheal band sign
on contrast radiography of a dilated esophagus, the impression made ventrally by the trachea.
 aspirate: 1) (Table 2). The collection included 55 strains that produced a TEM-type ESBL, 22 strains produced a SHV-type ESBL, and 52 strains produced a CTX-M type ESBL (Table 2).

Susceptibility Testing, Phylogenetic Grouping, and Virulence Factors

Susceptibility to ciprofloxacin ciprofloxacin /cip·ro·flox·a·cin/ (sip?ro-flok´sah-sin) a synthetic antibacterial effective against many gram-positive and gram-negative bacteria; used as the hydrochloride salt.

cip·ro·flox·a·cin
n.
 was tested by the disk diffusion technique according to according to
prep.
1. As stated or indicated by; on the authority of: according to historians.

2. In keeping with: according to instructions.

3.
 the guidelines of the Antibiogram Committee of the French Society for Microbiology (www.sfm.asso.fr) with MIC criteria of [less than or equal to] 1 mg/L (diameter [greater than or equal to] 22 mm) used to define susceptibility. Phylogenetic grouping of the E. coli isolates was determined by a PCR-based method developed by Clermont et al. (26) that uses a combination of 3 DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 markers (chuA, yjaA, and an anonymous DNA fragment, TspE4.C2). Strains were assigned to phylogenetic groups on the basis of presence or absence of the 3 DNA fragments: chuA-, TspE4.C2-, group A; chuA-, yjaA-, Tspe4.C2+, group B1; chuA+, yjaA+, group B2; chuA+, yjaA-, group D. Because 2 possible profiles can be obtained for the groups A, B2, and D, each was subdivided as follows: chuA-, yjaA-, Tspe4.C2-, group A subgroup [A.sub.0]; chuA-, yjaA+, Tspe4.C2-, group A subgroup [A.sub.1]; chuA+, yjaA+, Tspe4.C2-, group B2 subgroup [B2.sub.2]; chuA+, yjaA+, Tspe4.C2+, group B2 subgroup [B2.sub.3]; chuA+, yjaA-, Tspe4.C2-, group D subgroup [D.sub.1]; chuA+, yjaA-, Tspe4.C2+, group D subgroup [D.sub.2]. Virulence genes (pap, sfa/foc, hly, aer) were detected from DNA by PCR as described previously (15,27). These genes code for 2 adhesins (pyelonephritis-associated pill system and S fimbrial fimbrial

pertaining to or emanating from fimbriae.


fimbrial cysts
cysts in the region of the ovulation fossa; appear to cause no impediment to fertility except in very old mares where they may obstruct ovulation.
 adhesin), 1 toxin ([alpha]-hemolysin), and 1 iron captation system. These genes are good representatives of the intrinsic extraintestinal virulence of the strains (28).

Statistical Analysis

Data were summarized in 2 two-way tables, and each table had 129 rows, one for each E. coli strain. The first table had 16 columns corresponding to the variables, origin of the strains, phylogenetic group or subgroup, type of ESBL, and virulence factors. The second table had 12 columns corresponding to the variables, phylogenetic groups, type of ESBL, and resistance to ciprofloxacin. For each column, each strain was coded as a binary code binary code

Code used in digital computers, based on a binary number system in which there are only two possible states, off and on, usually symbolized by 0 and 1. Whereas in a decimal system, which employs 10 digits, each digit position represents a power of 10 (100, 1,000,
: present = 2, absent = 1. A factorial analysis of correspondence (FAC FAC - Functional Array Calculator. An APL-like language, but purely functional and lazy. It allows infinite arrays.

["FAC: A Functional APL Language", H.-C. Tu and A.J. Perlis, IEEE Trans Soft Eng 3(1):36-45 (Jan 1986)].
) (29) was conducted from this table with SPAD.N software (Cisia, Saint Mande, France). To confirm the significance of the correlation observed with FAC, [chi square chi square (kī),
n a nonparametric statistic used with discrete data in the form of frequency count (nominal data) or percentages or proportions that can be reduced to frequencies.
] tests were carried out.

Results

Characterization of ESBL Strains

Among the 129 E. coli strains analyzed, phylogenetic group B2, which is the source of most ExPEC clones, was represented by 36.4 % of the strains (8.5% were subgroup [B2.sub.2] and 27.9% were subgroup [B2.sub.3]). Phylogenetic group D, which is also a source of ExPEC but to a lesser extent, was represented by 25.5% of the strains (17% were subgroup [D.sub.1] and 8.5% were subgroup [D.sub.2]). Of the remaining strains, phylogenetic groups A and B1 were represented by 27.9% (9.3% were subgroup [A.sub.0] and 18.6% were subgroup [A.sub.1]) and 10% of the strains, respectively. The virulence determinants most represented in the collection were aer and pap, with 53 (41%) and 38 (29.5%) strains carrying these genes, respectively. Less prevalent were sfa/foc and hly determinants, with only 18 (14%) and 19 (15%) positive strains, respectively. Fluoroquinolone resistance was present in 34.8% of the strains.

ESBL-producing strains were found in all E. coli phylogenetic groups. Of the strains, 60% and 24% harbored at least 1 or 2 extraintestinal virulence determinants, respectively. Coresistance to fluoroquinolones was frequent.

Multidimensional Analysis In statistics, econometrics, and related fields, multidimensional analysis is a data analysis process that groups data into two basic categories: data dimensions and measurements.

To assess relationships between phylogenetic groups, VFs, type of ESBL produced, and origin of the strains (infection or colonization), a FAC was constructed with the 129 E. coli strains as individuals and the 16 characteristics as qualitative variables. Projections of the variables on the plane Fl/F2 (Figure A), which accounted for 34.5% of the total variance, showed a correlation between the type of ESBL produced and several phylogenetic group/subgroups of E. coli. Thus, SHV type and subgroup [B2.sub.3] are projected on the positive values of F1 and negative values of F2, whereas TEM type and subgroup [B2.sub.2] are projected on the positive values of F1 and F2. CTX-M type and subgroup [D.sub.2] are projected on the negative values of F1 and F2. Correlation between SHV type and subgroup [B2.sub.3] was confirmed by [chi square] tests (p < 0.001) and the CTX-M type and the subgroup [D.sub.2] (p < 0.001) (Table 3).

As previously reported, sfa/foc and hly VFs were exclusively found in strains of the subgroups [B2.sub.2] and [B2.sub.3] (10,16). Pairwise comparisons between individual subgroups showed that subgroups [B2.sub.2] and [B2.sub.3] each had mean VF scores (1.45 and 1.8, respectively) significantly higher than either phylogenetic groups and subgroups [A.sub.0], [A.sub.1], B1, [D.sub.1], or [D.sub.2] (p < 0.02 for all comparisons), but they were not significantly different from one another. Likewise phylogenetic groups and subgroups [A.sub.0], [A.sub.1], B1, [D.sub.1], and [D.sub.2] were not significantly different from one another with respect to mean VF scores (mean scores 0.5, 0.66, 0.54, 0.5, and 0.63, respectively). When the type of ESBL produced was considered, the frequency of VFs was higher in SHV-producing strains (mean score = 1.8) than in TEM-producing strains (mean score = 0.96). The lowest frequency was found in the CTX-M-producing strains (mean score = 0.6). FAC stressed these 2 observations, as it showed that the pap, sfa/foc, and hly VFs were projected on the positive values of the first axis with the subgroup [B2.sub.3] and the SHV type. The correlation between SHV type and the presence of the 3 VFs was also confirmed by [chi square] tests (pap, p < 0.01; sfa/foc, p < 0.001; hly, p < 0.001). Aerobactin was found in all the phylogenetic groups and subgroups, and no correlation was observed with the FAC (Table 4).

Projection of the colonization and infection variables on the plane showed that they were clearly distinguished by the first factor and that there was a correlation with some phylogenetic groups (Figure A). The colonization characteristic was projected on the positive values of F1 with phylogenetic subgroups [A.sub.0] and [D.sub.1]. The association was close to significance ([A.sub.0], p = 0.05; [D.sub.1], p = 0.06): strains of subgroups [A.sub.0] and [D.sub.1] were isolated more frequently from colonization (relative risk [RR] of 3.15 and 2.34, respectively) (Table 3). If we consider the clones usually to be the major source of ExPEC, strains of the subgroup [B2.sub.2] were equally distributed among the strains responsible for infection or colonization (8.1% versus 9.3%), but strains of subgroup [B2.sub.3] were more numerous among the strains responsible for infection than for colonization (32.5% versus 18.6%); the correlation was close to significance (p = 0.09, RR = 2.11) (Table 3). TEM type was also projected on the positive values of F2 with the colonization characteristic, and the [chi square] test confirmed the correlation (p = 0.03).

The mean VF score of the strains responsible for infection was significantly higher (p = 0.03) than the mean VF score of the strains responsible for colonization (1.1 and 0.76, respectively). However, when each VF was considered, only the frequency of aerobactin was significantly higher among the strains responsible for infection (p = 0.03) than the strains responsible for colonization.

To assess the relationships between phylogenetic groups and subgroups, ESBL type, and resistance to fluoroquinolones, a second FAC was performed, taking into account only these variables (Figure B). Projection of the variables on the plane F1/F2, which accounted for 34% of the total variance, showed a correlation between resistance to ciprofloxacin and type of ESBL produced. Thus, the ciprofloxacin-resistant characteristic was projected on the negative values of the first factor with CTX-M-type, and the ciprofloxacin-susceptible characteristic was projected on the positive values of the first factor with TEM and SHV types. Significant differences were observed between the rate of resistance to fluoroquinolones among the CTXM-(51.9%) and among the SHV- and TEM-producing strains (13.6% and 27.7%, respectively): CTX-M type / SHV type, p = 0.002 and CTX-M type / TEM type, p = 0.009. FAC stressed also the correlation between the subgroup [D.sub.1] and the resistance to ciprofloxacin, which were projected together on the negative values of the first factor and on the positive values of the second factor. The correlation was confirmed by the [chi square] test (p = 0.03). Strains of phylogenetic subgroup [D.sub.1] had the highest resistance rate (54%), and strains of subgroups [B2.sub.2], [B2.sub.3], and [A.sub.0] had the lowest resistance rates (18%, 25%, and 25%, respectively). Group/subgroups B1, [D.sub.2], and [A.sub.1] had ciprofloxacin resistance rates of 30.7%, 36%, and 45%, respectively. No significant difference was seen in the frequencies of ciprofloxacin resistance among strains from infection or colonization (38.3% versus 27.9%). The mean VF score of the ciprofloxacin-susceptible strains was significantly higher (p < 0.001) than the one of the ciprofloxacin-resistant strains (1.2 and 0.6, respectively) (Table 4). We found hly and sfa/foc exclusively in ciprofloxacin-susceptible strains, and the frequency of pap was significantly higher among ciprofloxacin-susceptible strains (p = 0.04) than among ciprofloxacin-resistant strains. No difference was observed in the frequency of aerobactin between the 2 groups (Table 4). Although the frequency of CTX-M type was higher among UTI strains than among non-UTI strains (Table 2), FAC analysis and [chi square] tests did not show any significant association between UTI strains, phylogenetic group or subgroup, individual VFs, and ciprofloxacin resistance (data not shown), which could explain some of the previously observed correlations.

Therefore, strains harboring ESBL of SHV and TEM types belonged preferentially to the B2 phylogenetic group. They possessed extraintestinal VFs, but ESBL TEM-type strains were more likely to be isolated from cases of colonization; they were also susceptible to fluoroquinolones. On the other hand, strains harboring ESBL of CTX-M type were associated with [D.sub.2] phylogenetic subgroup, had few VFs, but were resistant to fluoroquinolones.

Discussion

This study was designed to assess the role of the genetic background of strains of E. coli in the emergence of ESBL. Strains were sampled from hospitals in several distant areas, which allowed us to build up a collection of strains producing variants of the most prevalent ESBL types. Thus 3 groups of ESBL-types were collected, TEM-, SHV-, and CTX-M-type, having enough strains in each group to be compared. Spread of clones of ESBL-producing organisms can occur from cross-contamination among patients (2,7,23). Therefore, to avoid redundant strains, we used ERIC-PCR as a typing method, and strains with similar profiles were eliminated.

Several studies suggested that extraintestinal pathogenic E. coli strains are mostly derived from the B2 phylogenetic group and to a lesser extend from the D group (15,16,30-34). It had been estimated in collections dating from before the emergence of ESBL, or in collections not selected for ESBL production, that group B2 strains account for approximately two thirds of all extraintestinal E. coil infections, including UTI, bacteremia bacteremia: see septicemia.
bacteremia

Presence of bacteria in the blood. Short-term bacteremia follows dental or surgical procedures, especially if local infection or very high-risk surgery releases bacteria from isolated sites.
, meningitis, and other miscellaneous infections. When all ESBL-producing E. coli strains were considered, whatever their types were, group B2 represented only 39.4% of the strains responsible for infection in our study. Thus, production of ESBL among E. coli clinical strains isolated from infection was associated with shifts in phylogenetic distribution toward non-B2 phylogenetic groups, in particular groups D and A. The distribution of group B2 among strains isolated from infection or from colonization was not very different even if it was pointed out that subgroup [B2.sub.3] strains had a tendency to be isolated more frequently in clinical infections. Johnson et al., in 1991 (18), observed that E. coli strains belonging to phylogenetic groups other than group B2 have a greater prevalence of antimicrobial resistance, such as to ampicillin ampicillin (ăm'pĭsĭl`ĭn), a penicillin-type antibiotic that is effective against both gram-negative microorganisms and gram-positive microorganisms such as Escherichia coli. , tetracycline tetracycline (tĕ'trəsī`klēn), any of a group of antibiotics produced by bacteria of the genus Streptomyces. They are effective against a wide range of Gram positive and Gram negative bacteria, interfering with protein , chloramphenicol chloramphenicol (klōr'ămfĕn`əkŏl'), antibiotic effective against a wide range of gram-negative and gram-positive bacteria (see Gram's stain). It was originally isolated from a species of Streptomyces bacteria. , streptomycin streptomycin (strĕp'tōmī`sĭn), antibiotic produced by soil bacteria of the genus Streptomyces and active against both gram-positive and gram-negative bacteria (see Gram's stain), including species resistant to other , and sulfonamide sulfonamide /sul·fon·amide/ (sul-fon´ah-mid) a compound containing the sbondSO2NH2 group. The sulfonamides, or sulfa drugs, are derivatives of sulfanilamide, competitively inhibit folic acid synthesis in microorganisms, and formerly were ; express significantly fewer virulence factors; and invade more commonly compromised hosts. ESBL-producing organisms, which are resistant to [beta]-lactams, except carbapenems and cephamycins, and are often resistant to other antimicrobial drugs, are responsible for nosocomial infections, mostly in immunocompromised immunocompromised /im·mu·no·com·pro·mised/ (-kom´pro-mizd) having the immune response attenuated by administration of immunosuppressive drugs, by irradiation, by malnutrition, or by certain disease processes (e.g., cancer).  patients. ESBL-producing organisms also frequently colonize col·o·nize  
v. col·o·nized, col·o·niz·ing, col·o·niz·es

v.tr.
1. To form or establish a colony or colonies in.

2. To migrate to and settle in; occupy as a colony.

3.
 the lower digestive tract, and therefore are a major source for ESBL propagation (8). This finding may explain why two thirds of the strains in our study were not traditional virulence clones of ExPEC but clones whose ability to cause infection is limited to compromised hosts, in whom antibiotic resistance antibiotic resistance,
n the ability of certain strains of microorganisms to develop resistance to antibiotics.

antibiotic resistance 
 might provide selective advantage.

ESBLs are acquired [beta]-lactamases that are encoded mainly by genes located on plasmids (2). As such, they are a recent evolutionary development. Even if the genetic element that carries resistance is a mobile element, the multidimentional analysis showed a preferential association between the genetic background and the type of ESBL produced by the strains. Thus, an association was seen between SHV type and subgroup [B2.sub.3], between TEM type and subgroup [B2.sub.2], and CTX-M type and subgroup [D.sub.2]. Even more, the pap, sfa/foc, and hly VFs were associated with the genotype genotype (jēn`ətīp'): see genetics.
genotype

Genetic makeup of an organism. The genotype determines the hereditary potentials and limitations of an individual.
 SHV type/subgroup [B2.sub.3], defining a potentially high-virulence group of ESBL-producing E. coli strains. In contrast, the genotype CTX-M type/subgroup [D.sub.2], characterized by a low VF score, defined a potentially low-virulence group of ESBL-producing E. coli strains. The type of ESBL produced by E. coli could be a predictive factor for intrinsic virulence potential.

Organisms that produce ESBL are frequently resistant to other antimicrobial agents Antimicrobial agents

Chemical compounds biosynthetically or synthetically produced which either destroy or usefully suppress the growth or metabolism of a variety of microscopic or submicroscopic forms of life.
, such as aminoglycosides, tetracycline, and trimethoprim-sulfamethoxazole, as many of these additional resistance genes are encoded on the ESBL-associated plasmid. Fluoroquinolone resistance, which is also frequently associated with ESBL production, is usually chromosomally encoded, unlike the other coresistances. However, plasmid-mediated quinolone resistance has been discovered recently (35). Prevalence of fluoroquinolone resistance among ESBL-producing strains varies according to geographic regions (36), from 13.7% in Canada to 65.5% in the western Pacific. In our study, 34.8% of strains were resistant, which is close to the prevalence (34.2%) reported in Europe (36). Correlation with phylogenetic background and VF profiles showed highly fluoroquinolone-resistant strains of subgroup [D.sub.1], with the lowest VF score and association with colonization. In contrast, strains of phylogenetic group B2, which had the highest VF score, were among the strains with the lowest fluoroquinolone-resistance rates. These data agree with the work of Johnson et al. (19,37) and show a clear trade-off between resistance to fluoroquinolones and virulence. In addition, our study highlights an association between these fluoroquinolone-resistant strains and CTX-M-producing strains, which are devoid of VFs. However, the search for the gene responsible for plasmid-mediated quinolone resistance, qnr, by PCR was negative in our collection of ESBL-producing strains (O. Zamfir, E. Denamur, C. Branger, unpub, data). Thus, the observed association is not due to a genetic link between resistance to expanded-spectrum [beta]-1actams and quinolones on a mobile element, as was recently reported (38).

During the last 2 decades, most of the ESBL found in E. coli and, in general, in gram-negative bacilli bacilli /ba·cil·li/ (bah-sil´i) plural of bacillus.

bacilli

see bacillus.
, has been of TEM or SHV lineage. Recently TEM and SHV types have been replaced by CTX-M-type ESBL, whose emergence and proliferation are particularly noteworthy (39). The current spread may be explained in part by the ability of some insertion sequence insertion sequence
n.
Any of several discrete DNA sequences that repeat at various sites on a bacterial chromosome, on certain plasmids, and on bacteriophages and that can move from one site to another on the chromosome, to another plasmid in the same
 elements to mobilize and promote the expression of [beta]-1actamase (40). However, the high rate of fluoroquinolone resistance and the low virulence of the strains canting cant 1  
n.
1. Angular deviation from a vertical or horizontal plane or surface; an inclination or slope.

2. A slanted or oblique surface.

3.
a. A thrust or motion that tilts something.
 CTX-M ESBL could provide them selective advantage to spread, especially under strong environmental antimicrobial pressure with fluoroquinolones.

In summary, mobile elements encoding ESBL are not randomly distributed among the genetic diversity of the E. coil species. The arrival, expression, and maintenance of such elements seem to be the result of complex interactions between the type of ESBL, the phylogenetic background, the intrinsic virulence of the strains, and the presence of associated fluoroquinolone resistance. Such complexity reflects very likely the diversity of ecologic niches with different selective pressures.
Table 1. Sequence of primers used to detect bla genes *

                      Primer                          Reference or
PCR target             name      Primer sequence      accession no.

[bla.sub.TEM]           A       ATGAGTATTCAATTCCG         (22)
                        B      CTGACAGTTACCAATGCTTA
[bla.sub.SVH]           P4     GGTTATGCGTTATATTCGCC       (22)
                        P5      TTAGCGTTGCCAGTGCTC
[bla.sub.CTX-M]        MenA    AAGACTGGGTGTGGCATTGA      X92506
  (CTX-M-1 cluster)    MenB    AGGCTGGGTGAAGTAAGTGA
[bla.sub.CTX-M]        M2A     CTGGAAGCCCTGGAGAAAAG      X92507
  (CTX-M-2 cluster)    M2B     TACCTCGCTCCATTTATTGC
[bla.sub.CTX-M]        ToA     GCTTTATGCGCAGACGAGTG     AF174129
  (CTX-M-9 cluster)    ToB     GCCAGATCACCGCAATATCA
[bla.sub.CTX-M]         A8      GCCTGTATTTCGCTGTTG      AF189721
  (CTX-M-8 cluster)     B8     TGTCATTCGTCGTACCATAA

* PCR, polymerase chain reaction.

Table 2. Distribution of ESBL types according to
strain origin *

                     No. strains isolated from

ESBL type                 Other
(no. strains)     UTI   infections   Colonization

TEM (55)
TEM-24            11        9             11
TEM-52             3        0              7
TEM-21             5        1              2
TEM-3              1        0              3
TEM-10             0        0              1
TEM-20             1        0              0
SHV (22)
SHV2               3        1              2
SHV4               1        1              1
SHV5               2        0              1
SHV12              5        4              1
CTX-M (52)
CTX-M-1 cluster   20        2              7
CTX-M-2 cluster    3        0              1
CTX-M-9 cluster    9        4              6

* ESBL, extended-spectrum [beta]-lactamase;
UTI, urinary tract infection.

Table 3. Distribution of extended-spectrum [beta]-lactamase
types among Escherichia coli strains isolated from infection
or colonization, according to phylogenetic group

                     No. strains     No. (%) of isolates producing
                       in the
Phylogenetic group    group (%)       TEM         SHV        CTX-M

Infection
  [A.sub.0]            5 (5.8)      2 (6.4)     1 (5.8)     2 (5.2)
  [A.sub.1]           18 (20.9)     11 (35)        0       7 (18.4)
  B1                  9 (10.4)      2 (6.4)    3 (17.6)    4 (10.5)
  [B2.sub.2]           7 (8.1)      5 (16)      1 (5.8)     1 (2.6)
  [B2.sub.3]          28 (32.5)    8 (25.8)    10 (58.8)   10 (26.3)
  [D.sub.1]           11 (12.7)     3 (9.6)    2 (11.7)    6 (15.7)
  [D.sub.2]            8 (9.3)         0           0        8 (21)
  All groups          86 (100)     31 (100)    17 (100)    38 (100)

Colonization
  [A.sub.0]           7 (16.2)     5 (20.8)        0       2 (14.2)
  [A.sub.1]           6 (13.9)      2 (8.3)        0        4 (28)
  B1                   4 (9.3)     3 (12.5)        0        1 (7.1)
  [B2.sub.2]           4 (9.3)      2 (8.3)     1 (20)      1 (7.1)
  [B2.sub.3]          8 (18.6)     5 (20.8)     3 (60)         0
  [D.sub.1]           11 (25.5)     6 (25)      1 (20)     4 (28.4)
  [D.sub.2]            3 (6.9)      1 (4.1)        0       2 (14.1)
  All groups          43 (100)     24 (100)     5 (100)    14 (100)

All strains
  [A.sub.0]           12 (9.3)     7 (12.7)     1 (4.5)     4 (7.6)
  [A.sub.1]           24 (18.6)    13 (23.6)       0       11 (21.1)
  B1                   13 (10)       5 (9)     3 (13.6)     5 (9.6)
  [B2.sub.2]          11 (8.5)     7 (12.7)      2 (9)      2 (3.8)
  [B2.sub.3]          36 (27.9)    13 (23.6)    13 (59)    10 (19.2)
  [D.sub.1]            22 (17)     9 (16.3)    3 (13.6)    10 (19.2)
  [D.sub.2]           11 (8.5)      1 (1.8)        0       10 (19.2)
  All groups          129 (100)    55 (100)    22 (100)    52 (100)

Table 4. Frequency of virulence factors among
ciprofloxacin-susceptible and ciprofloxacin-resistant
Escherichia coli strains involved in infection or colonization,
according to extended-spectrum [beta]-lactamase (ESBL) type

                                     No. (%) strains carrying

ESBL type (no. strains)        pap       sfa/foc     h/y       aer

Ciprofloxacin resistance
  TEM (15)                    4 (20)        0         0      8 (53)
  SHV (3)                       0           0         0      1 (33)
  CTX-M (27)                  2 (7)         0         0      12 (44)
  All types (45)              6 (13)        0         0      21 (46)

Ciprofloxacin sensitivity
  TEM (40)                   14 (35)     9 (22)    9 (22)    9 (22)
  SHV (19)                   13 (68)     8 (42)    9 (47)    10 (52)
  CTX-M (25)                  5 (20)      1 (4)     1 (4)    13 (52)
  All types (84)             32 (55)     18 (21)   19 (22)   32 (38)

All strains
  TEM (55)                   18 (33)     9 (16)    9 (16)    17 (31)
  SHV (22)                   13 (59)     8 (36)     9 (4)    11 (50)
  CTX-M (52)                  7 (13)      1 (2)     1 (2)    25 (48)
  All types (129)           38 (29.5)    18 (14)   19 (15)   53 (41)

                            Virulence
                              factor
ESBL type (no. strains)     mean score

Ciprofloxacin resistance
  TEM (15)                     0.8
  SHV (3)                      0.33
  CTX-M (27)                   0.51
  All types (45)               0.6

Ciprofloxacin sensitivity
  TEM (40)                      1
  SHV (19)                     2.1
  CTX-M (25)                   0.8
  All types (84)               1.2

All strains
  TEM (55)                     0.96
  SHV (22)                     1.8
  CTX-M (52)                   0.6
  All types (129)               1


Acknowledgments

We thank Paulette Berry for technical assistance, Jean Philippe Emond for providing some of the strains, Matthieu Eveillard for advice about statistical methods, and Emmanuelle Cambau for help in the detection of the qnr gene.

This work was partially supported by grant from "La Fondation pour la Recherche La Recherche is a monthly French language popular science magazine covering recent scientific news. It is published by the Société d'éditions scientifiques (the Scientific Publishing Group), a subsidiary of Financière Tallandier.  Medicale" and the INSERM INSERM Institut National de la Santé et de la Recherche Médicale (French Institute of Health and Medical Research) .

References

(1.) Bradford PA. Extended-spectrum [beta]-1actamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin Microbiol Rev. 2001;14:933-51.

(2.) Gniadkowski M. Evolution and epidemiology of extended-spectrum [beta]-lactamases (ESBLs) and ESBL-producing microorganisms. Clin Microbiol Infect. 2001;7:597-608.

(3.) Paterson DL. Extended-spectrum [beta]-lactamases: the European experience. Curr Opin Infect Dis. 2001 : 14:697-701.

(4.) Saladin M, Cao VT, Lambert T, Donay JL, Herrmann JL, Ould Hocine Z, et al. Diversity of CTX-M [beta]-1actamases and their promoter regions from Enterobacteriaceae isolated in three Parisian hospitals. FEMS FEMS Federation of European Microbiological Societies
FEMS Federation of European Materials Societies
FEMS Fabrication Engineering Management System
FEMS Facility Equipment Maintenance System (PMEL/TMDE) 
 Microbiol Lett. 2002;209:161-8.

(5.) Humeniuk C, Arlet G, Gautier V, Grimont P, Labia R, Philippon A. [beta]-lactamases of Kluyvera ascorbata, probable progenitors
This article refers to the Star Trek race, and not a Convention with the same name in the in the role-playing game.


The Progenitors were a race of fictional beings in the Star Trek Universe created by Gene Roddenberry.
 of some plasmid-encoded CTX-M types. Antimicrob Agents Chemother. 2002;46:3045-9.

(6.) Poirel L, Kampfer P, Nordmann P. Chromosome-encoded Ambler class A [beta]-1actamase of Kluyvera georgiana, a probable progenitor pro·gen·i·tor
n.
1. A direct ancestor.

2. An originator of a line of descent.



progenitor

ancestor, including parent.


progenitor cell
stem cells.
 of a subgroup of CTX-M extended-spectrum [beta]-1actamases. Antimicrob Agents Chemother. 2002:46:4038-40.

(7.) Branger C, Bruneau B, Lesimple AL, Bouvet PJ, Berry P, Sevali Garcia J, et al. Epidemiological typing of extended-spectrum [beta]-1actamase-producing Klebsiella pneumoniae Klebsiella pneu·mo·ni·ae
n.
Friedlander's bacillus.
 isolates responsible for five outbreaks in a university hospital. J Hosp Infect. 1997;36:23-36.

(8.) Lucet JC, Regnier B. Enterobacteria en·ter·o·bac·te·ri·um  
n. pl. en·ter·o·bac·te·ri·a
Any of various gram-negative rod-shaped bacteria of the family Enterobacteriaceae that includes some pathogens of plants and animals, such as the colon bacillus and salmonella.
 producing extended spectrum [beta]lactamases. Pathol Biol. 1998;46:235-43.

(9.) Donnenberg MS. Escherichia coli: virulence mechanisms of a versatile pathogen Pathogen

Any agent capable of causing disease. The term pathogen is usually restricted to living agents, which include viruses, rickettsia, bacteria, fungi, yeasts, protozoa, helminths, and certain insect larval stages.
. San Diego, California “San Diego” redirects here. For other uses, see San Diego (disambiguation).
San Diego is a coastal Southern California city located in the southwestern corner of the continental United States. As of 2006, the city has a population of 1,256,951.
: Academic Press; 2002.

(10.) Johnson JR, Delavari P, Kuskowski M, Stell AL. Phylogenetic distribution of extraintestinal virulence-associated traits in Escherichia coli. J Infect Dis. 2001;183:78-88.

(11.) Finlay BB. Falkow S. Common themes in microbial microbial

pertaining to or emanating from a microbe.


microbial digestion
the breakdown of organic material, especially feedstuffs, by microbial organisms.
 pathogenicity revisited. Microbiol Mol Biol Rev. 1997:61:136-69.

(12.) Desjardins P, Picard B. Kaltenbock B, Elion J, Denamur E. Sex in Escherichia coli does not disrupt the clonal structure of the population: evidence from random amplified polymorphic polymorphic - polymorphism  DNA and restriction-fragment-length polymorphism polymorphism, of minerals, property of crystallizing in two or more distinct forms. Calcium carbonate is dimorphous (two forms), crystallizing as calcite or aragonite. Titanium dioxide is trimorphous; its three forms are brookite, anatase (or octahedrite), and rutile. . J Mol Evol. 1995;41:440-8.

(13.) Herzer PJ, Inouye S, Inouye M, Whittam TS. Phylogenetic distribution of branched RNA-linked multicopy single-stranded DNA Multicopy single-stranded DNA (msDNA) is a type of extrachromosomal satellite DNA which consists of a single-stranded DNA molecule linked via a phosphodiester bond to a branched RNA molecule.  among natural isolates of Escherichia coli. J Bacteriol. 1990;172:6175-81.

(14.) Duriez P. Clermont O, Bonacorsi S, Bingen E, Chaventre A, Elion J, et al. Commensal Escherichia coli isolates are phylogenetically phy·lo·ge·net·ic  
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history: a phylogenetic classification of species.
 distributed among geographically distinct human populations. Microbiology. 2001;147:1671-6.

(15.) Picard B, Garcia JS, Gouriou S, Duriez P, Brahimi N, Bingen E, et al. The link between phylogeny and virulence in Escherichia coli extraintestinal infection. Infect Immun. 1999;67:546-53.

(16.) Bingen E, Picard B, Brahimi N, Mathy S, Desjardins P, Elion J, et al. Phylogenetic analysis of Escherichia coli strains causing neonatal meningitis suggests horizontal gene transfer “HGT” redirects here. For other uses, see HGT (disambiguation).
Horizontal gene transfer (HGT), also Lateral gene transfer (LGT), is any process in which an organism transfers genetic material to another cell that is not its offspring.
 from a predominant pool of highly virulent B2 group strains. J Infect Dis. 1998;177:642-50.

(17). Boyd EF, Hartl DL. Chromosomal regions specific to pathogenic isolates of Escherichia coli have a phylogenetically clustered distribution. J Bacteriol. 1998:180:1159-65.

(18.) Johnson JR, Goullet P, Picard B, Moseley SL, Roberts PL, Stamm WE. Association of carboxylesterase B electrophoretic pattern with presence and expression of urovirulence factor determinants and antimicrobial resistance among strains of Escherichia coli that cause urosepsis. Infect Immun. 1991;59:2311-5.

(19.) Johnson JR, van der Schee C, Kuskowski MA, Goessens W, van Belkum A. Phylogenetic background and virulence profiles of fluoroquinolone-resistant clinical Escherichia coli isolates from the Netherlands. J Infect Dis. 2002;186:1852-6.

(20.) Vila J. Simon K, Ruiz J, Horcajada JR Velasco M, Barranco Barranco is a district in Lima, Peru. The current mayor is Felipe Antonio Mezarina Tong and the district's postal code is 04.

It is considered to be the city's most important romantic and bohemian district.
 M, et al. Are quinolone-resistant uropathogenic Escherichia coli less virulent? J Infect Dis. 2002:186:10394-2.

(21.) Velasco M, Horcajada JP, Mensa MENSA. This comprehends all goods and necessaries for livelihood. Obsolete.  J, Moreno-Martinez A, Vila J. Martinez JA. et al. Decreased invasive capacity of quinolone-resistant Escherichia coli in patients with urinary tract infections. Clin Infect Dis. 2001:33:1682-6.

(22.) Rashced JK. Jay C, Metchock B, Berkowitz F, Weigel L, Crellin J, et al. Evolution of extended-spectrum [beta]-lactam resistance (SHV-8) in a strain of Escherichia coli during multiple episodes of bacteremia. Antimicrob Agents Chemother. 1997;41:647-53.

(23.) Galdbart JO, Lemann F, Ainouz D, Feron P, Lambert Zechovsky N, Branger C. TEM-24 extended-spectrum [beta]-1actamase-producing Enterobacter aerogenes Enterobacter aerogenes is a Gram-negative, oxidase negative, catalase positive, rod-shaped bacterium.

E. aerogenes is a nosocomial pathogen that causes opportunistic skin and tissue infections.
: long-term clonal dissemination in French hospitals. Clin Microbiol Infect. 2000:6:316-23.

(24.) Struelens MJ, Carlier E, Maes N, Serruys E, Quint WG, van Belkum A. Nosocomial nosocomial /noso·co·mi·al/ (nos?o-ko´me-il) pertaining to or originating in a hospital.

nos·o·co·mi·al
adj.
1. Of or relating to a hospital.

2.
 colonization and infection with multiresistant Acinetobacter baumannii Acinetobacter baumannii is a species of pathogenic bacteria which forms opportunistic infections.[1] There have been many reports of drug-resistant A. baumannii infections among American soldiers wounded in Iraq. : outbreak delineation using DNA macrorestriction analysis and PCR-fingerprinting. J Hosp Infect. 1993;25:15-32.

(25.) Versalovic J, Koeuth T, Lupski JR. Distribution of repetitive DNA sequences in eubacteria eubacteria

Term formerly used to describe and differentiate the true bacteria from the archaebacteria. Today, the true bacteria form the domain Bacteria, and the archaebacteria (also an obsolete term) form the domain Archaea.
 and application to fingerprinting of bacterial genomes. Nucleic Acids Nucleic acids
The cellular molecules DNA and RNA that act as coded instructions for the production of proteins and are copied for transmission of inherited traits.
 Res. 1991 ; 19:6823-31.

(26.) Clermont O, Bonacorsi S, Bingen E. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl Environ Microbiol. 2000;66:4555-8.

(27.) Picard B, Duriez P, Gouriou S, Matic I, Denamur E, Taddei F. Mutator A mutator may refer to:
  • In computer science:
  • A mutator method is an object method that changes the state of the object
 natural Escherichia coli isolates have an unusual virulence phenotype phenotype (fē`nətīp'): see genetics.
phenotype

All the observable characteristics of an organism, such as shape, size, colour, and behaviour, that result from the interaction of its genotype (total genetic makeup) with
. Infect Immun. 2001;69:9-14.

(28.) Johnson JR, Kuskowski M, Denamur E, Elion J, Picard B. Clonal origin, virulence factors, and virulence. Infect Immun. 2000;68:424-5.

(29.) Greenacre M. Correspondence analysis in medical research. Stat Methods Med Res. 1992;1:97-117.

(30.) Johnson JR, Stell AL. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. J infect Dis. 2000;181:261-72.

(31.) Johnson JR, O'Bryan TT, Kuskowski M, Maslow JN. Ongoing horizontal and vertical transmission of virulence genes and papA alleles among Escherichia coli blood isolates from patients with diverse-source bacteremia. Infect Immun. 2001;69:5363-74.

(32.) Bingen-Bidois M, Clermont O, Bonacorsi S, Terki M, Brahimi N, Loukil C, et al. Phylogenetic analysis and prevalence of urosepsis strains of Escherichia coli bearing pathogenicity island-like domains. Infect Immun. 2002;70:3216-26.

(33.) Bonacorsi S, Clermont O, Houdouin V, Cordevant C, Brahimi N, Marecat A, et al. Molecular analysis and experimental virulence of French and North American North American

named after North America.


North American blastomycosis
see North American blastomycosis.

North American cattle tick
see boophilusannulatus.
 Escherichia coli neonatal meningitis isolates: identification of a new virulent clone. J Infect Dis. 2003;187:1895-906.

(34.) Zhang L, Foxman B, Marrs C. Both urinary and rectal Escherichia coli isolates are dominated by strains of phylogenetic group B2. J Clin Microbiol. 2002;40:3951-5.

(35.) Martinez-Martinez L, Pascual A, Jacoby GA. Quinolone resistance from a transferable plasmid. Lancet. 1998;351:797-9.

(36.) Winokur PL, Canton R, Casellas JM, Legakis N. Variations in the prevalence of strains expressing an extended-spectrum [beta]-lactamase phenotype and characterization of isolates from Europe, the Americas, and the Western Pacific region. Clin Infect Dis. 2001;32(Suppl 2):S94-103.

(37.) Johnson JR, Kuskowski MA, Owens K, Gajewski A, Winokur PL. Phylogenetic origin and virulence genotype in relation to resistance to fluoroquinolones and/or extended-spectrum cephalosporins Cephalosporins Definition

Cephalosporins are medicines that kill bacteria or prevent their growth.
Purpose

Cephalosporins are used to treat infections in different parts of the body—the ears, nose, throat, lungs, sinuses, and
 and cephamycins among Escherichia coli isolates from animals and humans. J Infect Dis. 2003;188:759-68.

(38.) Wang M, Sahm DF, Jacoby GA, Hooper DC. Emerging plasmid-mediated quinolone resistance associated with the qnr gene in Klebsiella pneumoniae clinical isolates in the United States United States, officially United States of America, republic (2005 est. pop. 295,734,000), 3,539,227 sq mi (9,166,598 sq km), North America. The United States is the world's third largest country in population and the fourth largest country in area. . Antimicrob Agents Chemother. 2004;48:1295-9.

(39.) Bou G, Cartelle M, Tomas M, Canle D, Molina F, Moure R, et al. Identification and broad dissemination of the CTX-M-14 [beta]-1actamase in different Escherichia coli strains in the northwest area of Spain. J Clin Microbiol. 2002;40:4030-6.

(40.) Poirel L, Decousser JW, Nordmann P. Insertion sequence ISEcp1B is involved in expression and mobilization of a bla (CTX-M) [beta]-lactamase gene. Antimicrob Agents Chemother. 2003;47:2938-45.

Catherine Branger, * [dagger] Oana Zamfir, ([dagger]) Sabine Geoffroy, * Genevieve Laurans, ([double dagger double dagger
n.
A reference mark () used in printing and writing. Also called diesis.

Noun 1.
]) Guillaume Arlet, ([section]) Hoang Vu Thien, ([paragraph]) Stephanie Gouriou, (#) Bertrand Picard, (#) and Erick Denamur ([dagger])

* Hopital Louis Mourier, AP-HP AP-HP Assistance Publique - Hôpitaux de Paris , Colombes, France; ([dagger]) INSERM E0339, Paris, France; ([double dagger]) Hopital Nord, Amiens, France; ([section]) Hopital Tenon, Paris, France; ([paragraph]) Hopital Trousseau, Paris, France; and (#) Hopital Morvan, Brest, France
For other uses, see Brest.


Brest is a city in Brittany, or the Bretagne région, north-west France, sous-préfecture of the Finistère département.


Address for correspondence: Catherine Branger, Laboratoire de Microbiologie, Hopital Louis Mourier, 178 Rue des Renouillers, Colombes 92701 Cedex, France; fax: 33-1-47-60-60-48; email: catherine.branger@lmr.ap-hop-paris.fr

Dr. Branger is a medical microbiologist at the Hopital Louis Mourier, a teaching hospital in Paris, France. Her main research interests are nosocomial infections and molecular epidemiology molecular epidemiology Molecular medicine An evolving field that combines the tools of standard epidemiology–case studies, questionnaires and monitoring of exposure to external factors with the tools of molecular biology–eg, restriction endonucleases,  of emerging pathogens.
COPYRIGHT 2005 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2005, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research
Author:Denamur, Erick
Publication:Emerging Infectious Diseases
Geographic Code:1USA
Date:Jan 1, 2005
Words:5874
Previous Article:Dengue and dengue hemorrhagic fever, Brazil, 1981-2002.(Research)
Next Article:Mycobacterium haemophilum and lymphadenitis in children.(Research)
Topics:



Related Articles
An Epidemic of Bloody Diarrhea: Escherichia coil O157 Emerging in Cameroon?
Chlorine Inactivation of Escherichia coli O157:H7.
Toxin Gene Expression by Shiga Toxin-Producing Escherichia coli: the Role of Antibiotics and the Bacterial SOS Response.
5'-proximal AUG sequences as translation initiation signals on mRNAs in Escherichia coli.(Statistical Data Included)
Typical and atypical Enteropathogenic Escherichia coli. (Synopsis).
Enteropathogenic Escherichia coli O157 strains from Brazil. (Dispatches).
Cephamycin resistance in Clinical isolates and laboratory-derived strains of Escherichia coil, Nova Scotia, Canada.(Research)
Escherichia coli producing CTX-M-2 [beta]-lactamase in Cattle, Japan.(Research)
Human Escherichia coli O157:H7 genetic marker in isolates of bovine origin.(Dispatches)
Class 1 integrons in resistant Escherichia coli and Klebsiella spp., US hospitals.(DISPATCHES)(infectious diseases research)(includes statistical...

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles