Printer Friendly

Gene expression profiling of liver and mammary tissues of lactating dairy cows.

INTRODUCTION

Liver and mammary gland are two of the most important tissues for metabolism and partitioning of nutrients in lactating dairy cows. The liver transforms dietary nutrients into the fuels and precursors required by other tissues, and exports them via the blood. The demand of extrahepatic ex·tra·he·pat·ic  
adj.
Originating or occurring outside the liver.
 tissues for nutrients varies with physiological and nutritional state of the animal. To meet these changing circumstances, the liver has remarkable metabolic flexibility. Little is understood about the metabolic adaptation in the liver during lactation in cattle. The lactating mammary gland of a high producing dairy cow takes as much as 80% of the metabolites exported from gut and liver tissues and synthesizes milk constituents. The primary substrates needed by the lactating mammary gland are glucose, acetate, long-chain fatty acids, and amino acids for the synthesis of lactose, milk fat, and milk protein. The mammary gland is able to generate and maintain large [Na.sup.+], [K.sup.+], and [Cl.sup.-] gradients between milk and blood. A considerable amount of phosphate and calcium transport is required for milk secretion and special transport mechanisms are involved. Relatively few studies have been reported on the transcriptional regulation of nutrient metabolism and nutrient transport systems in the liver and mammary gland of lactating cows.

Microarray technology provides a high-throughput functional genomics approach toward a greater understanding of the complex and reciprocal interactions within the genome at the molecular level (Stover, 2004). A recent microarray study demonstrates a strong inhibition of gene expression for cell proliferation and increased gene expression in metabolism at onset of lactation in the bovine mammary gland (Finucane et al., 2008). Recently, Rudolph and coworkers (2007) reported a transcriptome analysis between the liver and mammary gland in mice using the Affymetrix microarray chip (Rudolph et al., 2007); they focused on understanding the transcriptional regulation of lactose and lipid synthesis in mammary mammary /mam·ma·ry/ (mam´ah-re) pertaining to the mammary gland, or breast.

mam·ma·ry
adj.
Of or relating to a breast or mamma.



mammary

pertaining to the mammary gland.
 tissues. No study on global transcriptome analysis between the liver and mammary gland for nutrient metabolism (carbohydrate, lipid, and protein) and their transport systems has been done in bovine tissues.

To enhance our understanding of metabolic processes in cattle, a set of cDNA sequences encoding most of the bovine metabolome as well as interacting signal transduction pathway genes was generated. From these sequences, we previously developed the bovine metabolism (BMET BMET Biomedical Engineering Technology
BMet Bachelor of Metallurgy
BMET Bio-Medical Equipment Repair Technician
)-focused microarray containing known genes for metabolism and its regulation using publicly available genomic internet database resources (Etchebarne et al., 2004). BMET microarray analyses may be an effective system for understanding differential transcriptional regulation of metabolic genes for various tissues and in various metabolic states. The purpose of this study is to understand differential transcriptional regulation of genes for metabolism and its regulation between the liver and mammary gland of dairy cows during lactation.

MATERIALS AND METHODS

Tissues samples and RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 isolation

Liver and mammary tissue samples were used from previous work (Binelli et al., 1995). We used tissues stored from control primiparous pri·mip·a·ra  
n. pl. pri·mip·a·ras or pri·mip·a·rae
1. A woman who is pregnant for the first time.

2. A woman who has given birth to only one child.
 Holstein cows. Briefly, cows were slaughtered at 181 d of lactation. Cows were housed in the stalls, exposed to 24 h/d of light, and milked three times per day at 0545, 1430, and 2200 h in a parlor at the Michigan State University Michigan State University, at East Lansing; land-grant and state supported; coeducational; chartered 1855. It opened in 1857 as Michigan Agricultural College, the first state agricultural college.  Dairy Cattle Teaching and Research Center, MI, USA. Cows were fed a TMR TMR

total mixed ration.

TMR 1 Trainable mentally retarded 2 Transmyocardial revascularization, see there
 for ad libitum intake. The TMR was formulated to provide adequate nutrition for a cow (590 kg of BW) yielding 38.5 kg/d of milk containing 3.5% fat, assuming 22.7 kg of DMI/d. Feed was offered twice daily (0330 and 1630).

Cows were slaughtered (stunned with a captive bolt followed immediately by exsanguination). Liver and mammary tissue was collected within 20 min of slaughter and frozen in liquid nitrogen. Samples were then stored at -80[degree]C until RNA extraction.

Total RNA was extracted from frozen liver and mammary tissues from 3 cows. Frozen tissues (200 mg) were homogenized with Trizol reagent (Invitrogen Life Technologies Corp., Carlsbad, CA). RNA was extracted by phenol/chloroform, precipitated by isopropanol isopropanol, isopropyl alcohol, or 2-propanol (ī'səprō`pənōl, ī'səprō`pĭl), (CH3)2CHOH, a colorless liquid that is miscible with water. , and dried. The RNA pellet was resuspended in nuclease-free water. The quantity of RNA isolated was determined using the NanoDrop ND-1000 Spectrophotometer spectrophotometer, instrument for measuring and comparing the intensities of common spectral lines in the spectra of two different sources of light. See photometry; spectroscope; spectrum.  (NanoDrop Technologies, Wilmington, DE), and quality was checked using the using the RNA 6000 Nano LabChip kit and Agilent 2100 BioAnalyzer (Agilent Technologies, Palo Alto, CA).

BMET microarray hybridization hybridization /hy·brid·iza·tion/ (hi?brid-i-za´shun)
1. crossbreeding; the act or process of producing hybrids.

2. molecular hybridization

3.
 

For cDNA synthesis, 15 [micro]g of sample RNA was used as a template in reverse transcription reactions (SuperScript Any letter, digit or symbol that appears above the line. For example, 10 to the 9th power is written with the 9 in superscript (109). Contrast with subscript.  III Fluorescent Labeling Kit L101401; Invitrogen Life Technologies Corp., Carlsbad, CA) in which oligo(dT)15-18 plus random hexamer was used as primers. In the Superscript III system, cDNA is prepared with a randomly incorporated amino-modified dUTP. The first-strand cDNA was purified by using a SNAP column. The purified cDNAs for liver and mammary tissues within an animal were differentially labeled using N-hydroxysuccinimide-derivatized Cy3 and Cy5 dyes (Amersham Pharmacia, Ltd., Piscataway, NJ), respectively. The labeled cDNA was purified by using a SNAP column and the unincorporated Cye dye was removed. Differentially labeled cDNAs were combined and concentrated by using Microcon 30 spin concentrators (Millipore Corp., Bedford, MA). SlideHyb-1 hybridization buffer (Ambion Inc., Alameda, CA) was added to the concentrated Cy3-Cy5-labeled probe cDNAs for microarray hybridization. The labeled cDNAs were incubated at 70[degree]C for 5 min just prior to 18-h array hybridization.

To examine gene expression, we used the BMET microarray, which is targeted toward studies on metabolic regulation of bovine tissues (Etchebarne et al., 2004). The BMET array is a high-density array of 70mer oligonucleotides spotted onto glass slides. The BMET array has 2,349 bovine genes. The BMET microarray slide was boiled, dried and installed on GeneTAC HybStation according to the manufacture's instruction, and the probe/hybrization solution was injected into hybridization station. The slide was hybridized for 18 h with three stepdown procedures (6 h at 42[degree]C, 6 h 35[degree]C, and 6 h at 30[degree]C). After hybridization, the slide was washed, dried, and scanned with Agilent Microarray Scanner G2565B (Agilent Technologies, Inc., Santa Clara, CA, United States). GenePix Pro 6 software (Axon axon: see nervous system; synapse.  Instruments, Inc., Union City, CA) was used to process microarray images, find spots, integrate robot spotting files with the microarray image, and finally to create reports of raw spot intensities. Total intensity values for each dye channel are converted to comma-separated value data files and exported into Excel spreadsheets and loaded into SAS (1) (SAS Institute Inc., Cary, NC, www.sas.com) A software company that specializes in data warehousing and decision support software based on the SAS System. Founded in 1976, SAS is one of the world's largest privately held software companies. See SAS System.  for data normalization and analysis. After LOESS loess (lĕs, lō`əs, Ger. lös), unstratified soil deposit of varying thickness, usually yellowish and composed of fine-grained angular mineral particles mixed with clay.  adjustment of spots within an array and correction for average intensity of blocks within an array, changes in transcript abundance were tested between two tissues. Direct comparisons between two tissues were made using two arrays for each cow comparison with a reversal of dye assignments for the second array; a total of 6 arrays were performed with the BMET array. The model used for the analysis was:

Y = tissue + cow + tissue x cow

The interaction term tissue x cow was used to test for treatment differences. The p-values were not adjusted for false discovery rate.

Real-time PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 

Real-time reverse transcriptase polymerase chain reaction (RT-PCR) was performed to validate the changes in gene expression detected by microarray analysis. This procedure was performed using the ABI PRISM 7000 Sequence Detection System (Perkin Elmer Corp., Foster City, CA). Total RNA was extracted from each tissue from each of the three cows, quantified and quality checked as described previously. RNA was converted into first-strand cDNA by using 2 [micro]g of total RNA with oligo(dT)18 primer. The first-strand cDNA was synthesized with Superscript II RNase H reverse transcriptase (Invitrogen Life Technologies).

SYBR Green PCR Master Mix (Perkin Elmer Corp.) and gene-specific primers were used to perform RT-PCR reactions. Primer Express Software (Perkin Elmer Corp.) was used to design all primers, which were then synthesized by a commercial facility (Invitrogen Life Technologies). Primer sequences are shown in Table 1. The amount of primer used was determined by performing an optimization matrix for each primer using three concentrations of primers: 100:100 nM, 600:600 nM, 1,800:1,800 nM. Dissociation curves were similar for all concentrations and the 600:600 nM matrix was chosen, thus 3 [micro]l of primer was used for all experiments. Each gene of interest and the control gene were measured in duplicate. Within each well of a 96-well reaction plate (MicroAmp Optical, Applied Biosystems), 30 ng of sample cDNA (3 [micro]l), 6.5 [micro]l DEPC DEPC Diethyl Pyrocarbonate
DEPC Down East Partnership for Children
DEPC Data Evaluation and Publication Committee
 water, 3 [micro]l of each primer, and 12.5 [micro]l Sybr Green (Applied Biosystems) were added.

To determine an appropriate reference control gene by which relative mRNA abundances for genes of interest could be measured, a number of potential housekeeping genes were screened based on both expression ratio (liver/mammary tissues) and expression intensity of microarray results. These candidate control genes included NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1 (ndufb1), NADH dehydrogenase (ubiquinone) 1 alpha subcomplex (ndufa3) and splicing factor 1 (sf1). RT-PCR threshold cycle (CT) values for all three genes were consistent for liver and mammary tissues among animals and we used ndufb1 as a control. We did not use GAPDH GAPDH Glyceraldehyde-3-Phosphate Dehydrogenase (also seen as G3PDH)  as a control, since microarray data showed differential expression between liver and mammary tissues. We also confirmed differential expression of GAPDH between liver and mammary tissues by real-time PCR.

The [2.sup.-[DELTA][DELTA]CT] method of RT-PCR analysis was performed as previously described (Livak and Schmittgen, 2001). This method enabled relative gene expression changes across treatments based on quantitative differences in the PCR amplified target reaching a fixed CT number at a set treatment versus other treatments. Gene-specific standard errors were estimated using independent analyses of variance (ANOVA anova

see analysis of variance.

ANOVA Analysis of variance, see there
). All analyses were performed using the SAS 9.1 for windows.

RESULTS AND DISCUSSION

BMET microarray hybridization

Gene expression profiling was compared between liver and mammary tissues of dairy cows by using BMET microarray. Statistical analysis revealed that the 398 genes (17%) out of 2,349 genes were differentially expressed by greater than 2 x difference at p<0.05. Of these, 222 genes were greater in liver and 176 genes were higher in mammary tissues (Table 2). The distribution of p-values was highly skewed toward the lower p values, indicating a significant tissue effect (Figure 1).

Validation of the microarray data by real-time PCR

Quantitative real-time PCR of selected genes was performed to confirm microarray results. We selected 12 genes, mostly from the carbohydrate/energy metabolism category: six genes had higher expression in liver, four had higher expression in mammary gland, and two had similar expression between the two tissues. Of these genes, six had over a 10-fold difference between tissues, four had a 2-3 fold difference, and two were not different (Table 3). Realtime PCR analysis showed consistent results with those of microarray analysis for all 12 genes tested (Table 3). However, the real-time PCR analysis was more sensitive than the microarray. The fold difference of expression levels determined by real-time PCR was between 1 and 300,000, while fold difference determined by microarray analysis was between 1 and 58.

[FIGURE 1 OMITTED]

Gene expression profiling of liver and mammary tissues of lactating dairy cows

Genes significantly different in mRNA abundance between the two tissues were grouped within a number of gene ontologies and pathways using the GenMAPP MAPPFinder 2 program (Dahlquist et al., 2002; Doniger et al., 2003) These gene ontology categories are generalized across species and are not specific for bovine. The BMET analysis was able to differentiate gene expression profiles of major metabolic pathways of liver and mammary tissues (Table 2). Generally, expression profiles of BMET genes were consistent with function of the liver and mammary tissues. As expected, expression levels of genes involved in most of hepatic metabolic functions and their regulation were higher in the liver compared to mammary tissues. Gene ontology categories with a high percentage of genes more highly expressed in liver than mammary tissues included carbohydrate metabolism (glycolysis glycolysis (glīkŏl`ĭsĭs), term given to the metabolic pathway utilized by most microorganisms (yeast and bacteria) and by all "higher" animals (including humans) for the degradation of glucose. , glucoenogenesis, propanoate metabolism, butanoate metabolism, electron carrier and donor activity), lipid metabolism (fatty acid oxidation, chylomicron/lipid transport, bile acid metabolism, cholesterol metabolism, steroid metabolism, ketone body formation), amino acid/nitrogen metabolism (amino acid biosynthetic bi·o·syn·the·sis  
n.
Formation of a chemical compound by a living organism. Also called biogenesis.



bi
 process, amino acid catabolic process, urea cycle, and glutathione glutathione: see coenzyme.  metabolic process), cytochrome p450, heme binding, response to xenobiotic xen·o·bi·ot·ic
adj.
Foreign to the body or to living organisms. Used of chemical compounds.

n.
A xenobiotic chemical.



xenobiotic

any substance, harmful or not, that is foreign to the animal's biological system.
 stimulus, and blood coagulation. Categories with more genes highly expressed in mammary than liver tissues included nutrient transport systems for milk precursors and milk constituents (amino acid, sugar, sodium and phosphate transporters), lactose synthesis, arachidonic acid metabolism, and genes associated with several signal transduction pathways (MAPK MAPK Mitogen-Activated Protein Kinase
MAPK Map Kinase
, Wnt, and JAK-STAT).

In addition, BMET microarray was able to identify differential expression profiles of several gene isoforms (Table 4). These include isoforms of the facilitated glucose transporters (GLUT), the glutamate transporters, cationic cationic

having qualities dependent on having free cations available.


cationic detergents
are wetting agents that disrupt or damage cell membranes, denature proteins and inactivate enzymes.
 amino acid transporters, fatty acid transporters, fatty acid binding proteins, aldolases, acyl-Coenzyme A oxidases, long-chain acyl-CoA synthetases, acylglycerol-3-phosphate O-acyltransferases, phosphatidic acid phosphatases, and suppressor of cytokine Cytokine

Any of a group of soluble proteins that are released by a cell to send messages which are delivered to the same cell (autocrine), an adjacent cell (paracrine), or a distant cell (endocrine).
 signaling genes.

Carbohydrate metabolism : Although the Gene Ontology category "glycolysis" had more genes upregulated in liver than mammary tissue, several of these genes encode enzymes that catalyze reversible reactions. Thus, the higher expression of aldolase B, glyceraldehyde-3-P dehydrogenase dehydrogenase /de·hy·dro·gen·ase/ (de-hi´dro-jen-as?) an enzyme that catalyzes the transfer of hydrogen or electrons from a donor, oxidizing it, to an acceptor, reducing it.

de·hy·dro·gen·ase
n.
, 6-phosphofructo-2-kinase, and triosephosphate isomerase are actually consistent with the hepatic focus on gluconeogenesis gluconeogenesis /glu·co·neo·gen·e·sis/ (gloo?ko-ne?o-jen´e-sis) the synthesis of glucose from molecules that are not carbohydrates, such as amino and fatty acids.

glu·co·ne·o·gen·e·sis
n.
. Vertebrates have 3 aldolase aldolase /al·do·lase/ (al´do-las)
1. aldehyde-lyase.

2. an enzyme that acts as a catalyst in the production of dihydroxyacetone phosphate and glyceraldehyde phosphate from fructose 1,6-bisphosphate.
 isozymes, and aldolase B is considered the predominant form in liver. Our results confirm that aldolase B is the main transcript for liver and show aldolase C is the most abundant of the three isoforms in mammary tissue.

As expected, genes encoding the enzymes of gluconeogenesis and propanoate metabolism were more highly expressed in liver than mammary tissues. Phosphoenolpyruvate carboxykinase has a cytosolic (PCK PCK Pedagogical Content Knowledge (knowledge of how to teach a subject)
PCK Phosphoenolpyruvate Carboxykinase
PCK Polycystic Kidney Disease
PCK Phua Chu Kang (Singapore sitcom character) 
1) and mitochondrial mitochondrial

pertaining to mitochondria.


mitochondrial RNAs
a unique set of tRNAs, mRNAs, rRNAs, transcribed from mitochondrial DNA by a mitochondrial-specific RNA polymerase, that account for about 4% of the total cell RNA that
 (PCK2) form, which are products of two separate genes for rat, bovine, and several other species (Hod et al., 1986); but only the cytosolic form is hormonally regulated (Weldon et al., 1990). Hartwell et al. (1999) indicated a close relationship between total PCK activity and cytosolic PCK mRNA. Consistent with this, we found that PCK1 expression was liver specific, but PCK2 expression showed only a minor difference between the tissues. Transcript abundance of all enzymes for propanoate metabolism (propionyl Coenzyme A carboxylase carboxylase /car·box·y·lase/ (kahr-bok´si-las) an enzyme that catalyzes the removal of carbon dioxide from the carboxyl group of alpha amino keto acids.

car·box·yl·ase
n.
 alpha, methylmalonyl Coenzyme A mutase mutase /mu·tase/ (mu´tas) a group of enzymes (transferases) that catalyze the intramolecular shifting of a chemical group from one position to another.

mu·tase
n.
, etc) were higher in liver than mammary tissues. In addition, we found greater transcript levels in liver for all enzymes of butanoate metabolism (such as butyryl Coenzyme A synthetase synthetase /syn·the·tase/ (-the-tas) a term used in the names of some of the ligases, no longer favored because of its similarity to synthase and its emphasis on reaction products.

syn·the·tase
n.
 1, enoyl Coenzyme A hydratase, hydroxyacyl-Coenzyme A dehydrogenase, and aldehyde dehydrogenase 1) as well as all five alcohol dehydrogenase (ADH ADH: see antidiuretic hormone. ) isoforms for metabolizing ethanol and retinol retinol: see Vitamin A under vitamin. .

Lipid metabolism : Of the 212 genes on the BMET array that encode enzymes for lipid metabolism, 36% had>two-fold expression in liver and 13% had>two-fold expression in mammary tissue. Both tissues had very low abundance for ATP citrate lyase ATP citrate lyase is an enzyme that represents an important step in fatty acid biosynthesis. Reaction
In the presence of ATP and Coenzyme A, catalyzes the cleavage of citrate to yield acetyl CoA, oxaloacetate, ADP, and orthophosphate:

citrate + ATP + CoA-->
. The low transcript abundance of this enzyme in mammary tissue is consistent with its low activity level and minor contribution of glucose to fatty acid synthesis Fatty acids are formed by the action of Fatty acid synthases from acetyl-CoA and malonyl-CoA precursors. In humans fatty acids are predominantly formed in the liver and adipose tissue, and mammary glands during lactation.  via acetyl-CoA in ruminant ruminant, any of a group of hooved mammals that chew their cud, i.e., that regurgitate and chew again food that has already been swallowed. Ruminants have an even number of toes on each foot and a stomach with either three or four chambers.  mammary gland (Hood et al., 1972). Transcript levels of acetyl-CoA carboxylase alpha (ACACA ACACA Acetyl-Coa Carboxylase-Alpha ) and fatty acid synthase Fatty acid synthases (FAS) is enzymatic system composed of 272 kDa multifunctional polypeptide, in which substrates are handed from one functional domain to the next[1][2][3][4][5].  (FASN FASN Florida Association of School Nurses ) were high in both tissues but even higher in mammary tissues than liver. Bionaz and Loor (2008) reported that ACACA mRNA was up-regulated during lactation more than was FASN in dairy cows. This is consistent with the role of ACACA in the synthesis of malonyl-CoA, the rate-limiting step in milk fatty acid synthesis. In addition, the expression of acetyl-Coenzyme A synthetase 2 (categorized as a "Fatty acid oxidation" gene) was three-fold higher in mammary than liver tissue, consistent with its function of activating acetate for use in ruminant lipid synthesis and fuel support (Smith and Prior, 1986). Isocitrate dehydrogenase generates NADPH NADPH the reduced form of NADP.

NADPH
n.
The reduced form of NADP.



NADPH

reduced form of nicotinamide adenine dinucleotide phosphate (NADP) used in a number of reductive synthesis such as fatty
 to support fatty acid synthesis and was also more highly expressed in mammary than liver tissues. About half of the fatty acids found in milk triglycerides Triglycerides
Fatty compounds synthesized from carbohydrates during the process of digestion and stored in the body's adipose (fat) tissues. High levels of triglycerides in the blood are associated with insulin resistance.
 are derived from blood lipids (Moore and Christie, 1979). We found lipoprotein lipase (LPL LPL - List Programming Language. LISP-like language with ALGOL-like syntax, for IBM 360. "LPL - LISP Programming Language", F.W. Blair et al, RC 3062, IBM TJWRC, Sep 1970. ) expression was >ten times higher in mammary than liver tissue. Recent report demonstrates that expression of LPL significantly increased at 10 day after parturition parturition
 or birth or childbirth or labour or delivery

Process of bringing forth a child from the uterus, ending pregnancy. It has three stages.
 compared to about 5 day before parturition of Holstein dairy cows (Finucane et al., 2008). We observed about 10-fold higher expression of acetyl-coenzyme A acetyl acetyl /ac·e·tyl/ (as´e-til) (as´e-tel?) (ah-se´til) the monovalent radical CH3COsbond, a combining form of acetic acid.

a·ce·tyl
n.
 transferase 2 (ACAA2) gene in liver relative to mammary tissues. The ACAA2 gene has been downregulated in the liver of ketotic dairy cows (Xu et al., 2008).

Fatty acids must be activated by acyl-CoA synthethetase (ACSL ACSL Advanced Continuous Simulation Language (AEgis Technologies Group, Inc.)
ACSL American Computer Science League
ACSL Assistant Cub Scout Leader
ACSL Altocumulus Standing Lenticular Clouds (often confused for UFOs) 
) prior to their use in triacylglycerol synthesis The BMET microarray contains several ACSL isoforms. The ACSL5 isoform was the most abundant in liver. Among the other four isoforms, only ACSL1 showed even a trend for greater expression in mammary tissue. Recent studies report that ACSL1 is the predominant acyl-CoA synthetase of lactating bovine mammary tissues (Rudolph et al., 2007; Bionaz and Loor, 2008b). The fact that its expression was not greater was surprising.

Glycerol-3-P acyltransferase and 1-acylglycerol-3-P acyltransferase are both required for milk triglyceride synthesis (Moore and Christie, 1979). Two mammalian forms of glycerol-3-P acyltransferase have been identified on the basis of localization Customizing software and documentation for a particular country. It includes the translation of menus and messages into the native spoken language as well as changes in the user interface to accommodate different alphabets and culture. See internationalization and l10n.  to either the endoplasmic reticulum reticulum /re·tic·u·lum/ (re-tik´u-lum) pl. retic´ula   [L.]
1. a small network, especially a protoplasmic network in cells.

2. reticular tissue.
 or mitochondria. We observed a 25-fold higher expression of the mitochondrial form in mammary tissue relative to liver. Previously, higher enzymatic activities of this enzyme were observed in lactating mammary tissue of sheep compared to liver tissue (Vernon et al., 1987); our study suggests that this is transcriptionally regulated. Yamashita et al. (2007) showed the existence of nine mammalian isoforms of 1-acylglycerol-3-phosphate Oacyltransferase (AGPAT), which catalyzes the transfer of fatty acid from fatty acyl-CoA to lysophosphatidic acid, forming phosphatidic acid. The BMET array contains four genes of these isoforms, and AGPAT1 was the most abundant transcript in both tissues. We found a trend for more AGPAT1 transcripts in mammary tissues and a fivefold expression of AGPAT2 in liver. The BMET array does not contain AGPAT6; recently Bionaz and Loor (2008) showed a 10-fold increase in GPAM and 15-fold increase in AGPAT6 mRNAs at 60 d postpartum compared to the late prepartum/non-lactating period. They suggest that APTAT6, and to a lesser extent AGPAT1, are the most important AGPAT isoforms in bovine mammary gland (Bionaz and Loor, 2008a, 2008b).

As expected, hepatic lipase was more highly expressed in liver. We also found that expression of hormone-sensitive lipase lipase (lī`pās), any enzyme capable of degrading lipid molecules. The bulk of dietary lipids are a class called triacylglycerols and are attacked by lipases to yield simple fatty acids and glycerol, molecules which can permeate the membranes  was more highly expressed in mammary tissue, which is consistent with reports that hormone sensitive lipase likely plays a role in mammary epithelial cells and is up-regulated during lactation relative to gestation in rodents (Martin-Hidalgo, 2005). Half of the genes categorized as part of fatty acid oxidation were more highly expressed in liver than mammary tissue. Transcript levels of peroxisome Peroxisome

An intracellular organelle found in all eukaryotes except the archezoa (original lifeforms). In electron micrographs, peroxisomes appear round with a diameter of 0.1–1.
 proliferative activated receptor alpha, which is a major regulator of lipolysis lipolysis /li·pol·y·sis/ (li-pol´i-sis) the splitting up or decomposition of fat.lipolyt´ic

li·pol·y·sis
n. pl. li·pol·y·ses
The hydrolysis of lipids.
, were also higher in the liver. These results are consistent with the demonstration of decreased levels of enzymes for [beta]-oxidation in the lactating mammary gland (Rudolph et al., 2007). Consistent with reports that adipose adipose /ad·i·pose/ (ad´i-pos)
1. fatty.

2. the fat present in the cells of adipose tissue.


ad·i·pose
adj.
Of, relating to, or composed of animal fat; fatty.
 differentiation-related protein localizes to neutral lipid storage droplets and is a component of the milk lipid globule globule /glob·ule/ (glob´ul)
1. a small spherical mass or body.

2. a small spherical drop of fluid or semifluid substance.

3. a little globe or pellet, as of medicine.
 membrane, its transcript was highly abundant in mammary tissue, and it was ten-fold greater than in liver (Heid et al., 1996).

Nine fatty acid-binding proteins (FABPs 1-9) have been identified (Furuhashi and Hotamisligil, 2008), and seven of these are found on the BMET array. The different members of the FABP FABP Fatty Acid-Binding Protein  family exhibit unique patterns of tissue expression and are expressed most abundantly in tissues involved in active lipid metabolism. Expression of FABP1 was much greater in liver, while FABP3 and FABP4 transcripts were much more abundant in mammary tissues. FABP1 is abundant in liver cytoplasm cytoplasm: see protoplasm.
cytoplasm

Portion of a eukaryotic cell outside the nucleus. The cytoplasm contains all the organelles (see eukaryote).
, but is also expressed in splanchnic splanchnic /splanch·nic/ (splangk´nik) pertaining to the viscera.

splanch·nic
adj.
Of or relating to the viscera; visceral.



splanchnic

pertaining to the viscera.
 tissues and lung (Chmurzynska, 2006). FABP3 has been isolated from a wide range of tissues, including muscle, brain, mammary gland, ovary ovary, ductless gland of the female in which the ova (female reproductive cells) are produced. In vertebrate animals the ovary also secretes the sex hormones estrogen and progesterone, which control the development of the sexual organs and the secondary sexual  and brown adipose tissue brown adipose tissue

see brown adipose tissue.
 (Chmurzynska, 2006). FABP4 was first detected in mature adipocytes and adipose tissue (Hunt et al., 1986).

Of the 18 genes categorized as part of arachidonic acid metabolism on the BMET, seven were expressed at a >twofold level in mammary tissue than in liver. These include enzymes for prostaglandin synthesis, such as prostaglandin D2 synthase Prostaglandin D2 synthase generates prostaglandin D2 from prostaglandin H2.

    [
 and prostaglandin-endoperoxide synthase synthase /syn·thase/ (-thas) a term used in the names of some enzymes, particularly lyases, when the synthetic aspect of the reaction is dominant or emphasized.

syn·thase
n.
 2 (cyclooxigenase 2, COX2) and enzymes for leukotriene leukotriene /leu·ko·tri·ene/ (-tri´en) any of a group of biologically active compounds derived from arachidonic acid that function as regulators of allergic and inflammatory reactions.  synthesis, such as arachidonate 12-lipoxygenase and arachidonate 15-lipoxygenase. Cyclooxygenase is the key enzyme in prostaglandin biosynthesis Biosynthesis

The synthesis of more complex molecules from simpler ones in cells by a series of reactions mediated by enzymes. The overall economy and survival of the cell is governed by the interplay between the energy gained from the breakdown of compounds
 and acts both as a dioxygenase and as a peroxidase peroxidase /per·ox·i·dase/ (per-ok´si-das) any of a group of iron-porphyrin enzymes that catalyze the oxidation of some organic substrates in the presence of hydrogen peroxide.

per·ox·i·dase
n.
. Two COX isozymes exist: one constitutive (COX1) and one inducible (COX2). In our study, expression of COX2, but not COX1, was higher in mammary tissue. This is consistent with the postulated roles of COX2 in immune function, inflammation, and carcinogenesis car·ci·no·gen·e·sis
n.
The production of cancer.



carcinogenesis

production of cancer.


biological carcinogenesis
viruses and some parasites are capable of initiating neoplasia.
 (Pfaffl et al., 2003; Subbaramaiah et al., 2008).

Amino acid/nitrogen metabolism : Of the 110 genes on the BMET array that are included in the amino acid/nitrogen metabolism gene ontology category, 56% were expressed at >two-fold in liver compared to mammary tissue. Transcripts encoding enzymes involved in both amino acid biosynthetic processes (synthesis of arginine arginine (är`jənĭn), organic compound, one of the 20 amino acids commonly found in animal proteins. Only the l-stereoisomer participates in the biosynthesis of proteins. , methionine methionine (mĕthī`ənēn), organic compound, one of the 20 amino acids commonly found in animal proteins. Only the L-stereoisomer appears in mammalian protein. , glutamine glutamine (gl`təmēn), organic compound, one of the 20 amino acids commonly found in animal proteins. , histidine histidine (hĭs`tĭdēn), organic compound, one of the 22 α-amino acids commonly found in animal proteins. Only the l-stereoisomer appears in mammalian protein. , and sulfur amino acids) and catabolic processes (catabolism of L-phenylalanine, tyrosine, lysine lysine (lī`sēn), organic compound, one of the 20 amino acids commonly found in animal proteins. Only the l-stereoisomer appears in mammalian protein. , valine valine (văl`ēn), organic compound, one of the 22 α-amino acids commonly found in animal proteins. Only the l-stereoisomer appears in mammalian protein. , leucine leucine (l`sēn), organic compund, one of the 20 amino acids commonly found in animal proteins. , isoleucine isoleucine (ī'səl`sēn), organic compound, one of the 20 amino acids commonly found in animal proteins. , and arginine) were generally more abundant in liver than mammary tissues. In addition, about half of the genes involved in the urea cycle were more highly expressed (>2X) in liver relative to mammary tissue.

Glutathione S-transferase functions in the detoxification of electrophilic compounds, including carcinogens and products of oxidative stress. At present, eight distinct classes of the soluble cytoplasmic cytoplasmic

pertaining to or included in cytoplasm.


cytoplasmic inclusions
include secretory inclusions (enzymes, acids, proteins, mucosubstances), nutritive inclusions (glycogen, lipids), pigment granules (melanin, lipofuscin,
 mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. The alpha class genes are the most abundantly expressed glutathione S-transferases in liver. Consistent with this, we found an 18-fold higher expression of glutathione S-transferase A1 gene in the liver; the kappa and theta class genes also were over three-more highly expressed in liver compared to mammary tissue.

Transporters : Of the 48 genes on the BMET array that encode transport proteins, 40% were differentially expressed at our threshold value of 2X and p<0.05. Of the glucose transporters, GLUT1 was the most abundant transcript in both tissues, and both GLUT1 and GLUT4 were more highly expressed in mammary tissue than liver but not at the two-fold threshold. In the lactating bovine mammary gland, GLUT1 is the predominant glucose transporter, but GLUT3, 4, 5, 8, and 12 are also expressed (Zhao and Keating, 2007). The major sites of GLUT2 expression in human are liver, kidney, and small intestine (Fukumoto et al., 1988). Consistent with this, we found a six-fold expression of GLUT2 in liver compared to lactating mammary gland in dairy cows. Fatty acid transport proteins (FATP FATP Fatty-Acid Transport Protein
FATP Future Astronaut Training Program (camp)
FATP Functional Acceptance Test Plan
FATP First Article Test Plan
FATP Final Assembly, Test & Pack
) are transmembrane proteins that enhance the uptake of long-chain and very long chain fatty acids into cells. In humans, FATPs comprise a family of six highly homologous proteins, named FATP 1-6 (Stahl, 2004). FATP2 is found mostly in liver and kidney cortex, FATP5 is found only in liver, and FATP3 shows a broader expression pattern with notably high mRNA and protein levels in the lung (Hirsch et al., 1998). Our study provides, for the first time, the tissue specificity of FATP expression in cattle. The most abundant FATP transcript in both tissues was FATP4, but expression levels of FATP2 and FATP5 genes were higher in liver than mammary tissues, consistent with the data from human studies. Expression FATP3 gene was slightly higher in mammary than liver tissue, and there were no differences in expression of FATP4 and FATP6 between the two tissues.

Of the 14 amino acid tranporters on BMET, 7 had >twofold expression in mammary tissue compared to liver. There are seven amino acid transporters in solute carrier family The SoLute Carrier (SLC) group of membrane transport proteins include over 300 members organized into 47 families.[1] The SLC gene nomenclature system was originally proposed by the Human Genome Organization (HUGO) and is the basis for the official HUGO names of the  1, five high-affinity glutamate transporters and two neutral amino acid transporters (Kanai and Hediger, 2004). The BMET array had five of these, and three were more highly expressed in mammary tissue. The solute solute /so·lute/ (sol´ut) the substance dissolved in solvent to form a solution.

sol·ute
n.
 carrier 7 family is divided into two subgroups, the cationic amino acid transporters and the glycoprotein-associated amino acid transporters, also called catalytic chains of the hetero hetero prefix, Latin, different (di)meric amino acid transporters (Verrey et al., 2004). The BMET array contained four of these, and two were more highly expressed in mammary tissue. Expression levels of two amino acid transporters of family 38 were also greater in mammary tissues than liver. Thus, our results clearly demonstrate that several amino acid transporter genes are actively transcribed in lactating mammary gland, but little has been done to understand their role in milk synthesis.

We observed significant differences in expression of sodium potassium transporters. Of note, solute carrier family 34 member 2 was expressed 100-fold greater in mammary tissues than in liver. This transporter, also known as NaPi-IIb, was expressed apically in lactating mouse mammary gland but not in virgin mammary gland and is a potential marker of secretory secretory /se·cre·to·ry/ (se-kre´tah-re) (se´kre-tor?e) pertaining to secretion or affecting the secretions.

se·cre·to·ry
adj.
Relating to or performing secretion.
 function (Miyoshi et al., 2001) and mammary gland differentiation (Evarts et al., 2004). Recently, NaPi-IIb was found in goat mammary gland (Muscher et al., 2008). We suggest that NaPi-IIb may also function as a differentiation marker of mammary gland in lactating dairy cows. Solute carrier family 20 member 2 was also highly expressed in mammary tissues (17 fold higher than in liver). Shillingford et al. (1996) have suggested that this phosphate transporter provides basolateral uptake of Pi from the blood for subsequent secretion into the lumen in Pi secreting glands, such as the lactating mammary gland. Solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 1 also was much more highly expressed in mammary tissues. The role and expression patterns of most of sodium potassium transport systems have not been reported. Our analyses provide data for the first time that genes for specific sodium and potassium transporter systems are actively transcribed for milk synthesis and secretion in bovine lactating mammary gland.

Signal transduction : Of the 50 signal transduction genes examined, 34 were differentially expressed >two-fold in these tissues. The BMET contains oligos for 28 mitogenactivated protein kinases (MAPK) and nearly all of these were differentially expressed. Transcript levels of MAPK6 were higher in liver, while those of MAPK12 were higher in mammary tissues. One of the genes whose expression is under tight control by JNK JNK Jun N-terminal Kinase
JNK Junk (File Name Extension) 
 is the c-jun gene. MAPKs of the JNK family rapidly phosphorylate phos·pho·ryl·ate  
tr.v. phos·pho·ryl·at·ed, phos·pho·ryl·at·ing, phos·pho·ryl·ates
To add a phosphate group to (an organic molecule).



phos
 c-jun proteins already present in the cell in response to extracellular stimuli (Pulverer et al., 1991). BMET analysis showed 25-fold higher mRNA levels of jun in mammary tissues. MAPKs, which include the extracellular signal-regulated protein kinases (ERK ERK Extracellular Signal-Regulated Kinase
ERK Electronic Records Keeping
ERK Externally Regulated Kinases
1 and ERK2), c-jun N-terminal kinases (JNK1, JNK2, JNK3), and p38s and ERK5, are a family of serine/threonine kinases that play an essential role in signal transduction by modulating gene transcription in the nucleus in response to changes in the cellular environment.

We found greater transcript levels in mammary tissue, compared to liver, for genes in the TGF-[beta] pathway including TGF-[beta] isoforms 1, 2, and 3 and transforming growth factor-beta receptors II and III. Binding of transforming growth factor beta (TGF-[beta]) to the TGF-[beta] receptor complex activates both Smad and MAPK pathways.

There are three major Wnt signaling pathways: a canonical Wnt/[beta]-catenin pathway, Wnt/[Ca.sup.2+] pathway and Wnt/PCP (Planar Cell Polarity) pathway (Turashvili et al., 2006). The Wnt/[Ca.sup.2+] pathway involves Frizzled and Dishevelled proteins and leads to the release of intracellular calcium and thereby affects the activity of calciummodulated kinases, including calcium/calmodulindependent protein kinase II and protein kinase C Protein kinase C ('PKC', EC 2.7.11.13) is a family of protein kinases consisting of ~10 isozymes.[1] They are divided into three subfamilies: conventional (or classical), novel, and atypical based on their second messenger requirements. . Our analysis shows higher mRNA levels of genes for the Wnt/[Ca.sup.2+] pathway including wingless-type MMTV MMTV Mouse Mammary Tumor Virus  integration site family, member 5A (Wnt5A), frizzled homolog hom·o·log  
n.
Variant of homologue.
 1 (FZD FZD Flood Zone Determination (banking, insurance) 1), and protein kinase C genes in mammary tissues compared to liver. This suggests that the Wnt/[Ca.sup.2+] pathway has an active functional role in mammary gland. Wnt signals are strongly implicated in initial development of the mammary rudiments, and in the ductal branching and alveolar alveolar /al·ve·o·lar/ (al-ve´o-lar) [L. alveolaris ] pertaining to an alveolus.

al·ve·o·lar
adj.
Relating to an alveolus.
 morphogenesis morphogenesis /mor·pho·gen·e·sis/ (mor?fo-jen´e-sis) the evolution and development of form, as the development of the shape of a particular organ or part of the body, or the development undergone by individuals who attain the type to  that occurs during pregnancy (Brennan and Brown, 2004).

The suppressor of cytokine signaling (SOCS) proteins function in a negative feedback loop regulating cytokine JAK-STAT signal transduction. We found differential expression of several SOCS isoform genes between the two tissues: mRNA levels of SOCS 3 gene were five-fold higher in lactating mammary tissues compared to liver, while those of SOCS 1, 2, and 5 genes were 40 to 70% greater in mammary tissue. SOCS can modulate prolactin prolactin /pro·lac·tin/ (-lak´tin) a hormone of the anterior pituitary that stimulates and sustains lactation in postpartum mammals, and shows luteotropic activity in certain mammals.

pro·lac·tin
n.
 signaling in mammary tissues. During lactation, high levels of circulating prolactin may modulate up-regulation of SOCS 3 gene expression. Mammary transcription of mRNA for SOCS 2 and 3 proteins was low during the dry period but increased in lactation in dairy cows (Wall et al., 2005). SOCS 2 mRNA increased after parturition in the liver of dairy cows (Winkelman et al., 2008). In liver, growth hormone is shown to induce a transient expression of SOCS 3 (Adams et al., 1998).

CONCLUSION

Previously, there was no report on expression data for some genes because bovine cDNA sequences were not available. For the first time, we were able to detect expression profiles of several genes by using bioinformatics. This was possible because we designed bovine oligonucleotide sequences based on comparison of bovine EST EST electroshock therapy.

EST
abbr.
electroshock therapy
 sequences and human cDNA database for the genes that bovine cDNA sequences were not available. These include ACLY, GLUT2, SLC (Subscriber Loop Carrier) Lucent's designation for its digital loop carrier (DLC) products. See digital loop carrier. See also 386SLC. 1 family genes, and most genes for sodium potassium transport systems.

In conclusion, BMET microarray analyses were able to clearly identify differential gene expression profiles between liver and mammary tissues of high-producing lactating dairy cows. Many of these differences were consistent with the differences in metabolism of the two tissues. Thus, as expected, many of the metabolic functions of the two tissues can be explained by differences in gene transcription. The use of microarrays to help understand complex gene expression patterns in various tissue types in cattle is becoming increasingly helpful in understanding phenotype and genotype interactions. Further studies on the regulation of transporter proteins and signaling molecules are warranted and may help to improve the production and quality of milk in the future.

ACKNOWLEDGMENTS

This study was supported by Korea Research Foundation The Korea Research Foundation is a grant organization supported by the South Korean Ministry of Culture and Tourism. It provides support for research into new theories for the advancement of science, the arts, and the Korean culture in general.  Grant (KRF-2004-F00005) and a grant from the National Research Laboratory Program (ROA-2007-000-20057-0) to M. Baik, the Michigan Agricultural Experiment Station The examples and perspective in this article or section may not represent a worldwide view of the subject.
Please [ improve this article] or discuss the issue on the talk page.
, and USDA-IFAFS.

Received January 22, 2009; Accepted March 22, 2009

REFERENCES

Adams, T. E., J. A. Hansen, R. Starr, N. A. Nicola, D. J. Hilton and N. Billestrup. 1998. Growth hormone preferentially induces the rapid, transient expression of SOCS-3, a novel inhibitor of cytokine receptor signaling. J. Biol. Chem. 16:1285-1287.

Binelli, M., W. K. Vanderkooi, L. T. Chapin, M. J. Vandehaar, J. D. Turner, W. M. Moseley and H. A. Tucker. 1995. Comparison of growth hormone-releasing factor growth hormone-releasing factor or growth hormone-releasing hormone
n. Abbr. GHRF, GH-RF
See somatoliberin.
 and somatotropin somatotropin: see growth hormone. : body growth and lactation of primiparous cows. J. Dairy Sci. 78:2129-2139.

Bionaz, M. and J. J. Loor. 2008. Gene networks driving bovine milk fat synthesis during the lactation cycle. BMC (BMC Software, Inc., Houston, TX, www.bmc.com) A leading supplier of software that supports and improves the availability, performance, and recovery of applications in complex computing environments.  Genomics 31:366.

Bionaz, M. and J. J. Loor. 2008. ACSL1, AGPAT6, FABP3, LPIN LPIN Libertarian Party of Indiana
LPIN Legal Prostitution in Nevada
LPIN Lipo-Protein Ice Nucleator
1, and SLC27A6 are the most abundant isoforms in bovine mammary tissue and their expression is affected by stage of lactation. J. Nutr. 138:1019-1024.

Brennan, K. R. and A. M. Brown. 2004. Wnt proteins in mammary development and cancer. J. Mammary Gland Biol. Neoplasia neoplasia /neo·pla·sia/ (-pla´zhah) the formation of a neoplasm.

cervical intraepithelial neoplasia
 9:119-131.

Chmurzynska, A. 2006. The multigene family of fatty acid-binding proteins (FABPs): function, structure and polymorphism. J. Appl. Genet genet: see civet. . 47:39-48.

Dahlquist, K. D., N. Salomonis, K. Vranizan, S. C. Lawlor and B. R. Conklin. 2002. GenMAPP, a new tool for viewing and analyzing microarray data on biological pathways. Nat. Genet. 31:19-20.

Doniger, S. W., N. Salomonis, K. D. Dahlquist, K. Vranizan, S. C. Lawlor and B. R. Conklin. 2003. MAPPFinder: using Gene Ontology and GenMAPP to create a global gene-expression profile from microarray data. Genome Biol. 4:R7.

Etchebarne, B. E., W. Nobis, M. S. Allen, and M. J. VandeHaar. 2004. Design of a bovine metabolism oligonucleotide gene array. J. Anim. Feed Sci. 13(Suppl. 1):385-388.

Evarts, J. L., J. J. Rasweiler, R. R. Behringer, L. Hennighausen and G. W. Robinson. 2004. A morphological and immunohistochemical comparison of mammary tissues from the short-tailed fruit bat (Carollia perspicillata) and the mouse. Biol. Reprod.70:1573-1579.

Finucane, K. A., T. B. McFadden, J. P. Bond, J. J. Kennelly and F. Q. Zhao. 2008. Onset of lactation in the bovine mammary gland: gene expression profiling indicates a strong inhibition of gene expression in cell proliferation. Funct. Integr. Genomics 8:251-264.

Fukumoto, H., S. Seino, H. Imura, Y. Seino, R. L. Eddy, Y. Fukushima, M. G. Byers, T. B. Shows and G. I. Bell. 1988. Sequence, tissue distribution, and chromosomal localization of mRNA encoding a human glucose transporter-like protein. Proc. Natl. Acad. Sci. USA 85:5434-5438.

Furuhashi, M. and G. S. Hotamisligil. 2008. Fatty acid-binding proteins: role in metabolic diseases and potential as drug targets. Nat. Rev. Drug Discov. 7:489-503.

Hartwell, J. R., M. J. Cecava, B. Miller and S. S. Donkin. 1999. Rumen rumen

pl. rumens, rumina; the largest of the compartments of the forestomach of ruminant animals that serves as a fermentating vat. It is lined by a keratinized epithelium bearing numerous absorptive papillae; it is partly subdivided by folds (pillars).
 protected choline choline: see vitamin.
choline

Organic compound related to vitamins in its activity. It is important in metabolism as a component of the lipids that make up cell membranes and of acetylcholine.
 and dietary protein for transition cows. J. Dairy Sci. 82 (Suppl. 1):125(Abstr.).

Heid, H. W., M. Schnolzer and T. W. Keenan. 1996. Adipocyte adipocyte /ad·i·po·cyte/ (-sit?) fat cell.

ad·i·po·cyte
n.
See fat cell.



adipocyte
 differentiation-related protein is secreted into milk as a constituent of milk lipid globule membrane. Biochem J. 320(Pt 3):1025-1030.

Hirsch, D., A. Stahl and H. F. Lodish. 1998. A family of fatty acid transporters conserved from mycobacterium mycobacterium

Any of the rod-shaped bacteria that make up the genus Mycobacterium. The two most important species cause tuberculosis and leprosy in humans; another species causes tuberculosis in both cattle and humans.
 to man. Proc. Natl. Acad. Sci. USA 95:8625-8629.

Hod, Y., J. S. Cook, S. L. Weldon, J. M. Short, A. Wynshaw-Boris and R. W. Hanson. 1986. Differential expression of the genes for the mitochondrial and cytosolic forms of phosphoenolpyruvate carboxykinase. Ann. NY Acad. Sci. 478:31-45.

Hood, R. L., E. H. Thompson and C. E. Allen. 1972. The role of acetate, propionate propionate /pro·pi·o·nate/ (pro´pe-o-nat) any salt of propionic acid.

pro·pi·o·nate
n.
A salt or ester of propionic acid.



propionate

any salt of propionic acid.
 and glucose as substrates for lipogenesis lipogenesis /lipo·gen·e·sis/ (-jen´e-sis) the formation of fat; the transformation of nonfat food materials into body fat.lipogenet´ic

lip·o·gen·e·sis
n.
1.
 in bovine tissues. Int. J. Biochem. 3:598-606.

Hunt, C. R., J. H. Ro, D. E. Dobson, H. Y. Min and B. M. Spiegelman. 1986. Adipocyte P2 gene: developmental expression and homology of 5'-flanking sequences among fat cell-specific genes. Proc. Natl. Acad. Sci. USA 83:3786-3790.

Kanai, Y. and M. A. Hediger. 2004. The glutamate/neutral amino acid transporter family SLC1: molecular, physiological and pharmacological aspects. Pflugers Arch. 447:469-479.

Livak, K. J. and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408.

Martin-Hidalgo, A., L. Huerta, N. Alvarez, G. Alegria, M. del Val Toledo and E. Herrera. 2005. Expression, activity, and localization of hormone-sensitive lipase in rat mammary gland during pregnancy and lactation. J. Lipid Res. 46:658-668.

Miyoshi, K., J. M. Shillingford, G. H. Smith, S. L. Grimm, K. U. Wagner, T. Oka, J. M. Rosen, G. W. Robinson and L. Hennighausen. 2001. Signal transducer and activator of transcription (Stat) 5 controls the proliferation and differentiation of mammary alveolar epithelium. J. Cell Biol. 155:531-542.

Moore, J. H. and W. W. Christie. 1979. Lipid metabolism in the mammary gland of ruminant animals. Prog. Lipid Res. 17:347- 395.

Muscher, A., G. Breves and K. Huber. 2008. Modulation of apical apical /ap·i·cal/ (ap´i-k'l) pertaining to an apex.

a·pi·cal
adj.
1. Relating to the apex of a pyramidal or pointed structure.

2.
 Na/P(i) cotransporter type IIb expression in epithelial cells of goat mammary glands. J. Anim. Physiol. Anim. Nutr (Berl). (Epub ahead of print).

Pfaffl, M. W., S. L. Wittmann, H. H. Meyer and R. M. Bruckmaier. 2003. Gene expression of immunologically important factors in blood cells, milk cells, and mammary tissue of cows. J. Dairy Sci. 86:538-545.

Pulverer, B. J., J. M. Kyriakis, J. Avruch, E. Nikolakaki and J. R. Woodgett. 1991. Phosphorylation phosphorylation, chemical process in which a phosphate group is added to an organic molecule. In living cells phosphorylation is associated with respiration, which takes place in the cell's mitochondria, and photosynthesis, which takes place in the chloroplasts.  of c-jun mediated by MAP kinases. Nature 17:670-674.

Rudolph, M. C., J. L. McManaman, T. Phang, T. Russell, D. J. Kominsky, N. J. Serkova, T. Stein, S. M. Anderson and M. C. Neville. 2007. Metabolic regulation in the lactating mammary gland: a lipid synthesizing machine. Physiol. Genomics 28:323-336.

Shillingford, J. M., D. T. Calvert, R. B. Beechey and D. B. Shennan. 1996. Phosphate transport via Na-Pi cotransport and anion exchange in lactating rat mammary tissue. Exp. Physiol. 81: 273-284.

Smith, S. B. and R. L. Prior. 1986. Comparisons of lipogenesis and glucose metabolism between ovine ovine

pertaining to, characteristic of, or derived from sheep.


ovine atopic dermatitis
symmetrical erythema, alopecia, lichenification, excoriation on woolless areas; sporadic cases, recur each summer.
 and bovine adipose tissues. J. Nutr. 116:1279-1286.

Stahl, A. 2004. A current review of fatty acid transport proteins (SLC27). Pflugers Arch. 447:722-727.

Stover, P. J. 2004. Nutritional genomics. Physiol. Genomics 16:161-165.

Subbaramaiah, K., R. Benezra, C. Hudis and A. J. Dannenberg. 2008. Cyclooxygenase-2-derived prostaglandin E2 stimulates Id-1 transcription. J. Biol. Chem. 5:33955-33968.

Turashvili, G., J. Bouchal, G. Burkadze and Z. Kolar. 2006. Wnt signaling pathway The Wnt signaling pathway describes a complex network of proteins most well known for their roles in embryogenesis and cancer, but also involved in normal physiological processes in adult animals.  in mammary gland development and carcinogenesis. Pathobiology pathobiology /patho·bi·ol·o·gy/ (-bi-ol´ah-je) pathology.

path·o·bi·ol·o·gy
n.
The study or practice of pathology with greater emphasis on the biological than on the medical aspects.
 73:213-223.

Vernon, R. G., A. Faulkner, E. Finley, H. Pollock and E. Taylor. 1987. Enzymes of glucose and fatty acid metabolism Fatty acids are an important source of energy for many organisms. Excess glucose can be stored efficiently as fat. Triglycerides yield more than twice as much energy for the same mass as do carbohydrates or proteins.  of liver, kidney, skeletal muscle, adipose tissue and mammary gland of lactating and non-lactating sheep. J. Anim. Sci. 64:1395-1411.

Verrey, F., E. I. Closs, C. A. Wagner, M. Palacin, H. Endou and Y. Kanai. 2004. CATs and HATs: the SLC7 family of amino acid transporters. Pflugers Arch. 447:532-542.

Wall, E. H., T. L. Auchtung-Montgomery, G. E. Dahl and T. B. McFadden. 2005. Short communication: Short day photoperiod photoperiod /pho·to·pe·ri·od/ (fo´to-per?e-od) the period of time per day that an organism is exposed to daylight (or to artificial light).photoperiod´ic

pho·to·pe·ri·od
n.
 during the dry period decreases expression of suppressors of cytokine signaling in the mammary gland of dairy cows. J. Dairy Sci. 88:3145-3148.

Weldon, S. L., A. Rando, A. S. Matathias, Y. Hod, P. A. Kalonick, A. Savon, J. S. Cook and R. W. Hanson. 1990. Mitochondrial phosphoenolpyruvate carboxykinase from the chicken. J. Biol. Chem. 265:7308-7317.

Winkelman, L. A., M. C. Lucy, T. H. Elsasser, J. L. Pate and C. K. Reynolds. 2008. Short communication: suppressor of cytokine signaling-2 mRNA increases after parturition in the liver of dairy cows. J. Dairy Sci. 91:1080-1086.

Xu, C., Z. Wang, G. Liu, X. Li, G. Xie and H. Zhang. 2008. Metabolic characteristic of the liver of dairy cows during ketosis ketosis /ke·to·sis/ (ke-to´sis) accumulation of excessive amounts of ketone bodies in body tissues and fluids, occurring when fatty acids are incompletely metabolized.ketot´ic

ke·to·sis
n. pl.
 based on comparative proteomics. Asian-Aust. J. Anim. Sci. 21:1003-1010.

Yamashita, A., H. Nakanishi, H. Suzuki, R. Kamata, K. Tanaka, K. Waku and T. Sugiura. 2007. Topology of acyltransferase motifs and substrate specificity and accessibility in 1-acyl-sn-glycero-3-phosphate acyltransferase 1. Biochim. Biophys. Acta. 1771:1202-1215.

Zhao, F. Q. and A. F. Keating. 2007. Expression and regulation of glucose transporters in the bovine mammary gland. J. Dairy Sci. 90 Suppl 1:E76-E86.

M. Baik *, B. E. Etchebarne (1), J. Bong and M. J. VandeHaar (1)

Major in Molecular Biotechnology, Biotechnology Research Institute, Inst. of Ag. Sci. and Tech. Chonnam National University Academics
Undergraduate offerings are divided among 15 departments: Business Administration, Engineering, Agriculture & Life Sciences, Law, Education, Social Sciences, Human Ecology, Veterinary Medicine, Pharmacy, Arts, Medicine, Humanities, Natural Sciences, Dentistry, and the
, Gwangju 500-757, Korea

* Corresponding Author: M. Baik. Tel: +82-62-530-2164, Fax: +82-62-530-2169, E-mail: mgbaik@chonnam.ac.kr

(1) Department of Animal Science, Michigan State University, East Lansing, MI 48824, USA.
Table 1. Primers used in real-time PCR

Gene name                    Accession No.

Aldolase B,                  BC102278.1
  fructose-bisphosphate
Alcohol dehydrogenase        XM_598754.2
  class II
Ornithine                    NM_177487.2
  carbamoyltransferase
Phosphoenolpyruvate          NM_174737.2
  carboxykinase 1
Glyceraldehyde-3-phosphate   BTU85042
  dehydrogenase
ATP citrate lyase            BC108138.1

Malic enzyme 1, NADP(+)-     XM_613987.2
  dependent, cytosolic
Splicing factor 1            XM_880876.1

Acetyl-Coenzyme A            XM_582906.2
  synthetase 2
Isocitrate dehydrogenase     NM_181012.2
  1 (NADP+), soluble
Alpha-lactalbumin            NM_174378.2

Fatty acid binding           NM_174314.2
  protein 4, adipocyte
NADH dehydrogenase           NM_175809.1
  (ubiquinone) 1 beta

Gene name                    Primer    Sequence (5'-3')

Aldolase B,                  Forward   GGAGTTGCTCCGCTTGCA
  fructose-bisphosphate      Reverse   GCGTTCAGAAAGGCCATCA
Alcohol dehydrogenase        Forward   TGGGCCGTACTCTAACTGGAA
  class II                   Reverse   AGTCAGCAGCCAGTTTTGGAA
Ornithine                    Forward   TGGCATCGAGCTGACAGACT
  carbamoyltransferase       Reverse   TGCCCATCCTCGTCATGA
Phosphoenolpyruvate          Forward   TGGCATCGAGCTGACAGACT
  carboxykinase 1            Reverse   TGCCCATCCTCGTCATGAT
Glyceraldehyde-3-phosphate   Forward   GCATCGTGGAGGGACTTATGA
  dehydrogenase              Reverse   GGGCCATCCACAGTCTTCTG
ATP citrate lyase            Forward   TCATTGAGATGTGCCTGATGGT
                             Reverse   TGGTGTTATGAGCCCCAGAGA
Malic enzyme 1, NADP(+)-     Forward   AACCAACTGCCCTCATTGGA
  dependent, cytosolic       Reverse   TGAAGGCTGCCATGTCTTTG
Splicing factor 1            Forward   AAACATTCTGAAGCAGGGTATCG
                             Reverse   GCCAACTCTCGAAGTTGCATCT
Acetyl-Coenzyme A            Forward   GCAGACATTGGCTGGATCACT
  synthetase 2               Reverse   AAAACACTGGTGGCACCATTG
Isocitrate dehydrogenase     Forward   TTTGGGCCTGTAAGAACTATGATG
  1 (NADP+), soluble         Reverse   TGCCGAGAGAGCCATAACCT
Alpha-lactalbumin            Forward   CCCCGTGGCTACCTCGTT
                             Reverse   GGGCCCAGGGCTCAGA
Fatty acid binding           Forward   GCGTGGGCTTTGCTACCA
  protein 4, adipocyte       Reverse   CCCCATTCAAACTGATGATCAA
NADH dehydrogenase           Forward   GCCGCAGCATTCATGATG
  (ubiquinone) 1 beta        Reverse   GACAAATCCCATAGGGACAAGTACA

Gene name                    Primer     Product
                                       size (bp)

Aldolase B,                  Forward       69
  fructose-bisphosphate      Reverse
Alcohol dehydrogenase        Forward       75
  class II                   Reverse
Ornithine                    Forward       63
  carbamoyltransferase       Reverse
Phosphoenolpyruvate          Forward       71
  carboxykinase 1            Reverse
Glyceraldehyde-3-phosphate   Forward       66
  dehydrogenase              Reverse
ATP citrate lyase            Forward       66
                             Reverse
Malic enzyme 1, NADP(+)-     Forward       78
  dependent, cytosolic       Reverse
Splicing factor 1            Forward       75
                             Reverse
Acetyl-Coenzyme A            Forward       74
  synthetase 2               Reverse
Isocitrate dehydrogenase     Forward       72
  1 (NADP+), soluble         Reverse
Alpha-lactalbumin            Forward       67
                             Reverse
Fatty acid binding           Forward       68
  protein 4, adipocyte       Reverse
NADH dehydrogenase           Forward       74
  (ubiquinone) 1 beta        Reverse

Table 2. List of gene ontologies of differential gene expression
profile between liver and mammary tissues of lactating dairy cows

Gene ontology                             # genes   >2-fold higher
                                                        in liver

Carbohydrate metabolism                      154        74 (49%)
  Glycolysis                                  27         5 (19%)
  Gluconeogenesis                             15         5 (33%)
  Pentose-phophate shunt                       5         0 (0%)
  Lactose biosynthetic process                 3         0 (0%)
  Propanoate metabolism                        7         7 (100%)
  Butanoate metabolism                         7         7 (100%)
  Alcohol dehydrogenase and ethanol            5         5 (100%)
    metabolic process
  Electron carrier and electron donor         85        43 (51%)
    activity
Lipid metabolism                             212        76 (36%)
  Fatty acid biosynthetic process             22         3 (14%)
  Triacylglyceride Synthesis                  24         3 (13%)
  Fatty acid oxidation                        44        21 (48%)
    Fatty acid alpha-oxidation                 1         1 (100%)
    Fatty acid beta-oxidation                 32        10 (31%)
    Fatty acid omega-oxidation                11        10 (91%)
  Chylomicron/ lipid transport                13         4 (31%)
  Long chain fatty acid transport              1         0 (0%)
  Lipid transporter activity                   3         2 (67%)
  Fatty acid binding                           7         1 (14%)
  Bile acid metabolic and biosynthesis        32        18 (56%)
    process
  Cholesterol metabolic process               23         8 (35%)
    Cholesterol biosynthetic process          16         6 (38%)
    Cholesterol absorption                     7         2 (29%)
  Steroid and glucocorticoid metabolism        7         4 (57%)
  Synthesis and degradation of ketone          5         1 (20%)
    bodies
  Arachidonic acid metabolism                 18         0 (0%)
  Phospholipase D activity                     2         1 (100%)
Amino acid/nitrogen metabolism               110        62 (56%)
  Amino acid biosynthetic process             10         6 (60%)
  Amino acid catabolic process                40        31 (78%)
    L-phenylalanine and tyrosine               9         6 (67%)
      catabolic process
    Lysine degradation                         9         9 (100%)
    Valine, leucine and isoleucine            10        10 (100%)
      degradation
    Arginine catabolic process                 7         2 (29%)
  Urea cycle                                  21         9 (43%)
  Glutathione metabolic process and           21        10 (48%)
    glutathione transferase activity
  Antioxidant activity and Oxidative          23        10 (43%)
    stress
Cytochrome p450, Heme binding, and            14        13 (93%)
  Response to xenobiotic stimulus
Blood coagulation                             19        11 (58%)
Transporter                                   48         9 (19%)
  Sugar porter activity                       12         1 (8%)
  Fatty acid transporter                       5         2 (40%)
  Amino acid transport                        14         0 (0%)
  Symporter activity                          12         1 (8%)
  Sodium:phosphate symporter actvity           3         1 (33%)
Signal transduction                           50        12 (24%)
  MAPK signaling                              28        10 (36%)
  Wnt signaling                                6         0 (0%)
  JAK-STAT signaling                          14         2 (14%)
  mTOR/PDK/Akt signaling                       2         0 (0%)
All genes on array                         2,349       222 (9%)

Gene ontology                             >2-fold higher in
                                            mammary tissue

Carbohydrate metabolism                      10 (4%)
  Glycolysis                                  1 (4%)
  Gluconeogenesis                             1 (7%)
  Pentose-phophate shunt                      0 (0%)
  Lactose biosynthetic process                2 (67%)
  Propanoate metabolism                       0 (0%)
  Butanoate metabolism                        0 (0%)
  Alcohol dehydrogenase and ethanol           0 (0%)
    metabolic process
  Electron carrier and electron donor         4 (5%)
    activity
Lipid metabolism                             28(13%)
  Fatty acid biosynthetic process             2 (9%)
  Triacylglyceride Synthesis                  2 (8%)
  Fatty acid oxidation                        3 (7%)
    Fatty acid alpha-oxidation                0 (0%)
    Fatty acid beta-oxidation                 3 (9%)
    Fatty acid omega-oxidation                0 (0%)
  Chylomicron/ lipid transport                0 (0%)
  Long chain fatty acid transport             1 (100%)
  Lipid transporter activity                  0 (0%)
  Fatty acid binding                          3 (43%)
  Bile acid metabolic and biosynthesis        0 (0%)
    process
  Cholesterol metabolic process               0 (0%)
    Cholesterol biosynthetic process          0 (0%)
    Cholesterol absorption                    0 (0%)
  Steroid and glucocorticoid metabolism       0 (0%)
  Synthesis and degradation of ketone         0 (0%)
    bodies
  Arachidonic acid metabolism                 7 (39%)
  Phospholipase D activity                    0 (0%)
Amino acid/nitrogen metabolism                7 (6%)
  Amino acid biosynthetic process             0 (0%)
  Amino acid catabolic process                1 (3%)
    L-phenylalanine and tyrosine              0 (0%)
      catabolic process
    Lysine degradation                        0 (0%)
    Valine, leucine and isoleucine            0 (0%)
      degradation
    Arginine catabolic process                1 (14%)
  Urea cycle                                  1 (5%)
  Glutathione metabolic process and           4 (19%)
    glutathione transferase activity
  Antioxidant activity and Oxidative          1 (4%)
    stress
Cytochrome p450, Heme binding, and            0 (0%)
  Response to xenobiotic stimulus
Blood coagulation                             2 (11%)
Transporter                                  11 (23%)
  Sugar porter activity                       0 (0%)
  Fatty acid transporter                      0 (0%)
  Amino acid transport                        7 (50%)
  Symporter activity                          1 (8%)
  Sodium:phosphate symporter actvity          1 (33%)
Signal transduction                          22 (44%)
  MAPK signaling                             12 (43%)
  Wnt signaling                               6 (100%)
  JAK-STAT signaling                          2 (14%)
  mTOR/PDK/Akt signaling                      2 (100%)
All genes on array                          176 (7%)

The right columns show the number and percentage of genes that were
expressed at >2-fold in liver or mammary tissue at p<0.05.  Some genes
are included in multiple pathways in the gene ontology analysis.

Table 3. Validation of array-based gene expression profile by real-time
PCR

                                  Relative  expression (1)
Gene name
                                  Microarray (2)   p value

Aldolase B                             58           0.01
Alcohol dehydrogenase class II         51           0.003
Ornithine carbamoyltransferase         50           0.006
Phosphoenolpyruvate                    17           0.009
  carboxykinase 1
Glyceraldehyde-3-phosphate              3.3         0.003
  dehydrogenase
ATP citrate lyase                       1.8         0.05
Malic enzyme 1, NADP(+)-                1.2         0.37
  dependent, cytosolic
Splicing factor 1                       1.1         0.4
Acetyl-coenzyme A synthetase 2          0.4         0.04
Isocitrate dehydrogenase 1              0.3         0.03
  (NADP+), soluble
Alpha-lactalbumin                       0.09        0.007
Fatty acid binding protein 4,           0.04        0.005
  adipocyte

                                    Relative  expression (1)
Gene name
                                  Real-time PCR (3)   p value

Aldolase B                           5,506            <0.001
Alcohol dehydrogenase class II     306,388            <0.001
Ornithine carbamoyltransferase       4,488             0.003
Phosphoenolpyruvate                  5,493             0.005
  carboxykinase 1
Glyceraldehyde-3-phosphate               7            <0.001
  dehydrogenase
ATP citrate lyase                        6.4           0.001
Malic enzyme 1, NADP(+)-                 1.9           0.18
  dependent, cytosolic
Splicing factor 1                        1.0           0.5
Acetyl-coenzyme A synthetase 2           0.26          0.003
Isocitrate dehydrogenase 1               0.22          0.009
  (NADP+), soluble
Alpha-lactalbumin                        0.00002      <0.001
Fatty acid binding protein 4,            0.0003        0.009
  adipocyte

Gene name                         Validation
                                   (yes/no)

Aldolase B                             Y
Alcohol dehydrogenase class II         Y
Ornithine carbamoyltransferase         Y
Phosphoenolpyruvate                    Y
  carboxykinase 1
Glyceraldehyde-3-phosphate             Y
  dehydrogenase
ATP citrate lyase                      Y
Malic enzyme 1, NADP(+)-               Y
  dependent, cytosolic
Splicing factor 1                      Y
Acetyl-coenzyme A synthetase 2         Y
Isocitrate dehydrogenase 1             Y
  (NADP+), soluble
Alpha-lactalbumin                      Y
Fatty acid binding protein 4,          Y
  adipocyte

(1) Relative expression was calculated as ratio of expression levels
in liver/mammary tissues.

(2) Microarray: 6 slides (dye swap) of 3 animals.

(3) Gene expression levels were measured with the real time PCR and
normalized to NADH dehydrogenase (ubiquinone) 1 beta (ndufb1) using
ddCt method of relative quantification.

Table 4. Selected gene lists based on pathway analyses (1)

                                                 Ratio
Gene name                             Symbol     (L/MG) (2)   p value

Carbohydrate metabolism
 Glycolysis
  aldolase A, fructose-bisphosphate   ALDOA          0.43     0.043
  aldolase B, fructose-bisphosphate   ALDOB         58.3      0.012
  aldolase C, fructose-bisphosphate   ALDOC          0.46     0.108
  glyceraldehyde-3-phosphate          GAPDH          3.26     0.003
   dehydrogenase
  glucose phosphate isomerase         GPI            1.93     0.006
  hexokinase 3 (white cell)           HK3            2.96     0.008
  6-phosphofructo-2-kinase/           PFKFB1         8.10     0.02
   fructose-2,6-biphosphatase 1
  pyruvate kinase, liver and RBC      PKLR           2.22     0.061
  pyruvate kinase, muscle             PKM2           0.61     0.055
  triosephosphate isomerase 1         TPI1           2.89     0.004
 Gluconeogenesis
  fructose-1,6-bisphosphatase 1       FBP1           3.41     0.0001
  fructose-1,6-bisphosphatase 2       FBP2           0.75     0.02
  phosphoenolpyruvate                 PCK1          17.3      0.009
   carboxykinase 1 (soluble)
  phosphoenolpyruvate                 PCK2           1.71     0.071
   carboxykinase 2 (mitochondrial)
  6-phosphofructo-2-kinase/           PFKFB1         8.10     0.02
   fructose-2,6-biphosphatase 1
  triosephosphate isomerase 1         TPI1           2.89     0.004
  glucose-6-phosphatase,              G6PC          13.1      0.017
   catalytic (glycogen)
   storage disease type I, von
   Gierke disease)
 Pentose phosphate pathway
  glucose phosphate isomerase         GPI            1.93     0.006
  glucose-6-phosphate dehydrogenase   G6PD           0.76     0.162
  6-phosphogluconolactonase           PGLS           0.70     0.042
  phosphogluconate dehydrogenase      PGD            0.66     0.055
  transaldolase 1                     TALDO1         0.53     0.131
 Lactose biosynthetic process
  UDP-Gal:betaGlcNAc                  B4GALT1        0.30     0.086
   beta 1,4- galactosyltransferase,
   polypeptide 1
  lactalbumin, alpha-                 LALBA          0.09     0.007
  UDP-glucose pyrophosphorylase 2     UGP2           0.68     0.04

Lipid metabolism
 Fatty acid biosynthetic process
  ATP citrate lyase                   ACLY           1.75     0.05
  acetyl-Coenzyme A carboxylase       ACACA          0.28     0.031
   alpha
  fatty acid synthase                 FASN           0.58     0.02
  acetyl-Coenzyme A                   ACAA1          4.54     0.007
   acyltransferase 1
  (peroxisomal 3-oxoacyl-Coenzyme
   A thiolase)
  acetyl-Coenzyme A                   ACAA2          9.53     0.000
   acyltransferase 2
   (mitochondrial 3-oxoacyl-
   Coenzyme A thiolase)
  enoyl Coenzyme A hydratase,         ECHS1          2.84     0.048
   short chain, 1, mitochondrial
  isocitrate dehydrogenase 1          IDH1           0.30     0.023
   (NADP+), soluble
 Triacylglyceride synthesis
  acyl-CoA synthetase long-chain      ACSL1          0.76     0.178
   family member 1
  acyl-CoA synthetase long-chain      ACSL3          0.90     0.467
   family member 3
  acyl-CoA synthetase long-chain      ACSL4          1.57     0.072
   family member 4
  acyl-CoA synthetase long-chain      ACSL5         13.9      0.003
   family member 5
  acyl-CoA synthetase long-chain      ACSL6          1.05     0.754
   family member 6
  lipoprotein lipase                  LPL            0.09     0.031
  lipase, hormone-sensitive           LIPE           0.43     0.033
  lipase, hepatic                     LIPC           6.04     0.023
  glycerol-3-phosphate                GPAM           0.04     0.005
   acyltransferase, mitochondrial
  1-acylglycerol-3-phosphate O-       AGPAT1         0.62     0.091
   acyltransferase 1
   (lysophosphatidic acid
   acyltransferase, alpha)
  1-acylglycerol-3-phosphate          AGPAT2         5.38     0.023
   O-acyltransferase 2
   (lysophosphatidic acid
   acyltransferase, beta)
  1-acylglycerol-3-phosphate          AGPAT3         1.26     0.059
   O-acyltransferase 3
  1-acylglycerol-3-phosphate          AGPAT4         0.96     0.684
   O-acyltransferase 4
   (lysophosphatidic acid
   acyltransferase, delta)
 Fatty acid oxidation
  hydroxyacid oxidase (glycolate      HAO1           6.17     0.018
   oxidase) 1
  acyl-Coenzyme A dehydrogenase,      ACADS          7.83     0.003
   C-2 to C-3 short chain
  acyl-Coenzyme A dehydrogenase,      ACADL          2.13     0.046
   long chain
  acyl-Coenzyme A dehydrogenase,      ACADVL         1.83     0.047
   very long chain
  acyl-Coenzyme A oxidase 1,          ACOX1          6.53     0.003
   palmitoyl
  acyl-Coenzyme A oxidase 2,          ACOX2          4.69     0.009
   branched chain
  acyl-Coenzyme A oxidase 3,          ACOX3          1.96     0.088
   pristanoyl
  enoyl Coenzyme A hydratase,         ECHS1          2.84     0.048
   short chain, 1, mitochondrial
  hydroxyacyl-Coenzyme A              HADHB         10.8      0.011
   dehydrogenase/
   3-ketoacyl-Coenzyme A thiolase/
    enoyl-Coenzyme
   A hydratase (trifunctional
    protein), beta subunit
  triosephosphate isomerase 1         TPI1           2.89     0.004
  acetyl-Coenzyme A synthetase 2      ACAS2          0.37     0.042
   (ADP forming)
  2,4-dienoyl CoA reductase 1,        DECR1          4.55     0.001
   mitochondrial
   peroxisome proliferative           PPARGC1A       0.76     0.058
    activated receptor,
    gamma, coactivator 1, alpha
  peroxisome proliferative            PPARA          2.54     0.064
   activated receptor, alpha
 Long chain fatty acid transport
  adipose differentiation-related     ADRP           0.06     0.002
   protein
 Fatty acid binding
  fatty acid binding protein 1,       FABP1         27.7      0.005
   liver
  fatty acid binding protein 2,       FABP2          1.14     0.369
   intestinal
  fatty acid binding protein 3,       FABP3          0.01     0.003
   muscle and heart
   (mammary-derived growth
   inhibitor)
  fatty acid binding protein 4,       FABP4          0.04     0.005
   adipocyte
  fatty acid binding protein 5        FABP5          0.46     0.273
   (psoriasis-associated)
  fatty acid binding protein 6,       FABP6          1.03     0.58
   ileal (gastrotropin)
  fatty acid binding protein 7,       FABP7          1.25     0.155
   brain
 Arachidonic acid metabolism
  arachidonate 12-lipoxygenase        ALOX12         0.37     0.266
  arachidonate 15-lipoxygenase        ALOX15         0.11     0.011
  prostaglandin D2 synthase 21kDa     PTGDS          0.35     0.044
   (brain)
  prostaglandin-endoperoxide          PTGS2          0.46     0.025
   synthase 2
   (prostaglandin G/H synthase
   and cyclooxygenase)
Transporter
 Sugar porter
  solute carrier family 2             SLC2A1         0.69     0.092
   (facilitated glucose               (GLUT1)
   transporter), member 1
  solute carrier family 2             SLC2A2         5.61     0.012
   (facilitated glucose               (GLUT2)
   transporter), member 2
  solute carrier family 2             SLC2A4         0.67     0.018
   (facilitated glucose               (GLUT4)
   transporter), member 4
  solute carrier family 2,            SLC2A8         0.90     0.228
   (facilitated glucose               (GLUT8)
   transporter) member 8
 Fatty acid transporter
  solute carrier family 27            SLC27A2        7.41     0.014
   (fatty acid transporter),          (FATP2)
   member 2
  solute carrier family 27 (fatty     SLC27A3        0.68     0.001
   acid transporter), member 3        (FATP3)
  solute carrier family 27 (fatty     SLC27A4        0.99     0.61
   acid transporter), member 4        (FATP4)
  solute carrier family 27 (fatty     SLC27A5        2.49     0.019
   acid transporter), member 5        (FATP5)
  solute carrier family 27 (fatty     SLC27A6        0.66     0.214
   acid transporter), member 6        (FATP6)
 Amino acid transport
  solute carrier family 38,           SLC38A2        0.24     0.002
   member 2
  solute carrier family 38,           SLC38A3        0.21     0.023
   member 3
  solute carrier family 7             SLC7A3         1.05     0.549
   (cationic amino acid
   transporter, y+ system),
   member 3
  solute carrier family 7             SLC7A5         0.45     0.009
   (cationic amino acid
   transporter, y+ system),
   member 5
  solute carrier family 7             SLC7A7         0.18     0.035
   (cationic amino acid
   transporter, y+ system),
   member 7
  solute carrier family 7             SLC7A8         1.67     0.065
   (cationic amino acid
   transporter, y+ system),
   member 8
  solute carrier family 7             SLC7A9         1.19     0.478
   (cationic amino acid
   transporter, y+ system),
   member 9
  solute carrier family 1             SLC1A1         1.23     0.088
   (neuronal/epithelial high
   affinity glutamate transporter,
   system Xag), member 1
  solute carrier family 1             SLC1A2         0.32     0.023
   (glial high affinity glutamate
   transporter), member 2
  solute carrier family 1 (glial      SLC1A3         1.18     0.053
   high affinity glutamate
   transporter), member 3
  solute carrier family 1             SLC1A4         0.41     0.038
   (glutamate/neutral amino acid
   transporter), member 4
  solute carrier family 1 (neutral    SLC1A5         0.41     0.04
   amino acid transporter),
   member 5
 Symporter
  solute carrier family 23            SLC23A1        9.27     0.018
   (nucleobase transporters),
   member 1
  solute carrier family 23            SLC23A2        0.89     0.41
   (nucleobase transporters),
   member 2
  solute carrier family 34            SLC34A1        0.99     0.962
   (sodium phosphate), member 1
  solute carrier family 34            SLC34A2        0.01     0.003
   (sodium phosphate), member 2
  solute carrier family 6             SLC6A1         0.61     0.046
   (neurotransmitter transporter,
   GABA), member 1
  solute carrier family 6             SLC6A2         0.78     0.385
   (neurotransmitter transporter,
   noradrenalin), member 2
  solute carrier family 6             SLC6A3         0.91     0.539
   (neurotransmitter transporter,
   dopamine), member 3
  solute carrier family 6             SLC6A4         1.96     0.047
   (neurotransmitter transporter,
   serotonin), member 4
  solute carrier family 6             SLC6A6         1.37     0.092
   (neurotransmitter transporter,
   taurine), member 6
 Anion:cation symporter
  solute carrier family 17 (sodium    SLC17A2       13.15     0.012
   phosphate), member 2
  solute carrier family 20            SLC20A1        1.79     0.056
   (phosphate transporter),
   member 1
  solute carrier family 20            SLC20A2        0.06     0.01
   (phosphate transporter),
   member 2
  solute carrier family 9             SLC9A3R1       0.05     0.019
   (sodium/hydrogen exchanger),
   isoform 3 regulator 1
  solute carrier family 25            SLC25A6        0.45     0.007
   (mitochondrial carrier;
   adenine nucleotide
   translocator), member 6

Signal transduction
 MAPK signaling
  mitogen-activated protein           MAPK6          2.84     0.021
   kinase 6
  activating transcription factor 4   ATF4           0.43     0.02
   (tax-responsive enhancer
   element B67)
  tumor necrosis factor (TNF          TNF            0.09     0.005
   superfamily, member 2)
  transforming growth factor,         TGFB1          0.47     0.082
   beta 1
   (Camurati-Engelmann disease)
  transforming growth factor,         TGFB2          0.43     0.018
   beta 2
  transforming growth factor,         TGFB3          0.60     0.019
   beta 3
  transforming growth factor,         TGFBR3         0.60     0.014
   beta receptor III
   (betaglycan, 300kDa)
  transforming growth factor,         TGFBR2         0.62     0.01
   beta receptor II (70/80 kDa)
  mitogen-activated protein           MAPK12         0.10     0.000
   kinase 12
  mitogen-activated protein           MAPKAPK2        2.16    0.007
   kinase-activated protein
   kinase 2
  Ras-related associated with         RRAD           0.09     0.02
   diabetes
 Wnt signaling
  wingless-type MMTV integration      WNT5A          0.35     0.047
   site family, member 5A
  frizzled homolog 1 (Drosophila)     FZD1           0.50     0.026
  protein kinase C, beta 1            PRKCB1         0.09     0.02
  protein kinase C, eta               PRKCH          0.31     0.015
  v-jun sarcoma virus 17 oncogene     JUN            0.04     0.001
   homolog (avian)
  plasminogen activator, urokinase    PLAU           0.31     0.007
 JAK-STAT signaling
  suppressor of cytokine              SOCS1          0.58     0.033
   signaling 1
  suppressor of cytokine              SOCS2          0.70     0.04
   signaling 2
  suppressor of cytokine              SOCS3          0.17     0.006
   signaling 3
  suppressor of cytokine              SOCS5          0.58     0.056
   signaling 5
 mTOR/PDK/Akt signaling
  tuberous sclerosis 1                TSC1           0.14     0.04
  glycogen synthase kinase 3 alpha    GSK3A          2.11     0.001

                                                     Abundance of
                                                  expression level (3)

Gene name                             Symbol      Liver   Mammary

Carbohydrate metabolism
 Glycolysis
  aldolase A, fructose-bisphosphate   ALDOA       0.13%    0.30%
  aldolase B, fructose-bisphosphate   ALDOB      23.70%    0.41%
  aldolase C, fructose-bisphosphate   ALDOC       0.30%    0.65%
  glyceraldehyde-3-phosphate          GAPDH       3.10%    0.95%
   dehydrogenase
  glucose phosphate isomerase         GPI         0.29%    0.15%
  hexokinase 3 (white cell)           HK3         2.85%    0.96%
  6-phosphofructo-2-kinase/           PFKFB1      0.43%    0.05%
   fructose-2,6-biphosphatase 1
  pyruvate kinase, liver and RBC      PKLR        0.26%    0.12%
  pyruvate kinase, muscle             PKM2        1.20%    1.95%
  triosephosphate isomerase 1         TPI1        0.62%    0.21%
 Gluconeogenesis
  fructose-1,6-bisphosphatase 1       FBP1        1.05%    0.31%
  fructose-1,6-bisphosphatase 2       FBP2        0.04%    0.05%
  phosphoenolpyruvate                 PCK1        3.53%    0.20%
   carboxykinase 1 (soluble)
  phosphoenolpyruvate                 PCK2        0.32%    0.19%
   carboxykinase 2 (mitochondrial)
  6-phosphofructo-2-kinase/           PFKFB1      0.43%    0.05%
   fructose-2,6-biphosphatase 1
  triosephosphate isomerase 1         TPI1        0.62%    0.21%
  glucose-6-phosphatase,              G6PC        2.34%    0.18%
   catalytic (glycogen)
   storage disease type I, von
   Gierke disease)
 Pentose phosphate pathway
  glucose phosphate isomerase         GPI         0.29%    0.15%
  glucose-6-phosphate dehydrogenase   G6PD        0.20%    0.26%
  6-phosphogluconolactonase           PGLS        0.38%    0.55%
  phosphogluconate dehydrogenase      PGD         0.12%    0.18%
  transaldolase 1                     TALDO1      0.22%    0.42%
 Lactose biosynthetic process
  UDP-Gal:betaGlcNAc                  B4GALT1     1.37%    4.49%
   beta 1,4- galactosyltransferase,
   polypeptide 1
  lactalbumin, alpha-                 LALBA       7.90%   85.70%
  UDP-glucose pyrophosphorylase 2     UGP2        0.50%    0.74%

Lipid metabolism
 Fatty acid biosynthetic process
  ATP citrate lyase                   ACLY        0.10%    0.06%
  acetyl-Coenzyme A carboxylase       ACACA       0.53%    1.91%
   alpha
  fatty acid synthase                 FASN        2.01%    3.49%
  acetyl-Coenzyme A                   ACAA1       0.42%    0.09%
   acyltransferase 1
  (peroxisomal 3-oxoacyl-Coenzyme
   A thiolase)
  acetyl-Coenzyme A                   ACAA2       1.04%    0.11%
   acyltransferase 2
   (mitochondrial 3-oxoacyl-
   Coenzyme A thiolase)
  enoyl Coenzyme A hydratase,         ECHS1       4.49%    1.58%
   short chain, 1, mitochondrial
  isocitrate dehydrogenase 1          IDH1        1.95%    6.43%
   (NADP+), soluble
 Triacylglyceride synthesis
  acyl-CoA synthetase long-chain      ACSL1       0.11%    0.13%
   family member 1
  acyl-CoA synthetase long-chain      ACSL3       0.11%    0.12%
   family member 3
  acyl-CoA synthetase long-chain      ACSL4       0.21%    0.13%
   family member 4
  acyl-CoA synthetase long-chain      ACSL5       1.34%    0.10%
   family member 5
  acyl-CoA synthetase long-chain      ACSL6       0.10%    0.10%
   family member 6
  lipoprotein lipase                  LPL         2.15%   23.89%
  lipase, hormone-sensitive           LIPE        0.08%    0.18%
  lipase, hepatic                     LIPC        0.87%    0.14%
  glycerol-3-phosphate                GPAM        0.29%    7.12%
   acyltransferase, mitochondrial
  1-acylglycerol-3-phosphate O-       AGPAT1      0.84%    1.35%
   acyltransferase 1
   (lysophosphatidic acid
   acyltransferase, alpha)
  1-acylglycerol-3-phosphate          AGPAT2      0.17%    0.03%
   O-acyltransferase 2
   (lysophosphatidic acid
   acyltransferase, beta)
  1-acylglycerol-3-phosphate          AGPAT3      0.27%    0.22%
   O-acyltransferase 3
  1-acylglycerol-3-phosphate          AGPAT4      0.28%    0.29%
   O-acyltransferase 4
   (lysophosphatidic acid
   acyltransferase, delta)
 Fatty acid oxidation
  hydroxyacid oxidase (glycolate      HAO1        0.94%    0.15%
   oxidase) 1
  acyl-Coenzyme A dehydrogenase,      ACADS       0.93%    0.12%
   C-2 to C-3 short chain
  acyl-Coenzyme A dehydrogenase,      ACADL       0.49%    0.23%
   long chain
  acyl-Coenzyme A dehydrogenase,      ACADVL      0.38%    0.21%
   very long chain
  acyl-Coenzyme A oxidase 1,          ACOX1       0.66%    0.10%
   palmitoyl
  acyl-Coenzyme A oxidase 2,          ACOX2       0.70%    0.15%
   branched chain
  acyl-Coenzyme A oxidase 3,          ACOX3       0.08%    0.04%
   pristanoyl
  enoyl Coenzyme A hydratase,         ECHS1       4.49%    1.58%
   short chain, 1, mitochondrial
  hydroxyacyl-Coenzyme A              HADHB       0.77%    0.07%
   dehydrogenase/
   3-ketoacyl-Coenzyme A thiolase/
    enoyl-Coenzyme
   A hydratase (trifunctional
    protein), beta subunit
  triosephosphate isomerase 1         TPI1        0.62%    0.21%
  acetyl-Coenzyme A synthetase 2      ACAS2       0.51%    1.37%
   (ADP forming)
  2,4-dienoyl CoA reductase 1,        DECR1       0.51%    0.11%
   mitochondrial
   peroxisome proliferative           PPARGC1A    0.47%    0.62%
    activated receptor,
    gamma, coactivator 1, alpha
  peroxisome proliferative            PPARA       3.91%    1.54%
   activated receptor, alpha
 Long chain fatty acid transport
  adipose differentiation-related     ADRP        0.19%    3.17%
   protein
 Fatty acid binding
  fatty acid binding protein 1,       FABP1      14.20%    0.51%
   liver
  fatty acid binding protein 2,       FABP2       0.02%    0.02%
   intestinal
  fatty acid binding protein 3,       FABP3       0.23%   19.23%
   muscle and heart
   (mammary-derived growth
   inhibitor)
  fatty acid binding protein 4,       FABP4       0.08%    2.26%
   adipocyte
  fatty acid binding protein 5        FABP5       1.36%    2.99%
   (psoriasis-associated)
  fatty acid binding protein 6,       FABP6       0.11%    0.11%
   ileal (gastrotropin)
  fatty acid binding protein 7,       FABP7       0.02%    0.02%
   brain
 Arachidonic acid metabolism
  arachidonate 12-lipoxygenase        ALOX12      1.05%    2.83%
  arachidonate 15-lipoxygenase        ALOX15      0.08%    0.72%
  prostaglandin D2 synthase 21kDa     PTGDS       0.54%    1.57%
   (brain)
  prostaglandin-endoperoxide          PTGS2       0.63%    1.37%
   synthase 2
   (prostaglandin G/H synthase
   and cyclooxygenase)
Transporter
 Sugar porter
  solute carrier family 2             SLC2A1      1.57%    2.26%
   (facilitated glucose               (GLUT1)
   transporter), member 1
  solute carrier family 2             SLC2A2      0.67%    0.12%
   (facilitated glucose               (GLUT2)
   transporter), member 2
  solute carrier family 2             SLC2A4      0.27%    0.40%
   (facilitated glucose               (GLUT4)
   transporter), member 4
  solute carrier family 2,            SLC2A8      0.39%    0.44%
   (facilitated glucose               (GLUT8)
   transporter) member 8
 Fatty acid transporter
  solute carrier family 27            SLC27A2     0.64%    0.09%
   (fatty acid transporter),          (FATP2)
   member 2
  solute carrier family 27 (fatty     SLC27A3     0.24%    0.36%
   acid transporter), member 3        (FATP3)
  solute carrier family 27 (fatty     SLC27A4     1.31%    1.35%
   acid transporter), member 4        (FATP4)
  solute carrier family 27 (fatty     SLC27A5     0.71%    0.29%
   acid transporter), member 5        (FATP5)
  solute carrier family 27 (fatty     SLC27A6     0.15%    0.22%
   acid transporter), member 6        (FATP6)
 Amino acid transport
  solute carrier family 38,           SLC38A2     0.19%    0.76%
   member 2
  solute carrier family 38,           SLC38A3     0.86%    4.11%
   member 3
  solute carrier family 7             SLC7A3      0.16%    0.16%
   (cationic amino acid
   transporter, y+ system),
   member 3
  solute carrier family 7             SLC7A5      0.31%    0.68%
   (cationic amino acid
   transporter, y+ system),
   member 5
  solute carrier family 7             SLC7A7      1.10%    6.22%
   (cationic amino acid
   transporter, y+ system),
   member 7
  solute carrier family 7             SLC7A8      1.28%    0.77%
   (cationic amino acid
   transporter, y+ system),
   member 8
  solute carrier family 7             SLC7A9      0.88%    0.74%
   (cationic amino acid
   transporter, y+ system),
   member 9
  solute carrier family 1             SLC1A1      0.12%    0.10%
   (neuronal/epithelial high
   affinity glutamate transporter,
   system Xag), member 1
  solute carrier family 1             SLC1A2      0.14%    0.43%
   (glial high affinity glutamate
   transporter), member 2
  solute carrier family 1 (glial      SLC1A3      0.12%    0.11%
   high affinity glutamate
   transporter), member 3
  solute carrier family 1             SLC1A4      0.13%    0.33%
   (glutamate/neutral amino acid
   transporter), member 4
  solute carrier family 1 (neutral    SLC1A5      0.53%    1.30%
   amino acid transporter),
   member 5
 Symporter
  solute carrier family 23            SLC23A1     0.32%    0.04%
   (nucleobase transporters),
   member 1
  solute carrier family 23            SLC23A2     0.04%    0.04%
   (nucleobase transporters),
   member 2
  solute carrier family 34            SLC34A1     2.09%    2.10%
   (sodium phosphate), member 1
  solute carrier family 34            SLC34A2     0.19%   13.10%
   (sodium phosphate), member 2
  solute carrier family 6             SLC6A1      0.80%    1.31%
   (neurotransmitter transporter,
   GABA), member 1
  solute carrier family 6             SLC6A2      0.42%    0.54%
   (neurotransmitter transporter,
   noradrenalin), member 2
  solute carrier family 6             SLC6A3      0.33%    0.36%
   (neurotransmitter transporter,
   dopamine), member 3
  solute carrier family 6             SLC6A4      0.24%    0.12%
   (neurotransmitter transporter,
   serotonin), member 4
  solute carrier family 6             SLC6A6      6.88%    5.04%
   (neurotransmitter transporter,
   taurine), member 6
 Anion:cation symporter
  solute carrier family 17 (sodium    SLC17A2     1.15%    0.09%
   phosphate), member 2
  solute carrier family 20            SLC20A1    34.70%   19.40%
   (phosphate transporter),
   member 1
  solute carrier family 20            SLC20A2     1.14%   17.80%
   (phosphate transporter),
   member 2
  solute carrier family 9             SLC9A3R1    0.98%   20.30%
   (sodium/hydrogen exchanger),
   isoform 3 regulator 1
  solute carrier family 25            SLC25A6     0.46%    1.01%
   (mitochondrial carrier;
   adenine nucleotide
   translocator), member 6

Signal transduction
 MAPK signaling
  mitogen-activated protein           MAPK6       0.25%    0.09%
   kinase 6
  activating transcription factor 4   ATF4        0.76%    1.75%
   (tax-responsive enhancer
   element B67)
  tumor necrosis factor (TNF          TNF         1.69%   19.70%
   superfamily, member 2)
  transforming growth factor,         TGFB1       0.28%    0.60%
   beta 1
   (Camurati-Engelmann disease)
  transforming growth factor,         TGFB2       0.06%    0.14%
   beta 2
  transforming growth factor,         TGFB3       0.14%    0.23%
   beta 3
  transforming growth factor,         TGFBR3      0.02%    0.04%
   beta receptor III
   (betaglycan, 300kDa)
  transforming growth factor,         TGFBR2      1.34%    2.15%
   beta receptor II (70/80 kDa)
  mitogen-activated protein           MAPK12      0.42%    4.01%
   kinase 12
  mitogen-activated protein           MAPKAPK2    0.58%    0.27%
   kinase-activated protein
   kinase 2
  Ras-related associated with         RRAD        0.06%    0.66%
   diabetes
 Wnt signaling
  wingless-type MMTV integration      WNT5A       0.45%    1.26%
   site family, member 5A
  frizzled homolog 1 (Drosophila)     FZD1        0.05%    0.10%
  protein kinase C, beta 1            PRKCB1      2.70%   29.00%
  protein kinase C, eta               PRKCH       0.08%    0.24%
  v-jun sarcoma virus 17 oncogene     JUN         0.41%   11.12%
   homolog (avian)
  plasminogen activator, urokinase    PLAU        0.82%    2.65%
 JAK-STAT signaling
  suppressor of cytokine              SOCS1       0.14%    0.24%
   signaling 1
  suppressor of cytokine              SOCS2       0.16%    0.23%
   signaling 2
  suppressor of cytokine              SOCS3       2.16%   12.90%
   signaling 3
  suppressor of cytokine              SOCS5       0.02%    0.03%
   signaling 5
 mTOR/PDK/Akt signaling
  tuberous sclerosis 1                TSC1        0.06%    0.46%
  glycogen synthase kinase 3 alpha    GSK3A       1.80%    0.85%

(1) Genes that showed over 2 fold difference at p<0.05 were presented.

(2) Ratio indicates expression levels in liver (L)/mammary gland (MG).

(3) Abundance of expression level is an estimate of the percent of
maximum intensity for a spot, representing abundance of gene in liver
or mammary tissue. It gives a value of ratio (L/MG) in the table if we
make a ratio of an estimate of the percent of maximum intensity of
liver and mammary tissue.
COPYRIGHT 2009 Asian - Australasian Association of Animal Production Societies
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2009 Gale, Cengage Learning. All rights reserved.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Baik, M.; Etchebarne, B.E.; Bong, J.; VandeHaar, M.J.
Publication:Asian - Australasian Journal of Animal Sciences
Article Type:Report
Geographic Code:1USA
Date:Jun 1, 2009
Words:10775
Previous Article:Effects of taurine on lipid metabolism and protein synthesis in poultry and mice.
Next Article:Proteomic approach analysis of mammary membrane proteins expression profiles in Holstein cows.
Topics:


Related Articles
Effect of feeding calcium salts of palm oil fatty acids on performance of lactating crossbred cows.
Effect of dietary fish oil and soybean oil on milk production and composition of Holstein cows in early lactation.
Milk conjugated linoleic acid response to fish oil and linseed oil supplementation of grazing dairy cows.
Metabolic characteristic of the liver of dairy cows during ketosis based on comparative proteomics.
Evaluation of urinary nitrogen excretion from plasma urea nitrogen in dry and lactating cows.
The effects of fasting and grazing on Na-glucose cotransporter-1 (SGLT-1) gene expression of rectal epithelia in beef cattle.
Proteomic approach analysis of mammary membrane proteins expression profiles in Holstein cows.
The effects of feeding triacylglycerols on milk fat composition, lipogenesis and polymer-protomer transition of acetyl-CoA carboxylase in rat mammary...
A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis.

Terms of use | Copyright © 2014 Farlex, Inc. | Feedback | For webmasters