Gene expression changes related to endocrine function and decline in reproduction in fathead minnow (Pimephales promelas) after dietary methylmercury exposure.BACKGROUND: Methylmercury (MeHg) is a known neurotoxic neurotoxic pertaining to or emanating from a neurotoxin. neurotoxic state a case of poisoning by a neurotoxin. neurotoxic adjective agent, but the mechanisms by which MeHg may act on reproductive pathways are relatively unknown. Several studies have indicated potential changes in hormone levels as well as declines in vertebrates with increasing dietary MeHg exposure. OBJECTIVES: The purpose of this study was to identify alterations in gene expression associated with MeHg exposure, specifically those associated with previously observed changes in reproduction and reproductive biomarkers. Fathead minnows, Pimephales promelas, were fed one of three diets that were similar to documented concentrations of MeHg in the diets of wild invertivorous and piscivorous piscivorous fisheating; said of birds. fish. We used a commercial macroarray in conjunction with quantitative polymerase chain reaction Quantitative polymerase chain reaction (qPCR) is a modification of the polymerase chain reaction used to rapidly measure the quantity of DNA, complementary DNA or ribonucleic acid present in a sample. to examine gene expression in fish in relation to exposure to these environmentally relevant doses of MeHg. RESULTS: Expression of genes commonly associated with endocrine disruption was altered with Hg exposure. Specifically, we observed a marked up-regulation in vitellogenin Vitellogenin (Vg) (from latin vitellus = yolk and gener = to produce) is a synonymous term for the gene and the expressed protein. The molecule is classified as a glyco-lipo-protein, having properties of a sugar, fat and protein. mRNA in individual Hgexposed males and a significant decline in vitellogenin gene expression in female fish with increasing Hg concentrations. Other genes identified by the macroarray experiment included those associated with egg fertilization and development, sugar metabolism, apoptosis, and electron transport electron transport n. The successive passage of electrons from one cytochrome or flavoprotein to another by a series of oxidation-reduction reactions during the aerobic production of ATP, with the electrons originating from an oxidizable substrate and . We also observed differences in expression patterns between male and female fish not related to genes specifically associated with reproduction, indicating a potential physiological difference in the reaction of males and females to MeHg. CONCLUSION: Gene expression data may provide insight into the mechanisms by which MeHg affects reproduction in fish and indicate how MeHg differs in its effect from other heavy metals heavy metals, n.pl metallic compounds, such as aluminum, arsenic, cadmium, lead, mercury, and nickel. Exposure to these metals has been linked to immune, kidney, and neurotic disorders. and endocrine-disrupting compounds. KEY WORDS: endocrine disruption, gene expression, mercury, methylmercury, microarray, Pimephales promelas, reproduction, toxicogenomics, vitellogenin. Environ Health Perspect 114:1337-1343 (2006). doi:10.1289/ehp.8786 available via http://dx.doi.org/ [Online 30 May 2006] ********** Mercury is prevalent in the environment as a result of both natural processes and emissions from anthropogenic an·thro·po·gen·ic adj. 1. Of or relating to anthropogenesis. 2. Caused by humans: anthropogenic degradation of the environment. sources (Keating et al. 1997; Wiener et al. 2003). However, atmospheric deposition from anthropogenic emissions such as coal power plants is frequently the major source of Hg in aquatic systems (Landis and Keeler Keel´er n. 1. One employed in managing a Newcastle keel; - called also keelman ltname>. 2. A small or shallow tub; esp., one used for holding materials for calking ships, or one used for washing dishes, etc. 2002). After deposition, inorganic Hg is methylated meth·yl·ate n. An organic compound in which the hydrogen of the hydroxyl group of methyl alcohol is replaced by a metal. tr.v. meth·yl·at·ed, meth·yl·at·ing, meth·yl·ates 1. by microbes, then biomagnified in aquatic food webs. Subsequently, the greatest concentrations of methylmercury (MeHg) are found in piscivorous fish and wildlife (Spry and Wiener 1991; Watras and Bloom 1992). MeHg is the most toxic form of Hg, and nearly all (95-99%) Hg in fish is MeHg (Bloom 1992; Grieb et al. 1990). The environmental risks associated with MeHg have been explored mainly in relationship to the risks to human health associated with consumption of contaminated fish. The main route of MeHg exposure in humans is through fish consumption, and the body burden of MeHg in humans is directly correlated to the quantities of fish consumed (Bjornberg et al. 2005; Cole et al. 2004). Hg in its methylated form is neurotoxic, particularly to developing nervous systems, and has been associated with many different neurological problems, from learning disabilities and behavioral changes to death (National Research Council 2000; Zelikoff et al. 1995). However, the mechanistic effects of MeHg on other physiological processes such as reproduction are relatively unknown, and there are comparatively few studies that examine risks of MeHg exposure on fish populations themselves (Armstrong 1979; Spry and Wiener 1991; Wiener et al. 2003). The few studies on the impact of MeHg contamination on fish have shown consequences for reproduction. For example, fathead minnows (FHM FHM For Him Magazine FHM Fachhochschule München (Munich University of Applied Sciences, Germany) FHM Forest Health Monitoring FHM Familial Hemiplegic Migraine FHM Funeral Home Marker (genealogy) ), Pimephales promelas, fed MeHg-contaminated diets that simulated concentrations found in zooplankton zooplankton: see marine biology. zooplankton Small floating or weakly swimming animals that drift with water currents and, with phytoplankton, make up the planktonic food supply on which almost all oceanic organisms ultimately depend (see , invertebrates, and small fish in North America showed a delay in spawning, a decline in spawning activity, and a decline in the number of eggs laid (Hammerschmidt et al. 2002) with increasing MeHg. Dietary MeHg impairs gonadal gonadal pertaining to or arising from a gonad. See also testicular, ovarian. gonadal cords cords formed by epithelial cells which migrate from the mesonephric tubules in the embryo to the gonadal ridge and establish the indifferent development in walleye walleye, in medicine walleye: see strabismus. walleye, in zoology walleye or walleyed pike: see perch. (Sander vitreus; Friedmann et al. 1996), FHM (Hammerschmidt et al. 2002) and walking catfish (Clarias batrachus; Kirubagaran and Joy 1988, 1992) and causes testicular atrophy in guppies ''This article is about an American pop-culture term. For the fish, see Guppy Guppies is an acronym which stands for Generation X Yuppies. The combination of the two nelogistic generational terms is used to loosely identify anyone who was in their twenties during the 1990s, (Wester 1991). The mechanism by which MeHg alters reproduction is unclear. However, there is some indication that MeHg suppresses sex hormones that elicit secondary sex characteristics and stimulate gonadal development and game-togenesis. In the companion study (Drevnick and Sandheinrich 2003) to the present article, exposure to environmentally relevant concentrations of MeHg inhibited gonadal development and suppressed estrogen production in female FHM and testosterone in male FHM. Male fish fed a control diet had mean testosterone concentrations that were 20 and 116% greater than those fed low-MeHg (0.87 [micro]g/g dry wt) and medium-MeHg (3.93 [micro]g/g dry wt) diets, respectively. Female fish fed a control diet had mean estrogen concentrations that were 164 and 416% greater than those fed low- and medium-MeHg diets. Other studies have found similar results in fish at various concentrations (Arnold et al. 1998; Fynn-Aikins et al. 1998). MeHg also interferes with vitellogenesis vitellogenesis yolk formation in the liver, transport to ovaries, incorporation into ova. (Kirubagaran and Joy 1988) and spermatogenesis (Kirubagaran and Joy 1992). Genomic markers provide a useful tool to examine the physiological mechanisms that may be affected by toxicant toxicant /tox·i·cant/ (tok´si-kant) 1. poisonous. 2. poison. tox·i·cant n. 1. A poison or poisonous agent. 2. An intoxicant. adj. exposure [for review see Klaper and Thomas (2004)]. Genomic techniques allow simultaneous measurement of multiple biochemical pathways at levels of sensitivity not available with other biomarkers. Moreover, they provide information that cannot be obtained with currently available tests such as traditional ELISA ELISA (e-li´sah) Enzyme-Linked Immuno-Sorbent Assay; any enzyme immunoassay using an enzyme-labeled immunoreactant and an immunosorbent. ELISA n. assays (Klaper and Thomas 2004). Recent evidence has demonstrated the utility of genomic techniques in assessing the effects of dietary MeHg on fish. Using real-time quantitative polymerase chain reaction (qPCR), Gonzalez et al. (2005) examined the expression of 13 genes in muscle, liver, and brain tissue of zebrafish (Danio da·ni·o n. pl. da·ni·os Any of various small, often brightly colored freshwater fishes of the genera Danio and Brachydanio, native to Asia and popular as aquarium fish. rerio). Dietary exposures of 5 and 13.5 [micro]g MeHg/g dry wt increased expression of genes cytochrome c oxidase The enzyme cytochrome c oxidase or Complex IV (PDB 2OCC, EC 1.9.3.1) is a large transmembrane protein complex found in bacteria and the mitochondrion. Function It is the last protein in the electron transport chain. subunit I (coxI) and cytoplasmic cytoplasmic pertaining to or included in cytoplasm. cytoplasmic inclusions include secretory inclusions (enzymes, acids, proteins, mucosubstances), nutritive inclusions (glycogen, lipids), pigment granules (melanin, lipofuscin, superoxide dismutase superoxide dismutase n. An enzyme that catalyzes the decomposition of a superoxide into hydrogen peroxide and oxygen. superoxide dismutase (sod) associated with mitochondrial mitochondrial pertaining to mitochondria. mitochondrial RNAs a unique set of tRNAs, mRNAs, rRNAs, transcribed from mitochondrial DNA by a mitochondrial-specific RNA polymerase, that account for about 4% of the total cell RNA that metabolism and production of reactive oxygen species reactive oxygen species, n molecules and ions of oxygen that have an unpaired electron, thus rendering them extremely reactive. Many cellular structures are susceptible to attack by ROS contributing to cancer, heart disease, and cerebrovascular disease. (ROS ROS, n.pr See reactive oxygen species. ) in liver and skeletal muscle. The specific changes in gene expression in that study provide an indication of the potential mechanisms by which MeHg may be affecting these tissues. However, the study did not examine gene expression in relation to a specific physiological response and did not examine genes involved in reproduction pathways, and exposures were higher than normal environmental exposures. In the research presented here we assessed gene expression in FHM fed diets contaminated with environmentally relevant concentrations of MeHg as a continuation of the previous study by Drevnick and Sandheinrich (2003) that found altered reproduction associated with increased MeHg exposure. We used a combination of genomic techniques, including a commercial macroarray, a suppressive sup·pres·sive adj. Tending or serving to suppress. Adj. 1. suppressive - tending to suppress; "the government used suppressive measures to control the protest" subtraction hybridization hybridization /hy·brid·iza·tion/ (hi?brid-i-za´shun) 1. crossbreeding; the act or process of producing hybrids. 2. molecular hybridization 3. , and qPCR, to identify differentially expressed genes associated with MeHg exposure in the FHM. The goal of this research was to begin to examine the mechanistic relationship between reproductive changes and gene expression and to identify potential endocrine changes that may be linked to MeHg exposure. Materials and Methods Test organisms. We obtained embryos of FHM from the Upper Midwest Environmental Sciences Center (U.S. Geological Survey, La Crosse, WI) and raised them to maturity. Before exposure, larvae Larvae, in Roman religion Larvae: see lemures. were fed Artemia nauplii for 60 days and then fed Sterling Silver Cup Fish Food (Nelson and Sons Inc., Murray, UT) for 30 days. Subsequently, 200 fish were transferred to each of fifteen 180-L flow-through aquaria a·quar·i·a n. A plural of aquarium. for exposure studies. Aquaria were filled with well water, temperature was maintained at 23.6 [+ or -] 0.1[degrees]C, and each received a 16/8-hr light/dark photoperiod photoperiod /pho·to·pe·ri·od/ (fo´to-per?e-od) the period of time per day that an organism is exposed to daylight (or to artificial light).photoperiod´ic pho·to·pe·ri·od n. cycle. Additional information on the experimental design and culturing of FHM can be found in Drevnick and Sandheinrich (2003). MeHg exposure treatments and RNA RNA: see nucleic acid. RNA in full ribonucleic acid One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic extraction. Minnows were fed food containing one of three concentrations of MeHg at 5% body mass per day: control (0.058 [+ or -] 0.004 [micro]g/g dry wt), low MeHg (0.87 [+ or -] 0.02 [micro]g/g dry wt), or medium MeHg (3.93 [+ or -] 0.08 [micro]g/g dry wt). All three concentrations were designed to represent the diets of insectivorous insectivorous eating insects to the extent that they are significant as a contributor to the patient's diet. and piscivorous fish from some midcontinental low-alkalinity lakes contaminated with Hg from non-point sources (Hammerschmidt et al. 2002). Diets were prepared by mixing food with methyl-mercuric chloride in alcohol. Control diets were mixed with alcohol alone. Alcohol was evaporated from the food, and the diet was frozen until use. Fish were fed their respective food treatment for 600 days. Fish in this study were used in accordance with protocols approved by the University of Wisconsin-La Crosse Originally known for its nationally recognized physical education program,[3] UW–La Crosse now offers 85 undergraduate programs in 44 disciplines,[4] and 21 graduate programs and emphases in eight disciplines. Institutional Animal Care and Use Committee Institutional Animal Care and Use Committees are of central importance to the application of laws to animal research in the United States. Most research involving laboratory animals is funded by the United States National Institutes of Health or other federal agencies. . Animals used were treated humanely and with regard for the alleviation of suffering. After 600 days the fish were euthanized. The liver was harvested, placed in 2 mL of Trizol reagent (Invitrogen, Carlsbad, CA) and kept at -80[degrees]C until extraction. RNA was extracted per manufacturer's intructions for Trizol. Macroarray construction and analysis. The macroarray used in the experiment was a commercially available 200-gene FHMinnow array from EcoArray, Inc. (Alachua, FL; http://www.ecoarray.com/). Arrays were constructed, hybridized, and analyzed at EcoArray as previously described (Larkin et al. 2002, 2003). Arrays consisted of cDNA spotted in duplicate onto 11.5 x 7.6-cm neutral nylon membranes. Controls included water blanks, Cot-1 repetitive sequences, M13 sequence, and exogenous spiking genes from Arabidopsis thaliana used for normalization In relational database management, a process that breaks down data into record groups for efficient processing. There are six stages. By the third stage (third normal form), data are identified only by the key field in their record. purposes (SpotReport 3; Stratagene, La Jolla, CA). Total RNA was DNase treated (Ambion, Austin, TX) and radiolabeled with ([alpha]-[.sup.33.P])dATP (Strip-EZ RT; Ambion), and 0.6 ng of spiking RNA was added to each labeling reaction. After hybridization, we quantitatively evaluated the arrays using a Typhoon 8600 imaging system (Amersham Pharmacia Biotech, Molecular Dynamics, Sunnyvale, CA). Macroarray experimental design. We exposed sixteen membranes for the macroarray experiment. Four fish of each sex were chosen from both the control and highest MeHg dose treatment based on highest RNA quality as determined by absorbance absorbance /ab·sor·bance/ (-sor´bans) 1. in analytical chemistry, a measure of the light that a solution does not transmit compared to a pure solution. Symbol . 2. at 260/280 nm and gel electrophoresis. Each sample was separately exposed to array. For each cDNA clone represented on the membrane, we substracted the general background of each membrane from the average value of the duplicate spots on the membrane. The values were then normalized to the average value of two spiking genes that were spotted on the membranes. Data from control and MeHg-treated fish were compared with a t-test. Additional information about genes found on the 200-gene FHMinnow array is provided in the Supplemental Material available online for this article (http://www.ehponline.org/members/2006/8786/supplemental.pdf). qPCR analysis. qPCR was performed for 10 individuals from each treatment for a select number of genes. Genes were selected by cross-referencing differentially expressed genes in the macroarray data with genes found in a suppressive subtraction hybridization. Because gene sequence is necessary to design primers for qPCR, genes identified through suppressive subtractions that also showed significant differential expression on macroarrays were chosen for qPCR analysis. These included FHM vitellogenin [vtg, GenBank accession no. AF130354; http://www.ncbi.nih.gov)] and zona pellucida zona pel·lu·ci·da n. The thick solid transparent outer membrane of a developed mammalian ovum. Also called oolemma. 2 (zp2, GenBank accession no. EB684274). In addition apolipoprotein apolipoprotein /apo·lipo·pro·tein/ (ap?o-lip?o-pro´ten) any of the protein constituents of lipoproteins, grouped by function in four classes, A, B, C, and E. ap·o·lip·o·pro·tein n. (apo, GenBank accession no. EB684272) and nuclear autoantigenic sperm protein (nasp, GenBank accession no. EB684273) were also identified through suppressive subtraction and were chosen because of their role in reproduction. Primers for PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) were selected in areas of intron/exon junctions (where possible) to minimize the potential for DNA amplification DNA amplification Molecular diagnostics Any method used to ↑ the copy number of a sequence of DNA. See Cycling probe technology, Gap LCR–gap ligase chain reaction, Gene amplification, NASBA–nucleic acid sequence-based amplification, PCR, during qPCR. To determine splice sites, each gene sequence was aligned to zebrafish sequences [ZFIN ZFIN Zebrafish Information Network database (Zebrafish Information Network The Zebrafish Information Network (ZFIN) is an online biological database of information about the zebrafish (Danio rerio). The zebrafish is a widely used model organism for genetic, genomic, and developmental studies, and ZFIN provides an integrated interface for querying ; http://zfin.org)] using bl2seq (Tatusova and Madden 1999] and compared to intron-exon junctions on the ZFIN database. Primers (Table 1) were chosen to amplify approximately 150 bp of each target gene and designed to have approximately similar melting temperatures (52-58[degrees]C) and a guanine guanine (gwä`nēn), organic base of the purine family. It was reported (1846) to be in the guano of birds; later (1879–84) it was established as one of the major constituents of nucleic acids. and cytosine cytosine (sī`tōsēn'), organic base of the pyrimidine family. It was isolated from the nucleic acid of calf thymus tissue in 1894. content of 40-60% with minimal repeats. All primers were synthesized and HPLC HPLC high-performance liquid chromatography. HPLC high performance liquid chromatography. HPLC High-performance liquid chromatography Lab instrumentation A highly sensitive analytic method in which analytes are placed purified at Integrated DNA DNA: see nucleic acid. DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. Technologies (Coralville, IA). Recombinant cRNA standards were used for quantification using standard curves as described (Rees and Li 2004; Vanden Heuvel 1998). Briefly, cRNA standards for each of the genes listed above ranged in size from 321 to 448 bp (Table 1). A cRNA PCR product containing a 5' T7 promoter, a region of target-gene-specific sequence including the region of the real-time amplicon, and an SP6 promoter at the 3' end (Figure 1) was created using cDNA from a sample (GeneAmp RNA PCR Kit; Applied Biosystems, Foster City, CA). The cRNA product was reamplified, cleaned (QIAquick PCR Purification Kit; Qiagen, Valencia, CA), and transcribed using the Riboprobe In Vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment. in vi·tro adj. In an artificial environment outside a living organism. Transcription System (Promega Corp., Madison, WI) according to standard protocol. Each cRNA was DNase-treated (Promega Corp.) with RQ1 RNase-free DNase followed by phenol phenol (fē`nōl), C6H5OH, a colorless, crystalline solid that melts at about 41°C;, boils at 182°C;, and is soluble in ethanol and ether and somewhat soluble in water. :chloroform chloroform (klôr`əfôrm) or trichloromethane (trī'klôrōmĕth`ān), CHCl3 extraction (24:1). The aqueous phase aqueous phase n. The water portion of a system consisting of two liquid phases, one that is primarily water and a second that is a liquid immiscible with water. was isolated and extracted with chloroform-isoamyl alcohol (24:1) followed by an overnight ethanol precipitation at -20[degrees]C. Each cRNA pellet was resuspended in 20 [micro]L RNase-free water (Gibco, Invitrogen, Grand Island, NY) and filtered through a NucAway Spin Column (Ambion) to remove free nucleotides. The size and quality of the cRNA standard were verified by analysis on an agarose agarose more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments. gel and quantified at 260 nm. First-strand cDNA for samples was synthesized using the GeneAmp RNA PCR kit (Ambion). Reactions were incubated at room temperature for 10 min; incubated for 30 min at 42[degrees]C, 5 min at 99[degrees]C; then stored at -20[degrees]C until used for template in PCR. Products were quantified using Brilliant SYBR Green QPCR (Stratagene) according to manufacturer's directions and 300 nM of each primer. PCR reactions were analyzed on an MJ Research DNA Engine Opticon System (BioRad Laboratories, Waltham, MA) under the following conditions: 1 cycle of 95[degrees]C for 5 min, 40 cycles of 94[degrees]C for 30 sec, 56[degrees]C for 30 sec, 72[degrees]C for 1 min, and 1 cycle at 72[degrees]C for 10 min. The cycle threshold [C(t)] was manually set at 0.005 for all plates. A melting curve was generated to check for presence of nonspecific nonspecific /non·spe·cif·ic/ (non?spi-sif´ik) 1. not due to any single known cause. 2. not directed against a particular agent, but rather having a general effect. nonspecific 1. PCR products. Target gene samples were performed in triplicate, and copy number was estimated against a standard curve. Negative PCR controls were used to check for genomic DNA contamination, and all real time-reverse transcriptase transcriptase /trans·crip·tase/ (-krip´tas) a DNA-directed RNA polymerase; an enzyme that catalyzes the synthesis (polymerization) of RNA from ribonucleoside triphosphates, with DNA serving as a template. PCR products were run on agarose gels. Treatments were compared using a Kruskall-Wallis test as analyzed with SPSS A statistical package from SPSS, Inc., Chicago (www.spss.com) that runs on PCs, most mainframes and minis and is used extensively in marketing research. It provides over 50 statistical processes, including regression analysis, correlation and analysis of variance. (version 13.0; SPSS, Inc., Chicago, IL). Results Detection of changes in gene expression using macroarray. Dietary MeHg altered the expression of dozens of genes in liver tissue, including those related to reproduction. Using the EcoArray macroarray, we were able to identify 76 genes in female FHM and 42 in males that were differentially expressed (2-fold difference) between the highest-MeHg-exposed fish and controls as determined by comparing the average for each sex over each treatment. However, large variation in response among individual fish and small sample size (n = 4 macroarrays per sex, per treatment) resulted in a large number of statistically nonsignificant non·sig·nif·i·cant adj. 1. Not significant. 2. Having, producing, or being a value obtained from a statistical test that lies within the limits for being of random occurrence. values (Tables 2, 3). Gene expression differed by sex, and the effects of treatment on gene expression differed by sex. Vitellogenin mRNA, a phosphoglycolipoprotein associated with egg production and normally produced solely in female fish, increased an average 142.8-fold over controls in male fish. Macroarrays were spotted with multiples of this gene because it is of interest in endocrine disruption studies (circled in Figure 2B). Control male fish (Figure 2A) did not express vitellogenin RNA, although several treated males had large amounts of vitellogenin RNA (Figure 2B). This result was highly variable among treated males. In females, vitellogenin mRNA expression was down-regulated 0.6x on average in treated fish. Expression of RNA coding for zona pellucida proteins ZP2 and ZP3 also appeared to be up-regulated in individual male (2.8x and 14.7x, respectively) and female fish (9.5x and 11.1x, respectively), although the increase was statistically nonsignificant. Genes that were significantly down-regulated and statistically significant in males included phosphoethanolamine methyltransferase (0.2x change treated vs. control) and glucose 6-phosphatase (0.4x). In males, retinal binding protein 4 increased 2-fold (p = 0.0159) and 4-hydroxyphenylpyruvate dioxygenase and [alpha]-amylase were also up-regulated (1.9x), but the statistical significance was slightly > p = 0.05 (p = 0.0664 and p = 0.0895, respectively) (Table 3). Genes putatively up-regulated in females included glyceraldehyde 3-phosphate dehydrogenase Glyceraldehyde 3-phosphate dehydrogenase (abbreviated as GAPDH or less commonly as G3PDH) (EC 1.2.1.9) is an enzyme that catalyzes the sixth step of glycolysis and thus serves to break down glucose for energy and carbon molecules. (gapdh) (1.7x, p = 0.0263). Interestingly, gapdh is a common cellular component and is considered to be expressed constitutively; therefore it is often used as a gene for normalization of qPCR data. It was not used here because of its change with exposure. qPCR analysis of differential gene expression. qPCR supported the results of macroarray experiments for vitellogenin, apolipoprotein, and nasp, with differences only in the scale of estimated up-regulation or down-regulation and the significance of the effect of treatment; macroarrays underestimated effects compared with qPCR results. MeHg-treated female fish showed significantly lower expression in vitellogenin RNA than in control fish (p = 0.004, [chi square chi square (kī), n a nonparametric statistic used with discrete data in the form of frequency count (nominal data) or percentages or proportions that can be reduced to frequencies. ] = 10.835, df = 2; Figure 3). Both MeHg treatments down-regulated vitellogenin RNA production to almost the same magnitude. Using the macroarray, vitellogenin was down-regulated approximately 2-fold; however, qPCR estimated a 4-fold down-regulation in female fish. The significance of changes in female vitellogenin mRNA expression also increased with qPCR measurements either due to technique or to the inclusion of all of the individuals from the experiment (n = 10 vs. n = 4). From qPCR results, it appears that genes approaching 1.7x over controls may also be differentially regulated. Dietary MeHg up-regulated expression of the vitellogenin gene in livers of several of the male fish in both MeHg treatments; none of the male fish fed control diets expressed the gene. However, there was significant variability in response in MeHg-fed males, with some of the treated fish showing no up-regulation and some with significant up-regulation (ranging from 0 to 200x over control males). This contributed to the overall average increase in expression and also to the lack of statistical significance (Table 4). This was similar to the findings of the macroarrays, where vitellogenin RNA was up-regulated 142x with variation among individuals leading to insignificant statistical measures across the group as a whole. Dietary MeHg also altered expression of apolipoprotein in females, causing an increase in expression of approximately 4-fold in both treatments ([chi square] = 8.861, df = 2, p = 0.012) and increased nasp by 20-40x ([chi square] = 6.151, df = 2, p = 0.046). Zona pellucida expression, also commonly measured in association with endocrine disruption, did not appear to vary with exposure. Discussion In this study, we assessed gene expression in FHM fed diets with up to 4 [micro]g MeHg/g dry wt--environmentally relevant concentrations that have been shown previously to suppress the production of sex hormones and alter reproduction in minnows (Drevnick and Sandheinrich 2003; Hammerschmidt et al. 2002). Many industrial chemicals have been linked to the disruption of endocrine function (Colborn et al. 1993), but research has focused primarily on compounds that are similar in structure to estrogens Estrogens Hormones produced by the ovaries, the female sex glands. Mentioned in: Acne, Polycystic Ovary Syndrome estrogens (es´trōjenz), n. . It is possible that MeHg may act as an endocrine disruptor by binding to estrogen receptors and acting essentially as an estrogen mimic. Cadmium, cobalt, nickel, lead, and Hg have been shown to activate estrogen receptors and increase their production (Garcia-Morales et al. 2004; Henson and Chedrese 2004; Johnson et al. 2003; Martin et al. 2003; Stoica et al. 2000). However, there are notable differences between genes differentially expressed in this study and those identified in studies of other metals. Our data indicate that MeHg may have a different mode of action than other heavy metals, particularly at environmentally relevant exposure levels for MeHg. Studies have indicated that heavy metals may affect reproduction through interference with estrogen-responsive elements (Vetillard and Bailhache 2005) but invariably in·var·i·a·ble adj. Not changing or subject to change; constant. in·var i·a·bil cause changes in ROS, which may also be the basis
for changes in endocrine function with other Hg species and other heavy
metals (Henson and Chedrese 2004; Martin et al. 2003). This is seen with
cadmium, for example, which affects vitellogenin protein production but
also induces sod and glutathione S-transferase (gst) (Olsson et al.
1995; Pereira et al. 1993; Sheader et al. 2006). We did not find
significant genomic changes associated with ROS (e.g., changes in the
expression of sod, gst) with MeHg exposure (these genes were on the
macroarray) at these levels of MeHg. Instead, our array data indicated
differential expression associated with apoptosis, phospholipid phospholipid (fŏs'fōlĭp`ĭd), lipid that in its simplest form is composed of glycerol bonded to two fatty acids and a phosphate group. biosynthesis BiosynthesisThe synthesis of more complex molecules from simpler ones in cells by a series of reactions mediated by enzymes. The overall economy and survival of the cell is governed by the interplay between the energy gained from the breakdown of compounds , sugar metabolism, interference with gonadotropin gonadotropin /go·nado·tro·pin/ (-tro´pin) any hormone that stimulates the gonads, especially follicle-stimulating hormone and luteinizing hormone. pathways, calcium regulation, phospholipid biosynthesis, and plasma transport of proteins. This may be a factor of dose, as Gonzalez et al. (2005) did find evidence of differential expression of ROS-related genes at much higher MeHg concentrations. Regardless, according to our data, there is a clear separation between the effects of oxidative stress oxidative stress, n an imbalance of the prooxidant antioxidant ratio in which too few antioxidants are produced or ingested or too many oxidizing agents are produced. and reproductive effects. Differential gene expression in this study does overlap with gene expression patterns associated with known estrogenic compounds (e.g., Larkin et al. 2003), which lends support to the hypothesis of MeHg as a nonsteroidal non·ste·roi·dal or non·ster·oid adj. Not being or containing a steroid. n. A drug or other substance not containing a steroid. endocrine disruptor. Of the genes that differed among treatments, vitellogenin is of particular interest due to the recommendation of assessment of vitellogenin in protocols for screening potential endocrine-disrupting chemicals (Endocrine Disruptor Screening and Testing Advisory Committee 1998; Marin and Motozzo 2004). This is due to its sensitivity as a biomarker and the correlation with adverse effects in male and female fish (e.g., Panter et al. 1998). Vitellogenin is a female-specific glucolipoprotein yolk yolk (yok) the stored nutrient of an oocyte or ovum. yolk n. The portion of the egg of an animal that consists of protein and fat from which the early embryo gets its main nourishment and of precursor produced by all oviparous oviparous /ovip·a·rous/ (o-vip´ah-rus) producing eggs in which the embryo develops outside the maternal body, as in birds. oviparous producing eggs in which the embryo develops outside of the maternal body, as in birds. animals and is expressed specifically in the liver and transported to the gonad gonad /go·nad/ (go´nad) a gamete-producing gland; an ovary or testis.gonad´algonad´ial indifferent gonad the sexually undifferentiated gonad of the early embryo. in females during egg development. It is up-regulated before yolk deposition and is important in egg production. Although not normally produced by male fish, its expression can be induced in males by injection of 17[beta]-estradiol or exposure to chemicals that mimic estrogens (Byrne et al. 1989; Tong et al. 2004). When produced in males, vitellogenin is not readily removed from the bloodstream and can ultimately cause kidney and liver damage (Elliot et al. 1979; Herman and Kincaid 1988). The presence of vitellogenin in some male fish in this experiment provides an indication that MeHg contamination may be causing an estrogenic-like effect; however, results for individual male fish were variable. Variable vitellogenin responses of males has also been found in other studies in which fish have been exposed to known endocrine-disrupting compounds in the field or laboratory (George et al. 2004; Sole et al. 2002). In each of these cases, of the total population sampled, up to 50% of fish express vitellogenin. Vitellogenin in males in the present study never reached the levels found in female fish. In contrast, dietary MeHg significantly suppressed vitellogenin gene expression in sexually mature female fish (Figure 3), potentially affecting egg production. This is the first study to measure differences in the gene expression of vitellogenin and other genes associated with reproduction in response to environmentally realistic concentrations of MeHg. This was also associated with a decline in estrogen as well as a decline in reproduction (Drevnick and Sandheinrich 2003). In another study, Kirubagaran and Joy (1995) found that MeHg exposure decreased phospholipid content in ovarian tissue of fish and hypothesized that this is due to inhibition of vitellogenin synthesis in the liver. Vitellogenin gene expression declined in liver samples of fish exposed to MeHg, which supports this hypothesis. Additional genomic biomarkers associated with endocrine disruption or reproduction that changed with MeHg exposure include genes responsible for proteins for egg fertilization and implantation (zp2 and zp3), cholesterol and lipid transport (apo), and cell division (nasp). Expression of apo and nasp was found to increase in females that had been exposed to MeHg. Apoptosis, variance in sugar metabolism, and calcium regulation also appear linked to MeHg exposure in this study. The enzyme GAPDH is involved in glycolysis glycolysis (glīkŏl`ĭsĭs), term given to the metabolic pathway utilized by most microorganisms (yeast and bacteria) and by all "higher" animals (including humans) for the degradation of glucose. and is proposed to play an important role in apoptosis (Chuang et al. 2005). Hypoxia hypoxia Condition in which tissues are starved of oxygen. The extreme is anoxia (absence of oxygen). There are four types: hypoxemic, from low blood oxygen content (e.g., in altitude sickness); anemic, from low blood oxygen-carrying capacity (e.g. and diabetes increase the expression of this enzyme in various tissues (Beisswenger et al. 2003; Graven grav·en v. A past participle of grave3. Adj. 1. graven - cut into a desired shape; "graven images"; "sculptured representations" sculpted, sculptured and Farber 1995; Wentzel et al. 2003), and it was up-regulated in female fish exposed to MeHg. This may indicate a link between changes in sugar metabolism and apoptosis in liver tissue after MeHg exposure. However, this change appeared to be female specific, potentially indicating sex-specific effects of MeHg on metabolism. Other genes associated with sugar metabolism included glucose 6-phosphatase, involved in the production of glucose, and [alpha]-amylase, an enzyme that converts starches to sugars. Genes for 4-hydroxyphenylpyruvate dioxygenase, [alpha]-amylase, and retinal binding protein were all up-regulated in male fish, whereas glucose 6-phosphatase was down-regulated with MeHg exposure. Because these genes are associated with sugar metabolism, insulin function, and diabetes in mammals, our data indicate that MeHg may disrupt these functions particularly in males, and there may be a link between MeHg exposure and certain metabolic diseases. MeHg has been shown to affect bone cells, inducing hypercalcemia Hypercalcemia Definition Hypercalcemia is an abnormally high level of calcium in the blood, usually more than 10.5 milligrams per deciliter of blood. in goldfish and disrupting calcium homeostasis homeostasis Any self-regulating process by which a biological or mechanical system maintains stability while adjusting to changing conditions. Systems in dynamic equilibrium reach a balance in which internal change continuously compensates for external change in a feedback (Suzuki et al. 2004). Calcium levels in the blood are related to estrogen levels and affect the transport and metabolism of proteins. Because many of the differentially expressed genes identified in the macroarray analysis are associated with calcium, direct disruption of calcium transport or alteration in the levels of calcium may be responsible for some of these effects. This study suggests that MeHg acts as an endocrine disruptor and affects not only gene expression associated with reproduction and endocrine function but other pathways as well. The genomic response to MeHg appears different than the response of vertebrates to other heavy metals. As more genomic data become available for other heavy metals and endocrine-disrupting compounds, continuation of this work to evaluate unique gene expression patterns will provide specific biomarkers that indicate the impact of MeHg versus that of other toxic compounds. REFERENCES Armstrong FAJ FAJ Financial Analysts Journal FAJ Air Fiji (ICAO code) FAJ Floor Assembly Jig . 1979. Effects of mercury compounds on fish. In: Biogeochemistry bi·o·ge·o·chem·is·try n. The study of the relationship between the geochemistry of a region and the animal and plant life in that region. bi of Mercury in the Environment (Nriagu JO, ed). New York New York, state, United States New York, Middle Atlantic state of the United States. It is bordered by Vermont, Massachusetts, Connecticut, and the Atlantic Ocean (E), New Jersey and Pennsylvania (S), Lakes Erie and Ontario and the Canadian province of :Elsevier/North Holland Biomedical bi·o·med·i·cal adj. 1. Of or relating to biomedicine. 2. Of, relating to, or involving biological, medical, and physical sciences. Press, 657-670. Arnold BS, Jagoe CH, Reinert R. 1998. Effects of methyl mercury on plasma estrogen and 11-keto testosterone in Nile tilapia Nile tilapia tilapianiloticus (Oreochromis niloticus). (Oreochromis niloticus Oreochromis niloticus see tilapia niloticus. ) [Abstract]. In: Abstracts of 19th Annual Meeting of the Society of Environmental Toxicology and Chemistry, 13-19 November 1998. Charlotte, NC. Pensacola, FL:SETAC SETAC Society of Environmental Toxicology And Chemistry SETAC Systems Engineering & Technical Assistance Contract SETAC Shipboard Electronic Thermoacoustic Chiller SETAC Shipboard Electronics Thermo-Acoustic Cooler SETAC Shipboard Electronics Thermoacoustic Chiller Press, 145. Beisswenger PJ, Howell SK, Smith K, Szwergold BS. 2003. Glyceraldehyde-3-phosphate dehydrogenase dehydrogenase /de·hy·dro·gen·ase/ (de-hi´dro-jen-as?) an enzyme that catalyzes the transfer of hydrogen or electrons from a donor, oxidizing it, to an acceptor, reducing it. de·hy·dro·gen·ase n. activity as an independent modifier (programming) modifier - An operation that alters the state of an object. Modifiers often have names that begin with "set" and corresponding selector functions whose names begin with "get". of methylglyoxal levels in diabetes. Biochim Biophys Acta 1637:98-106. Bjornberg KA, Vahter M, Grawe KP, Berglund M. 2005. Methylmercury exposure in Swedish women with high fish consumption. Sci Total Environ 341:45-52. Bloom NS. 1992. On the chemical form of mercury in edible fish and marine invertebrate invertebrate (ĭn'vûr`təbrət, –brāt'), any animal lacking a backbone. The invertebrates include the tunicates and lancelets of phylum Chordata, as well as all animal phyla other than Chordata. tissue. Can J Fish Aquat Sci 49:1010-1017. Byrne BM, Gruber M, Ab G. 1989. The evolution of egg yolk proteins. Prog Biophys Mol Biol 53:33-69. Chuang DM, Hough C, Senatorov VV. 2005. Glyceradlehyde-3-phophate dehydrogenase, apoptosis, and neurodegenerative diseases neurodegenerative diseases diseases characterized by neurodegeneration. Lesions are microscopic only but in chronic disease with massive involvement there may be grossly visible atrophy of affected nervous tissue. . Annu Rev Pharmacol Toxicol 45:269-290. Colborn T, vom Saal FS, Soto AM. 1993. Developmental effects of endocrine disrupting chemicals in wildlife and humans. Environ Health Perspect 101:378-384. Cole DC, Kearney J, Sanin LH, Leblanc A, Weber JP. 2004. Blood mercury levels among Ontario anglers and sport-fish eaters. Environ Res 95:305-314. Drevnick PE, Sandheinrich MB. 2003. Effects of dietary methylmercury on reproductive endocrinology of fathead minnows. Environ Sci Technol 37:4390-4396. Elliot JAK, Bromage NR, Whitehead C. 1979. Effects of estradiol-17[beta] on serum calcium and vitellogenin levels in rainbow trout rainbow trout Species (Oncorhynchus mykiss) of fish in the salmon family (Salmonidae) noted for spectacular leaps and hard fighting when hooked. It has been introduced from western North America to many other countries. . J Endocrinol 83:54-55. Endocrine Disruptor Screening and Testing Advisory Committee. 1998. EDSTAC EDSTAC Endocrine Disruptors Screening and Testing Advisory Committee Final Report. Washington, DC:U.S. Environmental Protection Agency Environmental Protection Agency (EPA), independent agency of the U.S. government, with headquarters in Washington, D.C. It was established in 1970 to reduce and control air and water pollution, noise pollution, and radiation and to ensure the safe handling and . Friedmann AS, Watzin MC, Brinck-Johnsen T, Leiter JC. 1996. Low levels of dietary methylmercury inhibit growth and gonadal development in juvenile walleye (Stizostedion vitreum). Aquat Toxicol 35:265-278. Fynn-Aikins K, Gallagher E, Ruessler S, Wiebe J, Gross TS. 1998. An evaluation of methyl mercury as an endocrine disruptor in largemouth bass largemouth bass see micropterus salmoides. [Abstract]. In: Abstracts of the 19th Annual Meeting of the Society of Environmental Toxicology and Chemistry, 13-19 November 1998, Charlotte, NC. Pensacola, FL:SETAC Press, 146. Garcia-Morales P, Saceda M, Kenney N, Kim N, Salomon DS, Gottardis MM, et al. 2004. Effect of cadmium on estrogen receptor levels and estrogen-induced responses in human breast cancer cells. J Biol Chem 269:16896-16901. George S, Gubbins M, MacIntosh A, Reynolds W, Sabine V, et al. 2004. A comparison of pollutant biomarker responses with transcriptional responses in European flounders (Platicthys flesus) subjected to estuarine es·tu·a·rine adj. 1. Of, relating to, or found in an estuary. 2. Geology Formed or deposited in an estuary. Adj. 1. estuarine - of or relating to or found in estuaries estuarial pollution. Mar Environ Res 58:571-575. Gonzalez P, Dominique Y, Massabuau JC, Boudou A, Bourdinea JP, et al. 2005. Comparative effects of dietary methylmercury on gene expression in liver, skeletal muscle, and brain of the zebrafish (Danio rerio). Environ Sci Technol 39(11):3972-3980. Graven KK, Farber HW. 1995. Hypoxia-associated proteins. New Horiz 3:208-218. Grieb TM, Driscoll CT, Gloss SP, Schofield CL, Bowie GL, Porcella DB. 1990. Factors affecting mercury accumulation in fish in the upper Michigan peninsula. Environ Toxicol Chem 9:919-930. Hammerschmidt CR, Sandheinrich MB, Wiener JG, Rada RG. 2002. Effects of dietary methylmercury on reproduction of fathead minnows. Environ Sci Technol 36:877-883. Henson MC, Chedrese PJ. 2004. Endocrine disruption by cadmium, a common environmental toxicant with paradoxical effects on reproduction. Exp Biol Med 229:383-392. Herman RL, Kincaid HL. 1988. Pathological effects of orally administered estradiol to rainbow trout. Aquaculture aquaculture, the raising and harvesting of fresh- and saltwater plants and animals. The most economically important form of aquaculture is fish farming, an industry that accounts for an ever increasing share of world fisheries production. 72:165-172. Johnson MD, Kenney N, Stoica A, Hilakivi-Clarke L, Singh B, Chepko G, et al. 2003. Cadmium mimics the in vivo in vivo /in vi·vo/ (ve´vo) [L.] within the living body. in vi·vo adj. Within a living organism. in vivo adv. effects of estrogen in the uterus and mammary gland. Nat Med 9:1081-1084. Keating MH, Mahaffey KR, Schoeny R, Rice GE, Bullock OR, Ambrose RB, et al. 1997. Mercury Report to Congress. EPA-452/R-97-003. Washington, DC:U.S. Environmental Protection Agency. Kirubagaran R, Joy KP. 1988. Toxic effects of mercuric chloride, methylmercuric chloride, and Emisan 6 (an organic mercurial mercurial /mer·cu·ri·al/ (mer-kur´e-il) 1. pertaining to mercury. 2. a preparation containing mercury. mer·cu·ri·al adj. fungicide fungicide (fŭn`jəsīd', fŭng`gə–), any substance used to destroy fungi. Some fungi are extremely damaging to crops (see diseases of plants), and others cause diseases in humans and other animals (see fungal infection). ) on ovarian recrudescence recrudescence /re·cru·des·cence/ (re?kroo-des´ens) recurrence of symptoms after temporary abatement.recrudes´cent re·cru·des·cence n. in the catfish Clarias batrachus (L.). Bull Environ Contam Toxicol 41:902-909. Kirubagaran R, Joy KP. 1992. Toxic effects of mercury on testicular testicular /tes·tic·u·lar/ (tes-tik´u-lar) pertaining to a testis. tes·tic·u·lar adj. Of or relating to a testicle or testis. testicular pertaining to the testis. activity in the freshwater teleost teleost fish of the class Osteichthyes, having the skeleton completely ossified. , Clarias batrachus (L.). J Fish Biol 41:305-315. Kirubagaran R, Joy KP. 1995. Changes in lipid profiles and 32P uptake into phosphoprotein phosphoprotein /phos·pho·pro·tein/ (-pro´ten) a conjugated protein in which phosphoric acid is esterified with a hydroxy amino acid. phos·pho·pro·tein n. (vitellogenin) content of the ovary ovary, ductless gland of the female in which the ova (female reproductive cells) are produced. In vertebrate animals the ovary also secretes the sex hormones estrogen and progesterone, which control the development of the sexual organs and the secondary sexual and liver in the female catfish, Clarias batrachus, exposed to mercury. Biomed Environ Sci 8:35-44. Klaper R, Thomas M. 2004. At the crossroads of genomics and ecology: the promise of a canary on a chip. BioScience 54:403-412. Landis MS, Keeler GJ. 2002. Atmospheric mercury deposition to Lake Michigan during the Lake Michigan Mass Balance Study. Environ Sci Technol 36:4518-4524. Larkin P, Folmar LC, Hemmer MJ, Poston AJ, Denslow ND. 2003. Expression profiling of estrogenic compounds using a sheepshead minnow cDNA macroarray. Environ Health Perspect 111:29-36. Larkin P, Sabo-Attwood T, Kelso J, Denslow ND. 2002. Gene expression analysis of largemouth bass exposed to estradiol, nonylphenol, and p,p'-DDE. Comp Biochem Physiol B Biochem Mol Biol 133:543-557. Marin MG, Matozzo V. 2004. Vitellogenin induction as a biomarker of exposure to estrogenic compounds in aquatic environments. Mar Pollut Bull 48:835-839. Martin MB, Reiter R, Pham T, Avellanet YR, Camara J, Lahm M, et al. 2003. Estrogen-like activity of metals in Mcf-7 breast cancer cells. Endocrinology 144(6):2425-2436. National Research Council. 2000. Toxicological Effects of Mercury. Washington, DC:National Academy Press. Olsson P-E, Kling P, Petterson C, Silversand C. 1995. Interaction of cadmium and oestradiol-17[beta] on metallothionein and vitellogenin synthesis in rainbow trout (Oncorhynchus mykiss). Biochem J 307:197-203. Panter GH, Thompson RS, Sumpter JP. 1998. Adverse reproductive effects in male fathead minnows (Pimephales promelas) exposed to environmentally relevant concentrations of the natural oestrogens, oestradiol Noun 1. oestradiol - the most powerful female hormone that occurs naturally; synthesized and used to treat estrogen deficiency and breast cancer estradiol Loestrin - trade name for an oral contraceptive containing estradiol and norethindrone and oestrone oestrone see estrone. . Aquatic Toxicol 40:335-360. Pereira JJ, Mercaldo-Allen R, Kuropat C, Luedke D, Sennefelder G. 1993. Effect of cadmium accumulation on serum vitellogenin levels and hepatosomatic and gonadosomatic indices of winter flounder flounder: see flatfish. flounder Any of about 300 species of flatfishes (order Pleuronectiformes). When born, the flounder is bilaterally symmetrical, with an eye on each side, and it swims near the sea's surface. (Pleuronectes americanus). Arch Environ Contam Toxicol 24:427-431. Rees CB, Li W. 2004. Development and application of a real-time quantitative PCR assay for determining CYP1A CYP1A Cytochrome P450 1A transcripts in three genera of salmonids. Aquat Toxicol (66):357-368. Sheader DL, Williams TD, Lyons BP, Chipman JK. 2006. Oxidative stress response of European flounder (Platichthys flesus) to cadmium determined by a custom cDNA microarray. Mar Environ Res 62:33-44. Sole M, Barcelo D, Porte C. 2002. Seasonal variation of plasmatic and hepatic vitellogenin and EROD EROD Education Resource Organizations Directory EROD Ethoxyresorufin-O-deethylation EROD Early Return of Dependents EROD Electronic Record of Deposit (pending tranfer) activity in carp, Cyprinus carpio, in relation to sewage treatment plants. Aquat Toxicol 60:233-248. Spry DJ, Wiener JG. 1991. Metal bioavailability bioavailability /bio·avail·a·bil·i·ty/ (bi?o-ah-val?ah-bil´i-te) the degree to which a drug or other substance becomes available to the target tissue after administration. bi·o·a·vail·a·bil·i·ty n. and toxicity to fish in low-alkalinity lakes: a critical review. Environ Pollut 71:243-304. Stoica A, Katzenellenbogen BS, Martin MB. 2000. Activation of estrogen receptor-alpha by the heavy metal cadmium. Mol Endocrinol 14:545-553. Suzuki N, Yamamoto M, Watanabe K, Kambegawa A, Hattori A. 2004. Both mercury and cadmium directly influence calcium homeostasis resulting from the suppression of scale bone cells: the scale is a good model for the evaluation of heavy metals in bone metabolism. J Bone Miner Metab 22:439-446. Tatusova TA, Madden TL. 1999. Blast 2 sequences--a new tool for comparing protein and nucleotide sequences. FEMS Microbiol Lett 174:247-250. Tong Y, Shan T, Poh YK, Yan T, Wang H, Lam SH, et al. 2004. Molecular cloning of zebrafish and medaka me·da·ka n. A small Japanese fish (Oryzias latipes) commonly found in rice fields and often used in biological research or in stocking aquariums. vitellogenin genes and comparison of their expression in response to 17[beta]-estradiol. Gene 328:25-36. Vanden Heuvel JP. 1998. PCR Protocols in Molecular Toxicology. New York:CRC (Cyclical Redundancy Checking) An error checking technique used to ensure the accuracy of transmitting digital data. The transmitted messages are divided into predetermined lengths which, used as dividends, are divided by a fixed divisor. Press. Vetillard A, Bailhache T. 2005. Cadmium: An endocrine disrupter that affects gene expression in the liver and brain of juvenile rainbow trout. Biol Reprod 72:119-126. Watras CJ, Bloom NS. 1992. Mercury and methylmercury in individual zooplankton: implications for bioaccumulation bi·o·ac·cu·mu·la·tion n. The increase in the concentration of a substance, especially a contaminant, in an organism or in the food chain over time. . Limnol Oceanogr 37:1313-1318. Wentzel P, Ejdesjo A, Eriksson UJ. 2003. Maternal diabetes in vivo and high glucose in vitro diminish GAPDH activity in rat embryos. Diabetes 52:1222-1228. Wester PW. 1991. Histopathological effects of environmental pollutants [beta]-HCH and methylmercury on reproductive organs in freshwater fish. Comp Biochem Physiol 100C:237-239. Wiener JGD JGD John G Diefenbaker High School (Calgary, Alberta) JGD Joint Ground Domain (Joint Tactical Radio System US DoD) JGD JTRS Ground Domain (JTRS = Joint Tactical Radio Systems; US DoD) , Krabbenhoft DP, Heinz GH, Scheuhammer AM. 2003. Ecotoxicology The term ecotoxicology was coined by Truhaut in 1969, who defined it as "the branch of toxicology concerned with the study of toxic effects, caused by natural or synthetic pollutants, to the constituents of ecosystems, animal (including human), vegetable and microbial, in an of mercury. In: Handbook of Ecotoxicology, Chapt 16. (Hoffman DJ, Rattner BA, Burton GA, Cairns Cairns, city (1991 pop. 64,463), Queensland, NE Australia, on Trinity Bay. It is a principal sugar port of Australia; lumber and other agricultural products are also exported. The city's proximity to the Great Barrier Reef has made it a tourist center. J Jr, eds.). Boca Raton, FL:Lewis Publishers, 409-463. Zelikoff JT, Bertin JE, Burbacher TM, Hunter ES, Miller RK, Silbergeld EK, et al. 1995. Health risks associated with prenatal metal exposure. Fundam Appl Toxicol 25:161-70. Rebecca Klaper, (1) Christopher B. Rees, (1) Paul Drevnick, (2) Daniel Weber, (3) Mark Sandheinrich, (4) and Michael J. Carvan (1) (1) Great Lakes WATER Institute, University of Wisconsin-Milwaukee, Milwaukee, Wisconsin, USA; (2) Department of Zoology, Miami University, Oxford, Ohio, USA; (3) Marine and Freshwater Biomedical Sciences Center, University of Wisconsin-Milwaukee, Milwaukee, Wisconsin, USA; (4) River Studies Center and Department of Biology, University of Wisconsin-La Crosse, La Crosse, Wisconsin La Crosse is the county seat of La Crosse County, Wisconsin.GR6 The city, which lies alongside the Mississippi River, is known primarily as a college town and commercial center for the surrounding area. , USA Address correspondence to R. Klaper, Great Lakes WATER Institute, 600 East Greenfield Ave., Milwaukee, WI 53204. Telephone: (414) 382-1713. Fax: (414) 382-1705. E-mail: rklaper@uwm.edu Supplemental Material is available online at http://www.ehponline.org/members/2006/8786/supplemental.pdf We thank three anonymous reviewers that contributed suggestions to improve the manuscript. This is paper 476 of the Great Lakes WATER Institute, University of Wisconsin-Milwaukee. This research was supported by a pilot project grant from the National Institute of Environmental Health Sciences The National Institute of Environmental Health Sciences (NIEHS) is one of 27 Institutes and Centers of the National Institutes of Health (NIH),which is a component of the Department of Health and Human Services (DHHS). The Director of the NIEHS is Dr. David A. Schwartz. (NIEHS NIEHS National Institute of Environmental Health Sciences (NIH, DHHS) ) Marine and Freshwater Biomedical Sciences Center (supported by NIEHS ES04184) at the University of Wisconsin-Milwaukee (R.K.), a grant from the Wisconsin Sea Grant College sea grant college n. A college or university that receives government grants for oceanographic research. Program (M.S.), and a National Institutes of Health, Indian Health Service The Indian Health Service (IHS) is an Operating Division (OPDIV) within the U.S. Department of Health and Human Services responsible for providing federal health services to American Indians and Alaska Natives. , Native American Research Centers for Health grant (M.J.C.). The authors declare they have no competing financial interests. Received 29 October 2005; accepted 30 May 2006.
Table 1. Primers used for qPCR and RNA standards for qPCR.
Gene locus (a) Primer Primer sequence Product size (bp)
vtg cRNA FP TAATACGACTCACTATAGG 401
CATCAAGGAGAAGTTCCTGGCT
cRNA RP ATTTAGGTGACACTATAGAGGT
AGGAGCTTCATGATGGT
apo cRNA FP TAATACGACTCACTATAGG 426
GCTTAGTTGAAGTAGTCAGTG
cRNA RP ATTTAGGTGACACTATAGC
CTGACAAGGAGTTAGTTGAGA
nasp cRNA FP TAATACGACTCACTATAGG 363
TCAGAGGATTCTTCTGGGACTC
cRNA RP ATTTAGGTGACACTATAGC
GAGGAAACAGCATCTGCTTCA
zp2 cRNA FP TAATACGACTCACTATAGGGTA
CACTTCCTACTACAGTG 372
cRNA RP ATTTAGGTGACACTATAGAGATG
GTTTCCTGCAGAGGAG
vtg FP TGACAGCTAGTTTGGCTATG 149
RP AATATCATGGATGGGCCTGA
apo FP CACTGGCCAGACCGCTGATAA 155
RP GAGGATTGTCACTGCTTGGGA
nasp FP CTTCTCAGCTAGCATGGCACAA 133
RP GCAGACAGCTCCGTCGATGTTA
zp2 FP GATGGATGCCCTTACCAGGATG 157
RP AGATGGTTTCCTGCAGAGGAG
Abbreviations: FP, forward primer; RP, reverse primer.
(a) Primary sequences submitted to GenBank (http://www.ncbi.nih.gov/
Genbank).
Table 2. Macroarray gene expression results (a) for female FHM exposed
to MeHg-contaminated diets (3.93 [+ or -] 0.08 [micro]g MeHg/g dry wt)
versus control diets (0.058 [+ or -] 0.004 [micro]g MeHg/g dry wt).
Fold
Gene name change p-Value
vitellogenin 1 0.6 0.3113
vitellogenin precursor 0.6 0.4106
glyceraldehyde 3-phosphate dehydrogenase 1.7 0.0263
novel retinal pigment epithelial gene (NORPEG) 2.0 0.3606
piwi protein 2.0 0.5345
phosphoenolpyruvate carboxykinase 2.0 0.2376
heat shock protein 90-beta 2.0 0.2320
L-pipecolic acid oxidase 2.0 0.4516
actin 1 2.0 0.0689
heat shock protein Hsp70 2.0 0.5003
dual specificity phosphatase 13; protein phosphatase 2.0 0.4574
cytosolic branched-chain amino acid aminotransferase 2.0 0.4710
histone H1-0 2.0 0.4968
isocitrate dehydrogenase 2 (NADP+), mitochondrial 2.0 0.4458
G protein pathway suppressor 1; Arabimdopsis FUS6/COP11 2.1 0.1854
homolog
X-box-binding protein 1B 2.1 0.4827
cathepsin D precursor 2.1 0.3563
von Willebrand factor-cleaving protease precursor 2.1 0.4257
pyruvate kinase 2.1 0.5065
A-kinase anchoring protein-associated sperm protein 2.1 0.4567
oxysterol binding protein-like 9 isoform a 2.1 0.2378
mannose binding-like lectin 2.1 0.4514
bile salt export pump 2.2 0.1110
transcription factor JUN-B 2.2 0.3334
glutathione S-transferase 1 (GST-CL1) (GST CLASS-THETA) 2.2 0.4336
ventricular myosin heavy chain 2.3 0.3905
acyl carrier protein, mitochondrial precursor (ACP) 2.3 0.4527
succinyl CoA:3-oxoacid CoA transferase 2.3 0.3305
cell surface glycoprotein HT7 precursor 2.3 0.2830
ubiquitin-like protein SMT3A 2.3 0.4100
protein serine threonine kinase Clk4 2.3 0.4232
cytosolic sulfotransferase 2.3 0.3929
spermatogenesis-preventing substance 2.4 0.3869
apolipoprotein Eb; apolipoprotein E 2.4 0.1711
gonadotropin-regulated long chain acyl-CoA synthetase 2.4 0.4122
GDP-mannose pyrophosphorylase B, isoform 2 2.4 0.4177
ribosomal protein P2 2.4 0.2349
acyl-coenzyme A dehydrogenase, C-4 to C-12 straight 2.4 0.3715
chain
adenylate kinase 7 2.4 0.3979
stathmin 2.5 0.3786
cytochrome P450 51 2.5 0.3985
heat shock protein HSP 90-alpha (HSP 86) 2.5 0.4709
acyl-CoA oxidase type 1 2.5 0.3990
ribophorin I 2.5 0.3879
matrix metalloproteinase 9 2.5 0.4384
guanosine monophosphate reductase 2.5 0.4486
beta-ureidopropionase 2.5 0.3735
transposon-derived Buster1 transposase-like protein 2.5 0.3560
creatine kinase, testis isozyme 2.6 0.2586
lanosterol synthase (2,3-oxidosqualene-lanosterol 2.6 0.4240
cyclase)
uridine-cytidine kinase 1 2.6 0.4133
CPEB-associated factor Maskin 2.6 0.3647
eukaryotic translation elongation factor 2; 2.6 0.2497
polypeptidyl-tRNA translocase
tubulin, alpha 3; tubulin alpha 3 2.6 0.2231
glutathione reductase 1 2.7 0.3697
zinc finger protein 151 (Zinc finger protein Z13) 2.7 0.3620
glucose-6-phosphate-1-dehydrogenase; G6PD 2.7 0.3684
glutamine synthetase 2.7 0.3560
alpha tubulin 2.7 0.2810
eukaryotic translation initiation factor 3, subunit 8 2.8 0.2724
signal peptidase 25 kDA subunit 2.8 0.2700
tubulin beta-1 chain 2.9 0.3540
ependymin precursor (EPD) 2.9 0.3219
S100 calcium-binding protein, beta (neural) 3.0 0.4088
carboxypeptidase B 3.0 0.3561
axonemal dynein heavy chain 7 3.0 0.3940
kainate receptor beta chain precursor 3.0 0.3571
fucosidase, alpha-L-1, tissue 3.1 0.3476
chloride intracellular channel 2 3.1 0.4201
thyroid hormone receptor associated protein complex 3.2 0.2888
TRAP230/KIAA0192
angiotensinogen precursor 3.3 0.2102
UDP-glucuronic acid/UDP-N-acetylgalactosamine dual 3.4 0.3009
transporter
androgen receptor 1 3.4 0.3362
ubiquitin-conjugating enzyme E2D 2 3.5 0.2676
cyclin A2 3.6 0.1748
asparaginase and ankyrin repeat family member 3.6 0.3353
scavenger receptor cysteine-rich type 1 protein M160 3.8 0.3507
ZP2 9.5 0.1554
ZP3 11.1 0.1349
(a) Commercial macroarray. Genes names are from GenBank
(http://www.ncbi.nih.gov/GenBank) and the European Molecular Biology
Laboratory of the European Bioinformatics Institute (EMBL-EBI;
http://www.ebi.ac.uk/embl/).
Table 3. Macroarray gene expression (a) results male FHM exposed to
MeHg-contaminated diets (3.93 [+ or -] 0.08 [micro]g MeHg/g dry wt)
versus control diets (0.058 [+ or -] 0.004 [micro]g MeHg/g dry wt).
Fold
Gene name change p-Value
phosphoethanolamine methyltransferase 0.2 0.0273
transcription factor JUN-B 0.3 0.3853
fibronectin 1 0.3 0.1483
polyunsaturated fatty acid elongase 0.3 0.3617
serine-pyruvate aminotransferase 0.3 0.2567
fatty acid synthase 0.3 0.1857
glucose-6-phosphatase 0.4 0.0773
intestinal fatty acid binding protein 0.4 0.1941
L-threonine 3-dehydrogenase 0.4 0.3831
annexin VI 0.4 0.2342
superoxide dismutase 0.4 0.0870
transferrin variant D 0.4 0.2122
ubiquitin specific protease 15 0.4 0.2228
cytochrome P450 (2F2) 0.4 0.1455
25-hydroxyvitamin D3 24-hydroxylase 0.5 0.2357
gonadotropin-regulated long chain acyl-CoA synthetase 0.5 0.1703
antithrombin 0.5 0.1259
lanosterol synthase 0.5 0.5225
bile salt export pump 0.5 0.3028
3-hydroxy-3-methylglutaryl-Coenzyme A reductase 0.5 0.3053
cytochrome c oxidase subunit I 0.5 0.2533
4-hydroxyphenylpyruvate dioxygenase 1.9 0.0664
alpha amylase 1.9 0.0895
zinc finger protein 151 (zinc finger protein Z13) 2.0 0.2678
pyruvate kinase 2.0 0.3628
hepatic glucose transporter GLUT2 2.0 0.2632
retinol binding protein 4, plasma 2.0 0.0159
matrix metalloproteinase 9 2.2 0.2291
ventricular myosin heavy chain 2.3 0.2332
biliverdin reductase B [flavin reductase (NADPH)] 2.3 0.4626
kinesin-like protein 2 2.4 0.3089
tubulin beta-1 chain 2.4 0.3005
eukaryotic translation initiation factor 3, subunit 8 2.5 0.1936
cyclin A2 2.5 0.2848
homogentisate 1, 2-dioxygenase 2.6 0.3151
tubulin, alpha 3; tubulin alpha 3 2.8 0.1727
zona pellucida 2 (ZP2) 2.8 0.4347
nucleoside phosphorylase 2.9 0.1578
protein serine threonine kinase Clk4 3.5 0.3601
zona pellucida 3 (ZP3) 14.7 0.3218
vitellogenin precursor 76.3 0.2971
vitellogenin 1 142.8 0.3292
(a) Commercial macroarray. Genes names from GenBank (http://www.ncbi.
nih.gov/GenBank) and the European Molecular Biology Laboratory of the
European Bioinformatics Institute (EMBL-EBI; http://www.ebi.ac.uk/
embl/).
Table 4. qPCR results for all FHM in all treatments measured as
molecules per nanogram RNA for each gene product standardized to total
RNA.
Average female
Significance
Gene ([chi square], df, p-
locus Treatment Molecules/ng ([+ or -] SE) value)
vtg Control 4.0 x [10.sup.7] [+ or -] [chi square] = 9.374,
4.8 x [10.sup.6] df = 2, p = 0.009*
Low 9.5 x [10.sup.6] [+ or -]
4.1 x [10.sup.6]
Medium 8.2 x [10.sup.6] [+ or -]
2.8 x [10.sup.6]
zp2 Control 2.8 x [10.sup.6] [+ or -] [chi square] = 2.279,
1.4 x [10.sup.5] df = 2, p = 0.320
Low 9.2 x [10.sup.4] [+ or -]
3.0 x [10.sup.4]
Medium 1.4 x [10.sup.5] [+ or -]
3.7 x [10.sup.4]
apo Control 2.4 x [10.sup.5] [+ or -] [chi square] = 8.861,
7.8 x [10.sup.5] df = 2, p = 0.012*
Low 5.2 x [10.sup.5] [+ or -]
1.1 x [10.sup.5]
Medium 6.5 x [10.sup.5] [+ or -]
2.2 x [10.sup.5]
nasp Control 527[+ or -] 267 [chi square] = 6.151,
Low 14,711 [+ or -] 9,459 df = 2, p = 0.046*
Medium 21,351 [+ or -] 14,738
Average male
Significance
Gene ([chi square], df, p-
locus Treatment Molecules/ng ([+ or -] SE) value)
vtg Control 6,756 [+ or -] 4,284 [chi square] = 1.627,
Low 22,443 [+ or -] 18,977 df = 2, p = 0.443
Medium 1.4 x [10.sup.6] [+ or -]
1.0 x [10.sup.6]
zp2 Control 3.0 x [10.sup.5] [+ or -] [chi square] = 2.920,
74,376 df = 2, p = 0.232
Low 4.0 x [10.sup.5] [+ or -]
132,414
Medium 1.9 x [10.sup.5] [+ or -]
57,519
apo Control 3.4 x [10.sup.6] [+ or -] [chi square] = 0.608,
7.3 x [10.sup.5] df = 2, p = 0.997
Low 2.7 x [10.sup.6] [+ or -]
6.3 x [10.sup.5]
Medium 3.0 x [10.sup.6] [+ or -]
9.4 x [10.sup.5]
nasp Control 540 [+ or -] 178 [chi square] = 0.106,
Low 3,079 [+ or -] 227 df = 2, p = 0.948
Medium 1,098 [+ or -] 494
*Significant at p = 0.05.
|
|
||||||||||||||||||

i·a·bil
Printer friendly
Cite/link
Email
Feedback
Reader Opinion