G, N, and P gene-based analysis of Chandipura viruses, India.

An encephalitis outbreak in 2003 in children from India was attributed to Chandipura virus. Sequence analyses of G, N, and P genes showed 95.6%-97.6% nucleotide identity with the 1965 isolate (G gene, 7-11 amino acid changes); N and P genes were highly conserved.

**********

Chandipura virus (CHPV, family Rhabdoviridae), was implicated as the cause of a large outbreak of encephalitis in children, involving 329 cases with 183 deaths, from Andhra Pradesh State, India in 2003 (1). On the basis of serologic investigations conducted during the epidemic, CHPV infection led to different clinical manifestations, including subclinical cases, mild fever, and encephalitis; some patients died within 48 hours, while others recovered (1). CHPV was described for the first time in India in 1965, when it was isolated from the serum of a patient with febrile illness (2) during an outbreak of dengue and Chikungunya viruses. The virus was isolated again in 1980 from an encephalopathy patient during an outbreak in children (3). However, the magnitude of the 2003 outbreak was unique. The present study was conducted to understand the relationship of the 2003 isolates with the 1965 strain and to assess association of mutations in (5, N, and P genes with different clinical manifestations.

The Study

During the outbreak investigations, 5 CHPV isolates were obtained in cell culture. Table 1 provides details about these isolates. The 1980 isolate was not available for further analysis. These isolates were subjected to reverse transcription-polymerase chain reaction (RT-PCR), according to the previously described method (1). The primers listed in Table 2 were designed on the basis of published sequences and used to amplify and sequence the G, P, and N genes (4,5). The PCR products were purified by using Wizard PCR preps DNA purification Kit (Promega, Madison,WI) and sequenced by using Big Dye Terminator cycle sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA) and an automatic sequencer (ABI PRISM 310 Genetic Analyzer, Applied Biosystems).

Multiple alignment of nucleotide/amino acid sequences was carried out by using software ClustalX v.1.83. Phylogenetic analyses based on the G, N, and P genes (1593, 1269, 882 nucleotides [nt], respectively) were carried out employing maximum likelihood method in Phylo win software (6). The reliability of different phylogenetic groupings was evaluated by using the bootstrap test, with 1,000 bootstrap replications, available in Phylo_win. CHPV sequences representing 3 encephalitis cases, including 1 fatal case (patient 2, Table) and 2 febrile cases, were compared.

G gene analysis led to the correction of the sequence reported for the 1965 isolate (accession no. J04350). As compared to the 1965 isolate, the only sequence available in the GenBank database, the following differences were noted for all the 2003 epidemic isolates: 1) an addition of 17 nt after position 1457 base; 2) additions at positions 804, 902, and 1558; and 3) deletions at positions 854 and 869. To confirm these mutations, we sequenced the 1965 isolate available with the repository of the institute and noted that the 1965 sequence did not exhibit the deletions or additions mentioned above. The corrected 1965-CHP-G gene sequence was deposited in GenBank (accession no. AY614717) and used for comparisons. When compared with the corrected sequence, the 2003 epidemic isolates did not exhibit the mutations mentioned above. Although Walker and Kongsuwan resequenced part of the G gene of the 1965 isolate (262 nt) and made necessary corrections (7), these were not deposited in GenBank.

The epidemic isolates exhibited 97% [+ or -] 0.3% nucleotide identity (PNI) with each other and 95.6%-96.1% PNI with the 1965 isolate. For CIN0360 and C1N0327 isolates, grown in 2 different cell lines, the PNIs were 100% and 99.9%, respectively. Comparison of partial G gene sequences from clinical samples (N = 3) with the corresponding cell-line isolates documented that, although sequences derived from different clinical samples exhibited unique mutations, except for 1 substitution in CIN0331M isolate (A1167C), no changes were noted (see online Figure 1; available from http://www.cdc.gov/ncidod/EID/ voll lno01/04-0602-G1.htm).

Alignment of deduced amino acid sequences of the G protein (530 amino acids [aa]) from different isolates is depicted in online Figure 2 (available from http://www.cdc.gov/ncidod/EID/vol11no01/04-0602G2.htm). A total of 7 aa substitutions were noted for the epidemic isolates: Leul9Ser, Thr22Ser, Thr219Ala, Gly222Ala, Arg264Lys, His269Pro, and Thr279Ala. In addition, the brain-derived isolate exhibited 4 more substitutions: Ile 16Val, Asn30Ser, lle218Val, and Arg502Lys. This isolate did not replace Pro [right arrow] Met at position 367 seen in other epidemic isolates. Two amino acid substitutions (Lys40Arg and Leu424Val) were seen in the isolates from encephalitis cases (CIN0327M and CIN0327R). One isolate from a febrile patient, CIN0309R, showed an additional substitution, Asp213Val.

N gene analysis showed that the 1965 isolate was 96.5%-97.6% identical at the nucleotide level with the epidemic isolates, whereas the epidemic isolates were 97.7% [+ or -] 0.3% identical with each other. The isolates grown in different cell lines exhibited 99.3%-99.5% PNI. A single amino acid substitution, Lys37Arg, was noted for all epidemic isolates (online Figure 3, available from http://www.cdc.gov/ncidod/EID/voll1no01/04-0602G3.htm). In all isolates except CIN0331M, Asp substituted Glu at 364. Additional substitutions, Val413Ile (brain-derived isolate) and Ala163Thr (CIN0309R, from a febrile case), were present.

For the P gene, among epidemic isolates, the PNI was 97.4% [+ or -] 0.4%, whereas 95.8%-96.8% identity was observed with the 1965 isolate. The isolates grown in different cell lines were 99%-99.7% identical at the nucleotide level. Glu64Asp substitution was present in all the epidemic isolates (online Figure 4; available from http://www.cdc.gov/ncidod/EID/vol11no01/04-0602G4.htm). A unique single amino acid substitution was noted for 3 isolates: Glnl03Arg in CIN0309R (febrile case), IlelSOVal in brain-derived isolates, and Asn257Thr in CIN0327M (encephalitis case). In addition, Gly112Glu substitution was recorded in 4 isolates (CIN0327R, CIN0327M, CIN0309R, and CIN0331M); Ala214Val was present in all except CIN0327R, CIN0360R, and Ile270Val in 3 isolates (C1N0318R, CIN0309R, and CIN0331M).

The Figure presents the phylogenetic status of different epidemic isolates. Overall, different CHPV isolates were not very divergent from each other. For G and P gene-based analyses, the brain-derived isolate was closer to the 1965 isolate. No segregation of fever and encephalitis case-derived isolates was noted. Although the topology for the unrooted N gene-based tree was similar, the 1965 isolate remained on a separate branch.

Conclusions

This study showed that the 2003 epidemic isolates were closely related to the 1965 isolate. PNIs were 95.6%-96.1% for the G gene, which is responsible for virus entry into cells and induction of neutralizing antibodies; 96.5%-97.6% for the N gene, mainly associated with cytotoxic T-lymphocyte responses; and 95.8%-96.8% for the P gene, associated with RNA polymerase. Thus, the epidemic was not associated with extensive mutations in these genes. Adaptation to cell cultures did not result in changes in the partial G gene sequences, except for 1 nt change (A to C at position 1167) for 1 isolate.

The comparison of the deduced amino acid sequences of G protein of 1965 and 2003 isolates documented 7 differences for the epidemic isolates. None of these were in the transmembrane region sequence (482-502 aa) or in the intracytoplasmic region sequence (503-530, the carboxyl end of the protein). No change in the signal sequence was noted for CIN0309R, the only isolate sequenced completely in this region. Additional amino acid substitutions were recorded for the brain-derived isolate. These included Ile16Val, the signal sequence, and Arg502Lys, the transmembrane region sequence. Both N and P proteins were highly conserved, with only 1 aa substitution at positions 37 and 64, respectively. Importance of the amino acid substitutions in these proteins in the pathogenesis of CHPV infection remains to be determined. As modeled by Walker and Kongsuwan (7), major antigenic sites for Vesicular stomatitis virus (New Jersey) neutralization escape mutations correspond to the CHPV G domain exhibiting multiple amino acid changes in epitope VII (Yhr219Ala and Gly222Ala) and epitope VI (Arg264Lys and His269Pro).

Phylogenetic analyses based on G and P genes (Figure) showed that the brain-derived isolate clustered with the 1965 isolate. No segregation of the isolates from encephalitis and febrile cases was noted, regardless of the type of the viral gene examined, a finding that suggests the importance of host factors in influencing the outcome of the infection.

In conclusion, the present study shows that Chandipura viruses isolated from human cases in India in 1965 and 2003 were not very divergent. Although several amino acid differences were recorded in G protein, the importance of these changes in the pathogenesis of CHPV infection needs to be determined. Generation of infectious cDNA clones for 1965 and 2003 isolates and assessment of individual genes in the pathogenesis of CHPV infection may help in understanding the relationship of structure to outcome for CHPV infections.

Table 1. Details of the Chandipura viral isolates examined

Patient no   Place (state)      Isolate/date       Cell line
                                  of origin

1             KarimNagar          CIN0327M           MDCK
                (AP) *            July 2003
1             Karimnagar          CIN0327R            RD
                 (AP)             July 2003
2             Karimnagar          CIN036OR            RD
                 (AP)             July 2003
2             Karimnagar          CIN0360V           Vero
                 (AP)             July 2003
3             Karimnagar          CIN0331M           MDCK
                 (AP)             July 2003
4             Karimnagar          CIN0309R            RD
                 (AP)             July 2003
5             Karimnagar          CIN0318R            RD
                 (AP)             July 2003
6             Chandipura     CIN6514V ([dagger])    BS-C-1
             (Maharashtra)        June 1965

Patient no   Place (state)      Isolate/date        Inoculum
                                  of origin

1             Karimnagar          CIN0327M         Throat swab
                (AP) *            July 2003
1             Karimnagar          CIN0327R         Throat swab
                 (AP)             July 2003
2             Karimnagar          CIN036OR            Brain
                 (AP)             July 2003
2             Karimnagar          CIN0360V            Brain
                 (AP)             July 2003
3             Karimnagar          CIN0331M         Throat swab
                 (AP)             July 2003
4             Karimnagar          CIN0309R         Throat swab
                 (AP)             July 2003
5             Karimnagar          CIN0318R         Throat swab
                 (AP)             July 2003
6             Chandipura     CIN6514V ([dagger])      Serum
             (Maharashtra)        June 1965

Patient no   Place (state)      Isolate/date       Clinical category
                                  of origin

1             Karimnagar          CIN0327M           Encephalitis
                (AP) *            July 2003
1             Karimnagar          CIN0327R           Encephalitis
                 (AP)             July 2003
2             Karimnagar          CIN036OR           Encephalitis
                 (AP)             July 2003
2             Karimnagar          CIN0360V           Encephalitis
                 (AP)             July 2003
3             Karimnagar          CIN0331M           Encephalitis
                 (AP)             July 2003
4             Karimnagar          CIN0309R               Fever
                 (AP)             July 2003
5             Karimnagar          CIN0318R               Fever
                 (AP)             July 2003
6             Chandipura     CIN6514V ([dagger])         Fever
             (Maharashtra)        June 1965

Patient no   Place (state)      Isolate/date          Accession no.
                                  of origin

1             Karimnagar          CIN0327M          G gene: AY382603
                (AP) *            July 2003        N/P gene: AY614725
1             Karimnagar          CIN0327R          G gene: AY614718
                 (AP)             July 2003        N/P gene: AY614726
2             Karimnagar          CIN036OR          G gene: AY614719
                 (AP)             July 2003        N/P gene: AY614731
2             Karimnagar          CIN0360V          G gene: AY614720
                 (AP)             July 2003        N/P gene: AY614730
3             Karimnagar          CIN0331M          G gene: AY614721
                 (AP)             July 2003        N/P gene: AY614729
4             Karimnagar          CIN0309R          G gene: AY614723
                 (AP)             July 2003        N/P gene: AY614728
5             Karimnagar          CIN0318R          G gene: AY614722
                 (AP)             July 2003        N/P gene: AY614727
6             Chandipura     CIN6514V ([dagger])    G gene: AY614717
             (Maharashtra)        June 1965        N/P gene: AY614724

* AP, Andhra Pradesh

([dagger]) 1965 isolate.

Table 2. Primers used for amplification and sequencing

Gene                           Primers

G gene
  CHAND-G-F1     27-5' ATGACTTCTTCAGTGACAATTAGT 3'-50
  CHAND-G-F2     425-5' GTCTTGTGGTTATGCTTCTGT 3'-445
  CHAND-G-F3    853-5' TGTGTCCGACCGGGATCAGAGGT 3'-875
  CHAND-G-F4     1278-5' GACAATGAACTACACGAGCT 3'-1297
  CHAND-G-R1   1741-5' TCATCCACCGGGTTGAGATCCAT 3'-1708
  CHAND-G-R2    1342-5' TGAGCATGAGGTAGCTGTGGAT 3'-1321
  CHAND-G-R3      30-5' TCCTCTGAATCTCTGAGGTC 3'-911
  CHAND-G-R4     471-5' TGATTACCAAGAACTCAGAGT 3'-451
N / P gene
  CHAND-N-F1       31-5' TATAGTAGTACACGAACACT 3'-50
  CHAND-N-F2     481-5' TCTTTGGTCTTTATCGTG TGT 3'-501
  CHAND-N F3     871-5' TTGACCAAGCTGATTCCTACAT 3'-892
  CHAND-N-F4    1279-5' TAGGAGATATTCGAGTGAACT 3'-1299
  CHAND-N-F5   1742-5' TGAGTGCTCTCCAACTTCTGCAGT 3'-1765
  CHAND-N-F6   2281-5' CAGATTCTCTGTTGCTTACCACT 3'-2306
  CHAND-N-R1      531-5' TCTTCTTGTACTCGACCTGT 3'-512
  CHAND-N-R2     942-5' TTGAAGAGTAAGGAGACTTCGT 3'-921
  CHAND-N-R3     1320-5' TCCTGGCGTACTCTGCAACT 3'-1301
  CHAND-N-R4    1830-5' TGTGCTGATCTGCAACAGCCT 3'-1810
  CHAND-N-R5   2331-5' TTCTTCAGAGCTTGCATCTTGAT 3'-2309
  CHAND-3'-F      11-5' TATGTCTTATAAGAATGCTATT 3'-32

References

(1.) Rao BL, Basu A, Wairagkar NS, Gore MM, Arankalle VA. Thakare JR et ah A large outbreak of acute encephalitis with high case fatality rate in children in Andhra Pradesh, India in 2003 associated with Chandipura virus. Lancet. 2004;364:869-74.

(2.) Bhatt PV, Rodriguez FM. Chandipura: a new arbovirus isolated in India from patients with febrile illness. Indian J Med Res. 1967;55:1295-305.

(3.) Rodrigues J J, Singh PB, Dave DS, Prasan R, Ayachit V, Shaikh BH, et al. Isolation of Chandipura virus from the blood in acute encephalopathy syndrome, Ind J Med Res. 1983;77:303-7.

(4.) Masters PS. Banerjee AK. Sequences of Chandipura virus N and NS genes: evidence for high mutability of the NS gene within vesiculoviruses. Virology. 1987:157:298-306.

(5.) Masters PS, Bhella RS, Butcher M, Patel B, Ghosh HP, Banerjee AK. Structure and expression of the glycoprotein gene of Chandipura virus. Virology. 1989:171:285-90.

(6.) Galtier N, Gouy M, Gautier C. SeaView and Phylo_win, two graphic tools for sequence alignment and molecular phylogeny