Printer Friendly
The Free Library
14,457,828 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Functional characterization of polymorphisms in DNA repair genes using cytogenetic challenge assays.


A major barrier to understanding the role of polymorphic polymorphic - polymorphism  DNA repair DNA repair refers to a collection of processes by which a cell identifies and corrects damage to the DNA molecules that encode its genome. In human cells, both normal metabolic activities and environmental factors such as UV light can cause DNA damage, resulting in as many as 1  genes for environmental cancer is that the functions of variant genotypes are largely unknown. Using our cytogenetic cytogenetic /cy·to·ge·net·ic/ (-je-net´ik)
1. pertaining to chromosomes.

2. pertaining to cytogenetics.


cytogenetic

pertaining to or originating from the origin and development of the cell.
 challenge assays, we conducted an investigation to address the deficiency. Using X-rays or ultraviolet (UV) light, we irradiated blood lymphocytes Lymphocytes
Small white blood cells that bear the major responsibility for carrying out the activities of the immune system; they number about 1 trillion.
 from 80 nonsmoking non·smok·ing  
adj.
1. Not engaging in the smoking of tobacco: nonsmoking passengers.

2. Designated or reserved for nonsmokers: the nonsmoking section of a restaurant.
 donors to challenge the cells to repair the induced DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 damage, and we analyzed expression of chromosome aberrations (CA) specific to the inducing agents. We have genotyped polymorphic DNA repair genes preferentially involved with base excision repair Base excision repair (BER) is a cellular mechanism that can repair damaged DNA during DNA replication. Repairing DNA sequence errors is necessary so that mutations are not induced during replication.  (BER (1) (Basic Encoding Rules) A set of encoding rules for ASN.1 notation, which is a method for defining data structures. See ASN.1.

(2) (Bit Error Rate) The average number of bits transmitted in error. See BERT.

1.
) and nucleotide excision repair Nucleotide excision repair is a DNA repair mechanism. DNA constantly requires repair due to damage that can occur to bases from a vast variety of sources including chemicals but also ultraviolet (UV) light from the sun.  (NER) activities (XRCC XRCC Xerox Research Centre of Canada
XRCC X-Ray Repair, Complementing Defective, in Chinese Hamster
1, XRCC3, APE1, XPD XPD Palladium Ounces
XPD X-Ray Photoelectron Diffraction
XPD Expedite
XPD Cross Polarization Discrimination
XPD ATC Transponder
XPD Palladium Exchange Rate (ounces) 
) corresponding to the repair of X-ray- and UV light-induced DNA damage, respectively. We expected that defects in specific DNA repair pathways due to polymorphisms would cause corresponding increases of specific CA. From our data, XRCC1 399Gln and XRCC3 241Met were associated with significant increases in chromosome deletions compared with the corresponding homozygous ho·mo·zy·gous
adj.
Having the same alleles at one or more gene loci on homologous chromosome segments.


Homozygous
Identical genes controlling a specified inherited trait.
 wild types (18.27 [+ or -] 1.1 vs 14.79 [+ or -] 1.2 and 18.22 [+ or -] 0.99 vs 14.20 [+ or -] 1.39, respectively); XPD 312Asn and XPD 751Gln were associated with significant increases in chromatid chromatid (krō`mətəd): see chromosome; crossing over.  breaks compared with wild types (16.09 [+ or -] 1.36 vs 11.41 [+ or -] 0.98 and 16.87 [+ or -] 1.27 vs 10.54 [+ or -] 0.87, respectively), p < 0.05. The data indicate that XRCC1 399Gln and XRCC3 241Met are significantly defective in BER, and the XPD 312Asn and XPD 751Gin are significantly defective in NER. In addition, the variant genotypes interact significantly, with limited overlap of the two different repair pathways. Key words: challenge assay, chromosome aberrations, DNA damage, DNA repair, DNA repair gene polymorphisms, genetic susceptibility. Environ Health Perspect 111:1843-1850 (2003). doi:10.1289/txg.6632 available via http://dx.doi.org/[Online 6 October 2003]

**********

On a daily basis, endogenous and exogenous Exogenous

Describes facts outside the control of the firm. Converse of endogenous.
 agents induce cellular DNA damage. If not repaired, the damage can interfere with important cellular functions and can cause serious health problems such as cancer. Therefore, a variety, of DNA repair processes such as the base excision repair (BER), nucleotide excision repair (NER), and mismatch and double-strand break repairs have evolved to perform the critical repair functions (Dybdahl et al. 1999; Friedberg 2003). The BER pathway is involved in the repair of DNA damage caused by a variety of internal and external factors including ionizing radiation i·on·i·zing radiation
n.
High-energy radiation capable of producing ionization in substances through which it passes.


Ionizing radiation 
, alkylating agents, and oxidation. XRCCI and Apel enzymes play important roles in the BER pathway. The Apel protein incises the phosphodiester backbone of DNA immediately 5' to the baseless lesion, leaving a strand break with a normal 3'-hydroxyl group and a nonconventional 5'-abasic terminus (Wilson and Barsky 2001). XRCC1 acts as a scaffold for other DNA repair proteins such as DNA polymerase DNA polymerase /DNA po·lym·er·ase/ (pah-lim´er-as) any of various enzymes catalyzing the template-directed incorporation of deoxyribonucleotides into a DNA chain, particularly one using a DNA template.  [beta] and DNA ligase DNA ligase /DNA li·gase/ (li´gas) a ligase that catalyzes the linkage between two free ends of double-stranded DNA chains by forming a phosphodiester bond between them, as in the repair of damaged DNA.  II (reviewed by Caldecott 2003). The XRCC3 protein functions in the homologous homologous /ho·mol·o·gous/ (ho-mol´ah-gus)
1. corresponding in structure, position, origin, etc.

2. allogeneic.


ho·mol·o·gous
adj.
1.
 DNA double-strand break repair pathway and directly interacts with and stabilizes Rad51 (Bishop et al. 1998). NER is the major pathway in humans for the removal of cyclopyrimidine dimers and 6-4 photoproducts produced by ultraviolet (UV) light and a wide variety of bulky lesions formed by chemical agents (Friedberg et al. 1995). XPD proteins are involved in the NER pathway. They stabilize the transcription factor This article or section may be confusing or unclear for some readers.
Please [improve the article] or discuss this issue on the talk page.
 complex TFIIH and have 5 [right arrow] 3' DNA helicase activity (Lehmann 2001).

Mutations that affect the function of DNA repair enzymes are rare in the human population because they can cause serious health consequences. However, with the advent of the human genome The human genome is the genome of Homo sapiens, which is composed of 24 distinct pairs of chromosomes (22 autosomal + X + Y) with a total of approximately 3 billion DNA base pairs containing an estimated 20,000–25,000 genes.  program, variations in DNA sequences of repair genes were discovered recently (Shen Shen, in the Bible, place, perhaps close to Bethel, near which Samuel set up the stone Ebenezer.  et al. 1998). The surprise was that the frequencies of the variant gene alleles, based on single nucleotide polymorphisms Noun 1. single nucleotide polymorphism - (genetics) genetic variation in a DNA sequence that occurs when a single nucleotide in a genome is altered; SNPs are usually considered to be point mutations that have been evolutionarily successful enough to recur in a , reached the polymorphism polymorphism, of minerals, property of crystallizing in two or more distinct forms. Calcium carbonate is dimorphous (two forms), crystallizing as calcite or aragonite. Titanium dioxide is trimorphous; its three forms are brookite, anatase (or octahedrite), and rutile.  level in the population. In addition some of the polymorphisms may not be innocuous variations because the alterations can be predicted to cause the substitution of amino acids in the repair enzymes, presumably pre·sum·a·ble  
adj.
That can be presumed or taken for granted; reasonable as a supposition: presumable causes of the disaster.
 altering their repair functions (Mohrenweiser and Jones 1998; Shen et al. 1998). However, the functions of the variant genotypes have not yet been well characterized.

The discovery of DNA repair gene polymorphism has stimulated tremendous interest in research to determine if the variant genotypes are associated with cancer. Significant associations with lung cancer lung cancer, cancer that originates in the tissues of the lungs. Lung cancer is the leading cause of cancer death in the United States in both men and women. Like other cancers, lung cancer occurs after repeated insults to the genetic material of the cell. , head and neck cancer, and bladder cancer bladder cancer

Malignant tumour of the bladder. The most significant risk factor associated with bladder cancer is smoking. Exposure to chemicals called arylamines, which are used in the leather, rubber, printing, and textiles industries, is another risk factor.
 have been reported (Butkiewicz et al. 2001; Spitz spitz

Any of several northern dogs, including the chow chow, Pomeranian, and Samoyed, characterized by a dense, long coat, erect pointed ears, and a tail that curves over the back. In the U.S.
 et al. 2001; Stern et al. 2002; Sturgis et al. 2002; Tomescu et al. 2001; Zhou et al. 2003). However, a high number of the observations were not consistent with each other (reviewed by Benhamou and Sarasin 2002; Goode et al. 2002; Hu et al. 2002). In addition unexpected observations were reported. For example, inheritance of XPA XPA Xeroderma Pigmentosum, Complementation Group A (protien)
XPA X Public Access
XPA Extra Points Attempted (football) 
 variant alleles was associated with reduced risk for lung cancer (Wu et al. 2003). In association with the variant genotypes for XRCC1 and ERCC ERCC Excision-Repair Cross-Complementing
ERCC Engine(s) Running Crew Change
ERCC Electric Reliability Coordinating Council
ERCC Excision-Repair, Complementing Defective, in Chinese Hamster
3, the risk for lung cancer decreased as the pack-years of smoking increased (Zhou et al. 2003). There have been many proposed explanations to address the discrepancies. The consistent recommendation is that the functional consequences of the polymorphisms need to be characterized.

We have conducted an investigation to elucidate DNA repair function of certain variant genotypes using our cytogenetic challenge assays (Au 1993; Au et al. 1991; El Zein zein

the principal protein in maize. Has low nutritive value, being deficient in lysine and tryptophan.
 et al. 1995). The challenge assays have been validated to indicate abnormal DNA repair responses to X rays and to UV light on the basis of studies using the host cell reactivation reactivation

to become active after a period of quiescence or, as in bacterial and viral infections, latency.


cross reactivation
 assay and patients with skin cancer susceptibility (El Zein et al. 1995; Hallberg et al. 1997). Specifically, we have selected two groups of polymorphic DNA repair genes preferentially involved with BER and NER activities that correspond to the repair of X rays and UV light-induced DNA damage, respectively. The relationship between variant genotypes and the expression of X rays and UV light-induced chromosome aberrations (CA) in normal human lymphocytes was investigated. Our assumption is that defects in specific DNA repair pathways would lead to a corresponding increase in specific CA. The data indicate that XRCC1 399Gln and XRCC3 241Met are associated with defects in BER, and XPD 312Asn and XPD 751 Gln with NER.

Materials and Methods

Recruitment of Donors

In this study we recruited volunteers who were healthy and had a presumably stable lifestyle. Therefore, we advertised for healthy males and females who were in the middle age group (35-40 years of age), regardless of ethnicity. Potential volunteers were informed about the objectives of the study, the need to donate a blood sample, and the risk and benefit from participation in the study. Study participants filled out a questionnaire for lifestyle information and medical history and signed consent forms, according to according to
prep.
1. As stated or indicated by; on the authority of: according to historians.

2. In keeping with: according to instructions.

3.
 the approved protocol from the University Institutional Review Board. Exclusion criteria exclusion criteria AIDS Donor exclusion criteria, see there  were smoking of cigarettes, cigars, and pipes; previous exposure to radiation or hazardous chemicals; on medication; and history of cancer or from cancer families. Each qualified volunteer was asked to donate a single blood sample.

Laboratory Reagents and Cell Cultures

Standard laboratory culture reagents were purchased from Gibco Laboratory (Grand Island, NY) and from Murex mu·rex  
n. pl. mu·ri·ces or mu·rex·es
Any of various marine gastropods of the genus Murex common in tropical seas and having rough spiny shells, especially M. trunculus, the source of Tyrian purple.
 Biotech (Dartford, UK). The primers for genotyping Genotyping refers to the process of determining the genotype of an individual with a biological assay. Current methods of doing this include PCR, DNA sequencing, and hybridization to DNA microarrays or beads. , DNA 7;lq polymerase, and restriction enzymes were purchased from SigmaAldrich (St. Louis, MO).

Blood specimens were collected into Vacutainer tubes (Sigma-Aldrich) containing sodium heparin as an anticoagulant anticoagulant (ăn'tēkōăg`yələnt), any of several substances that inhibit blood clot formation (see blood clotting). . The specimens were labeled with a predetermined pre·de·ter·mine  
v. pre·de·ter·mined, pre·de·ter·min·ing, pre·de·ter·mines

v.tr.
1. To determine, decide, or establish in advance:
 code and transported to the laboratory as soon as possible after collection. Blood cultures were set tip according to the standard procedures in our laboratory (An et al. 1991). The cultures were normally set up within 2 hr from the time blood samples were drawn from the donors. The culture medium was made tip of RMPI RMPI Relationship Management Programs Incorporated  1640 medium that was supplemented with 10% heat-inactivated fetal bovine serum Fetal bovine serum ( or foetal bovine serum) is serum taken from the fetuses of cows. Fetal Bovine Serum (or FBS) is the most widely used serum in the culturing of cells. In some papers the expression foetal calf serum is used. , 2% phytohaemagglutinin Phytohaemagglutinin (PHA, or phytohemagglutinin) is a lectin found in plants, especially beans. It is found in the highest concentrations in uncooked red kidney beans (Phaseolus vulgaris), and it is also found in lower quantities in many types of green bean. , 100 U/mL penicillin, 100 [micro]g/mL streptomycin streptomycin (strĕp'tōmī`sĭn), antibiotic produced by soil bacteria of the genus Streptomyces and active against both gram-positive and gram-negative bacteria (see Gram's stain), including species resistant to other , and L-glutamine. Cultures were maintained in a water-jacketed C[O.sub.2] incubator set up at 37.5[degrees]C.

The X-Ray Challenge Assay

The challenge assay used in this study was developed in our laboratory and discussed in detail elsewhere (Au 1993; Au et al. 1991). For this assay, blood cultures were set up by placing 0.5 mL whole blood into culture tubes that each contained 4.5 mL culture medium as described above (Au et al. 1991). A Mark I cesium-137 pneumatic irradiator with a dose rate of approximately 80 cGy/min was used for the irradiation (J.L. Shephard, Glendale, CA). The cells were irradiated in the culture tubes 24 hr after culture initiation and the irradiation dose was 100 cGy. Fifty hours after culture initiation, cells were harvested using the standard Colcemid blocking procedure (An et al. 1991).

UV-Light Challenge Assay

The UV challenge assay was described in our previous publication (El Zein et al. 1995). Under UV irradiation conditions, target cells need to be irradiated as a monolayer mon·o·lay·er
n.
1. A film or layer one molecule thick formed at the interface between water and either oil or air by a substance such as a partially esterified fatty acid that contains both hydrophobic and hydrophilic groups in the same
 and without overlap from the other cell types. Therefore, lymphocytes were isolated from whole blood using Histopaque 1077 (Sigma-Aldrich) and used to set up the cultures (500,000 cells/mL in 5 mL culture, using the same culture medium described earlier). Twenty-four hours after initiation of the lymphocyte lymphocyte: see blood; immunity.
lymphocyte

Type of leukocyte fundamental to the immune system, regulating and participating in acquired immunity. Each has receptor molecules on its surface that bind to a specific antigen.
 cultures, the culture tubes were centrifuged to pack cells. The supernatant supernatant /su·per·na·tant/ (-na´tant) the liquid lying above a layer of precipitated insoluble material.

supernatant

the liquid lying above a layer of precipitated insoluble material.
 medium was removed and saved for reuse after the irradiation. The packed cells Noun 1. packed cells - a preparation of blood cells separated from the liquid plasma; "packed cells are given to severely anemic patients in order to avoid overloading the circulatory system with too much fluid"  from each culture were resuspended in 2 mL sterile saline and put into a 100-mL Petri dish pe·tri dish
n.
A shallow circular dish with a loose-fitting cover, used to culture bacteria or other microorganisms.



Petri dish

a shallow, circular, glass or disposable plastic dish used to grow bacteria on solid media such as agar.
 for irradiation. With the small volume of saline, the cells were therefore spread out into a thin layer with limited overlapping of cells. The source of UV light was a 15-W short-wave tube that produced a peak of intensity of l, 100 [micro]W/[cm.sup.2] of 254 nm at 15 cm distance. The irradiation dose was 4 J/[m.sup.2] for 4 sec. The irradiation was performed in a lamina LAMINA - A concurrent object-oriented language.

["Experiments with a Knowledge-based System on a Multiprocessor", Third Intl Conf Supercomputing Proc, 1988].
 flow hood with the lids of the Petri dishes removed. After the irradiation, cells were resuspended in their own growth medium saved earlier and allowed to grow for an additional 26 hr before harvesting.

Cell Harvesting

Before harvest, cells were blocked with Colcemid (final concentration 0.1 [micro]g/mL) for 1.5 hr. After removal of the culture medium, cells were treated with hypotonic hypotonic /hy·po·ton·ic/ (-ton´ik)
1. denoting decreased tone or tension.

2. denoting a solution having less osmotic pressure than one with which it is compared.
 solution (0.075 M KC1) and fixed with Carnoy's fixative fixative /fix·a·tive/ (fik´sit-iv) an agent used in preserving a histological or pathological specimen so as to maintain the normal structure of its constituent elements.

fix·a·tive
adj.
 (methanol and glacial acetic acid glacial acetic acid
n.
Acetic acid that is at least 99.8 percent pure.
 at 3:1 ratio). Cytological cytological, cytologic

pertaining to cytology.


cytological examination
examination of material for purposes of cytology. Carried out on cerebrospinal fluid, joint fluid, aspirates of body cavities and cystic lesions.
 preparations were made, coded, and stained with 10% Giemsa solution for 15 rain. The stained slides were air dried, and a cover slip was then put onto each slide. Under the microscope, metaphase metaphase /meta·phase/ (met´ah-faz) the second stage of cell division (mitosis or meiosis), in which the chromosomes, each consisting of two chromatids, are arranged in the equatorial plane of the spindle prior to separation.  cells were located and analyzed for the presence of CA (Au et al. 1991). Fifty metaphase cells were analyzed for every exposure condition and the data are expressed as percentages. One individual did all analyses using coded slides.

DNA Isolation and Genotyping

Genomic DNA genomic DNA
n.
The full complement of DNA contained in the genome of a cell or organism.
 was extracted from isolated lymphocytes by a standard nonorganic procedure (Miller et al. 1988). The extracted DNA was used for characterization of the following polymorphic DNA repair genes. These polymorphic genes were chosen because they reportedly are associated with several environmental cancers (Butkiewicz et al. 2001; Misra et al. 2003; Smith et al. 2003; Sturgis et al. 2002; Tomescu et al. 2001; Zhou et al. 2003). Polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
), followed by restriction fragment length polymorphism restriction fragment length polymorphism
n. Abbr. RFLP
Intraspecies variations in the length of DNA fragments generated by the action of restriction enzymes and caused by mutations that alter the sites at which these enzymes act, changing
, was used for genotyping. All genotype genotype (jēn`ətīp'): see genetics.
genotype

Genetic makeup of an organism. The genotype determines the hereditary potentials and limitations of an individual.
 assays were performed twice, and the repeat analyses were conducted independent of each other. Only concordant findings from these analyses were accepted.

For determination of polymorphism XRCC1 Arg194Trp, 100 ng genomic DNA was amplified in a total volume of 50 [micro]L containing 0.2 [micro]M of the following primer pairs: forward, 5 '-GCCCCGTCCCAGGTA-3', reverse, 5 '-AGC CCC CCC

A very speculative grade assigned to a debt obligation by a rating agency. Such a rating indicates default or considerable doubt that interest will be paid or principal repaid. Also called Caa.
 AAG AAG Association of American Geographers (Washington, DC)
AAG Assistant Attorney General
AAG Asociación Argentina de Golf
AAG Anti-Aircraft Gun
AAG Assistant Adjutant General
AAG Australian Association of Gerontology
 ACCC ACCC Association of Canadian Community Colleges
ACCC Australian Competition & Consumer Commission
ACCC Association of Community Cancer Centers
ACCC Academic Computing and Communications Center
ACCC American College of Chiropractic Consultants
 TTT-3', 1 x PCR buffer (150 mM Tris-HCl, pH 0.8, 500 mM KCl), 2.5 mM Mg[Cl.sub.2], 0.2 mM each deoxynucleoside triphosphate triphosphate /tri·phos·phate/ (tri-fos´fat) a salt containing three phosphate radicals.

tri·phos·phate
n.
A salt or ester containing three phosphate groups.
 (dNTP), and 1 U Taq polymerase Taq polymerase ("Taq Pol," or simply "Taq") is a thermostable polymerase used in polymerase chain reaction to check for the presence or absence of a gene by amplifying a DNA fragment. It replaced E.coli DNA polymerase in PCR because of the temperature conditions of PCR. . The PCR amplification condition consisted of initial denaturation denaturation, term used to describe the loss of native, higher-order structure of protein molecules in solution. Most globular proteins exhibit complicated three-dimensional folding described as secondary, tertiary, and quarternary structures.  step at 95[degrees]C for 2 min, followed by 40 cycles of 94[degrees]C for 15 sec, 57[degrees]C for 45 sec, 72[degrees]C for 45 sec, and final extension step at 72[degrees]C for 5 min. The PCR products (490 bp) were digested overnight with the restriction enzyme PvuII. The restricted products of XRCC1 codon codon: see nucleic acid.  194 Arg/Arg, Arg/Trp, and Trp/Trp genotypes had band sizes of 490, 490/294/196, and 294/196 bp, respectively (Hu et al. 2001).

For the XRCC1 Arg399Gln genotyping, 100 ng genomic DNA was amplified in a total reaction volume of 50 [micro]L containing 0.2 [micro]M of each of the forward primer, 5 '-CAAGTACAGCCAGGTCCTAG-3', reverse primer, 5'-CCTTCCCTCA TCTGGAGTAC-3', 1 x PCR buffer (150 mM Tris-HCl, pH 0.8, 500 mM KCl), 1.5 mM Mg[Cl.sub.2], 0.2 mM each dNTP, and 1 U Taq polymerase. The PCR amplification condition consisted of initial denaturation step at 95[degrees]C for 2 min, followed by 40 cycles of 94[degrees]C for 15 sec, 55[degrees]C for 30 sec, 72[degrees]C for 45 sec, and final extension step at 72[degrees]C for 5 min. The 248-bp PCR products were digested with NciI (Promega, Madison, WI); the Arg allele allele (əlēl`): see genetics.
allele

Any one of two or more alternative forms of a gene that may occur alternatively at a given site on a chromosome.
 was cut into 89 and 159 bp fragments (Gin allele not digested) (Matullo et al. 2001).

Polymorphism in exon Exon

In split genes, a portion that is included in the ribonucleic acid (RNA) transcript of a gene and survives processing of the RNA in the cell nucleus to become part of a spliced messenger RNA (mRNA) or structural RNA in the cell cytoplasm.
 10 of XPD, which contains G/A G/A Gate/Array (NEC)
G/A Ground/Air
G/A Ground-to-Air
, Asp312Asn, was determined using the method described by Spitz et al. (2001). The oligonucleotide primers 5 '-CTGTTGGTGGGTGCCCGTATCTGTTGGTCT-3 (bases 22872-22901 of XPD) and 5 '-TAATATCGGGGCTCACCCTGCAGCACTTCCT (bases 23592-23616 of XPD) were used. PCR was performed in 50-[micro]L reaction mixtures containing 1.5 mM Mg[Cl.sub.2], 0.2 mM dNTP, 3% dimethyl sulfoxide dimethyl sulfoxide (DMSO)

Colourless, nearly odourless liquid organic compound. It mixes in all proportions with water, ethanol, and most organic solvents and dissolves a wide variety of compounds (but not aliphatic hydrocarbons).
, 0.2 [micro]M primers, 100 ng template DNA, and 1.5 units Taq polymerase in 1 x PCR buffer [10 mM Tris-HCl (pH 9.0 at 25[degrees]C), 50 mM KCl, and 0.1% Triton X-100]. After an initial denaturation at 94[degrees]C for 4 min, the DNA was amplified by 30 cycles of 1 rain at 94[degrees]C, 1 min at 60[degrees]C j, and 1 min at 72[degrees]C, and then by a final extension step of 5 min at 72[degrees]C. The PCR product was digested with StyI for 8 hr at 37[degrees]C. The digestion products were then resolved on a 3% agarose agarose

more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments.
 gel containing ethidium bromide Ethidium bromide (sometimes abbreviated as EtBr) is an intercalating agent commonly used as a nucleic acid stain in molecular biology laboratories for techniques such as agarose gel electrophoresis. . The homozygous wild-type (Asp/Asp) was identified by two DNA bands (507 and 244 bp), the homozygous mutant type (Asn/Asn) produced three bands (474, 244, and 33 bp), and heterozygotes (Asp/Asn) displayed all four bands (507, 474, 244, and 33 bp).

The XPD Lys751Gln polymorphism, a transversion trans·ver·sion
n.
Eruption of a tooth in a position normally occupied by another.


transversion,
n eruption of a tooth in the wrong position
 A [right arrow] C in exon 23 (position 35931), was determined using the primers (forward) 5'-CTGCTCAGCCTGGAGCAGCTAGA ATCAGAGGACGCTG-3' and (reverse) 5'-AAGACCTTCTAGCACCACCG-3'. The PCR condition consisted of initial denaturation step at 95[degrees]C for 2 min, followed by 40 cycles of 94[degrees]C for 15 sec, 67[degrees]C for 30 sec, 72[degrees]C for 45 sec, and final extension step at 72[degrees]C for 5 min. The 161-bp PCR product was digested with PstI (Promega); the Gln allele was cut into 41- and 120-bp fragments (Lys allele not digested).

The XRCC3 Thr241Met polymorphism was determined using the primers (forward) 5 '-GCCTGGTGGTCATCGACTC-3' and (reverse) 5'-ACAGGGCITCTGGAAGGCACTGCTCAGCTC ACGCACC-3' (underlined base modifies primer sequence introducing a cut site in the presence of the Met allele). The PCR condition consisted of initial denaturation step at 95[degrees]C for 2 min, followed by 40 cycles of 94[degrees]C for 15 sec, 60[degrees]C for 30 sec, 72[degrees]C for 45 sec, and final extension step at 72[degrees]C for 5 min. The 136-bp PCR product was digested with NcoI (Promega); the Met allele was cut into 39- and 97-bp fragments (Thr allele not digested) (Matullo et al. 2001).

For XRCC3 genotyping,the XRCC3 Thr241 Met polymorphism, a T [right arrow] C transition in exon 7 (position 18067) was determined using the following primers: sense, 5 '-G CCTG CCTG Campus California Teacher Group
CCTG California Christmas Tree Growers
 GTG (chat) gtg - Got to go. The user is about to stop chatting.  GTCATCGACTC- 3'; antisense antisense, DNA or RNA manipulated in a laboratory so that its components (nucleotides) form a complementary copy of normal, or "sense," messenger RNA (mRNA; see nucleic acid). , 5 '-ACAGGGCTCTGGAAGGCACTGCTCAGCTCACGCACC-3'. The PCR conditions consisted of 100 ng genomic DNA, 1.5 mM MgCI2, 200 [micro]M each dNTP, 0.5 U Taq, and 250 nM of each primer in 1 x PCR buffer. The PCR program was as follows: a 3-min denaturation step at 94[degrees]C, followed by 35 cycles of 95[degrees]C for 1 min, 60[degrees]C for 1 min, and 72[degrees]C for 1 min, followed by final extension step at 72[degrees]C for 5 min. The 136-bp PCR product was digested with NcoI restriction enzyme at 37[degrees]C for 6 hr; the Met allele was cut into 39-and 97-bp fragments (Thr allele not digested) (Matullo et al. 2001).

For APE1 genotyping (Hu et al. 2001), the polymorphism in APE1, exon 5, T/G T/G Turbine Generator , 148 Asp/Glu, was determined using the following primers: forward, 5 '-CTGTTTCATTTCTATAGGCTA-3'; reverse, 5 '-AGGAACTTGCGAAAGGCTTC-3'. About 100 ng genomic DNA in a total volume of 50 [micro]L was amplified by PCR. The reaction mixture consisted of PCR buffer (150 mM Tris-HCl, pH 8.0, 500 mM KC1), 2.5 mM Mg[Cl.sub.2], 0.2 mM each dNTP, 0.2 [micro]M each primer, and 1 U Taq polymerase. PCR conditions were 95[degrees]C for 2 min, followed by 40 cycles of 94[degrees]C for 15 sec, 57[degrees]C for 45 sec, 72[degrees]C for 45 sec, and a final elongation step at 72[degrees]C for 5 min. The 64-bp PCR product was digested with the BfaI restriction enzyme at 37[degrees]C for 6 hr. The restricted products of APE1 codon 148 Asp/Asp, Asp/Glu, and Glu/Glu genotypes are represented by band sizes of 164, 164/144/20, and 144/20 bp, respectively.

Statistical Analysis

The genotype and chromosome data were collected by two individuals and entered into a spreadsheet data file without further modification and used for statistical analyses by a third individual. All statistical tests were performed with the software SPSS A statistical package from SPSS, Inc., Chicago (www.spss.com) that runs on PCs, most mainframes and minis and is used extensively in marketing research. It provides over 50 statistical processes, including regression analysis, correlation and analysis of variance.  for Windows (version 10; SPSS Inc., Chicago, IL). CA was expressed as mean [+ or -] standard error of the mean (SE). Statistical significance was determined using analysis of variance (ANOVA anova

see analysis of variance.

ANOVA Analysis of variance, see there
), followed by Bonferroni's correction for multiple comparisons when the overall F-test was significant. CA frequency was further compared using stratified stratified /strat·i·fied/ (strat´i-fid) formed or arranged in layers.

strat·i·fied
adj.
Arranged in the form of layers or strata.
 analysis by genotype after adjusting for potential confounders in a general linear model. An alpha error (p) of less than 0.05 was used as the criterion of significance. Significant levels (p-values) correspond to two-sided tests.

Results

Characteristics of the Study Population

A total of 80 subjects participated in the current study. The use of donated blood specimens for the various assays was determined purely based on the availability of blood from the donors. Whole-blood lymphocyte cultures from 61 donors were used to investigate the effect of DNA repair polymorphisms in X-ray-induced CA. Isolated blood lymphocyte cultures from 49 donors were used to investigate DNA repair polymorphisms in UV-induced CA. As indicated in Table 1, there is no significant difference in age, gender, and distribution of the different genotypes between the entire study population and the two subpopulations. The genotype data were based on two independent and concordant determinations of each genotype. The distribution of the genotypes is not consistent with Hardy-Weinberg equilibrium. This observation is probably due to our limited sample size of a highly selective population. However, our investigation focuses on individual responses based on genotype composition of each individual and is not based on distribution of genotypes in the population. Therefore, the Hardy-Weinberg equilibrium condition does not affect the significance of our investigation.

Effect of X Rays and DNA Repair Gene Polymorphisms on Chromosome Aberrations

Irradiation of the whole-blood cultures from 61 donors with X rays resulted in the induction of different types of CA. Chromatid-type aberrations such as breaks and exchanges and chromosome-type aberrations such as deletions and dicentrics were observed. The frequencies of these aberrations together with aberrant aberrant /ab·er·rant/ (ah-ber´ant) (ab´ur-ant) wandering or deviating from the usual or normal course.

ab·er·rant
adj.
1.
 cells indicating the percentage of cells that contained any types of CA are summarized in Table 2. Because X rays preferentially induced chromosome-type aberrations such as deletions and dicentrics (Au et al. 2001), these aberrations were more frequently observed than chromatid-type breaks and exchanges (Table 2). Consequently, the aberrant cells category has high frequency as well. As shown in the table, XPD 312 Asn and XPD 751Gln are associated with slightly reduced aberration frequencies in most categories, with a reduction in diccntrics for the combined heterozygous het·er·o·zy·gous
adj.
1. Having different alleles at one or more corresponding chromosomal loci.

2. Of or relating to a heterozygote.
 and homozygous variant XPD 312Asn and XPD 751Gln. The reduction in dicentrics corresponded to the 2-fold increase of another type of translocation translocation /trans·lo·ca·tion/ (trans?lo-ka´shun) the attachment of a fragment of one chromosome to a nonhomologous chromosome. Abbreviated t. , chromatid exchanges (Table 2). Conversely, the XRCC1, XRCC3, and APE1 variant genotypes are associated with increased aberrations in most categories. Significant increases were observed for XRCC1 194Try in chromatid exchanges, XRCC1 399Gln in aberrant cells and deletions, and XRCC3 241 Met in deletions. Besides the mentioned significant differences, some variations in CA frequencies across the study population were observed, but these are normal observations in population studies. The variations are probably influenced by the presence of other polymorphic genotypes.

Effect of Ultraviolet Light Ultraviolet light
A portion of the light spectrum not visible to the eye. Two bands of the UV spectrum, UVA and UVB, are used to treat psoriasis and other skin diseases.
 and DNA Repair Gene Polymorphisms on Chromosome Aberrations

Irradiation of the isolated lymphocyte cultures from 49 donors with UV light resulted in the induction of CA that can be classified as aberrant cells, chromatid breaks, chromatid exchanges, and chromosome deletions (Table 3). Dicentrics, a chromosome-type translocation, were rarely observed; therefore, this type of abnormality was not meaningful for further evaluation. Chromatid-type aberrations such as breaks and exchanges are preferentially induced by UV light (Au et al. 2001); therefore, their frequencies are high and the aberrant cells category also has high frequencies. As shown in the table, XPD 312Asn and XPD 751Gln are consistently associated with increased CA in every evaluated category (Table 3). Specifically, the variant genotypes are significantly associated with increases in the aberrant cells and chromatid breaks categories. The variant genotypes for XRCC1, XRCC3, and APE1 are associated with increased CA in the most observed category (Table 3). However, significant association was observed only in the aberrant cells category for the XRCC1 194Trp. As mentioned earlier, normal variations in CA frequencies were observed.

Specificity of Genotypes on Chromosome Aberrations

By plotting the experimental data from Tables 2 and 3 into graphic formats, we were able to visualize better the genotype-specific effects on CA. The graphic formats also allowed us to hypothesize hy·poth·e·size  
v. hy·poth·e·sized, hy·poth·e·siz·ing, hy·poth·e·siz·es

v.tr.
To assert as a hypothesis.

v.intr.
To form a hypothesis.
 interactions among the different genotypes. We found that variant gene alleles for BER (XRCC1 194Trp, XRCC/399Gln, XRCC3 241 Met, and APE1 148Glu) but not those for NER (XPD 312Asn and XPD 751Gln) are consistently associated with defective repair of X-ray-induced DNA damage. The most revealing case involves the expression of increased chromosome deletions preferentially induced by X rays (Figure 1). Based on the figure, we hypothesized that the XRCC and APE variant genotypes would interact with each other but not with XPD variant genotypes. The analyses of the interactions support our hypothesis (Table 4). More important, gene dosage Gene dosage is the number of copies of a gene present in a cell or nucleus. An increase in gene dosage can cause higher levels of gene product if the gene is not subject to regulation from elsewhere in the body.  effects were documented. Additional interactions of genotypes (in combinations of threes) were not evaluated because the sample size for each group was too small to be meaningful.

As shown in Figure 2, the data indicate that the variant genotypes for NER genes (XPD 312Asn and XPD 751Gln) are consistently associated with defective repair of UV light-induced DNA damage, leading to significant increase of chromatid breaks, the aberrations preferentially induced by UV light. Conversely, the BER genes (XRCC and APE) are not: significantly or consistently involved with the repair of this type of damage. Interactive effects of variant genotypes in the repair of UV light-induced DNA damage were further investigated. As shown in Table 4, the only significant interactions were observed with the XPD variant genotypes and for chromatid breaks preferentially induced by UV light only. Significant gene-dosage effects were detected. Furthermore, there was no significant interaction between the BER and the NER genes.

Discussion

The results from ongoing investigations into the relationship between polymorphisms in DNA repair genes and susceptibility to environmental cancer have not yet produced consistent results (Benhamou and Sarasin 2002; Goode et al. 2002; Mohrenweiser et al. 2003). However, the inconsistency is most likely due to the complexity of the biological process and of molecular epidemiological investigations. A complementary approach to investigate the role of these polymorphic genes in human disease is to use biomarkers to conduct functional studies. Functional investigations using biomarkers still need to be interpreted carefully on the basis of their experimental design. For example, the use of nonsmoking healthy volunteers would allow us a better chance to elucidate the function of the gene alleles than the use of cigarette smokers or lung cancer patients because the latter conditions could interfere with gene functions. Furthermore, different biomarkers provide different quality of data for understanding the biological mechanisms leading to disease (Bonassi and Au 2002). For example, induction of CA and gene mutations involves the contribution of a spectrum of repair processes, and the data can be used to indicate increased risk for cancer. On the other hand, the presence of DNA adducts is used as a biomarker of exposure, and the extent of DNA repair in modifying the adduct adduct /ad·duct/ (ah-dukt´) to draw toward the median plane or (in the digits) toward the axial line of a limb.
adduct /ad·duct/ (a´dukt) inclusion complex.
 levels is not yet clear.

In our study we observed that XPD 312Asn is associated with significant increase in UV light-induced CA (aberrant cells and cells with chromatid breaks, shown in Table 3) but with no increase of CA from X-ray-irradiated cultures. This indicates specific defects in NER. The chromosome data are consistent with the involvement of the same genotype with a nonsignificant non·sig·nif·i·cant  
adj.
1. Not significant.

2. Having, producing, or being a value obtained from a statistical test that lies within the limits for being of random occurrence.
 increase of transversion p53 gene mutation in lung cancer patients (Hou et al. 2003) but not with DNA adducts levels in lymphocytes of lung cancer patients (Pastorelli et al. 2002). Similarly, our observation of specific DNA repair defects in XPD 751Gln is consistent with the significant increase of DNA adducts among healthy nonsmokers (Matullo et al. 2001) and with increased transversion t353 mutation in lung cancer patients (Hou et al. 2003) but not with changes in DNA adducts in lymphocytes of lung cancer patients (Pastorelli et al. 2002). Our data also showed that XPD 312 Asn and XPD 751Gln are associated with slightly reduced aberration frequencies in X-ray-challenged cells, with more reduction in dicentrics for the combined heterozygous and homozygous variant XPD 312Asn and XPD 751Gln (Table 2). However, this unexpected reduction in dicentrics may be caused by the corresponding 2-fold increase of another type of translocation, chromatid exchanges.

With respect to XRCC1 194Trp, we observed an association with increased CA, but the increase is not consistent or indicative of specific DNA repair defect. This is similar to the lack of association with 1353 gene mutation in oral cancer (Hsieh et al. 2003) and the lack of increased DNA adducts (Pastorelli et al. 2002). Nevertheless, the defective DNA repair activities interacted with XRCC1 399Gin to cause significant increase in X-ray-induced chromosome deletions (Table 4).

XRCC1 399Gln is associated with significant and specific CA indicative of defects in BER. This observation is consistent with the report that XRCC1 399Gln is associated with significant increase of t)53 gene mutation in oral cancer patients (Hsieh et al. 2003), significant increase of glycophorin A mutations in normal smokers and nonsmokers (Lunn et al. 1999), and significant increase of DNA adducts in normal nonsmokers (Matullo et al. 2001). However, our data are not consistent with the lack of increase of t:53 gene mutations in lung cancer patients (Hou et al. 2003) and the lack of increased DNA adducts in lung cancer patients (Pastorelli et al. 2002).

We showed that XRCC3 241Met is associated with BER defects. However, our data are not consistent with the lack of increase of DNA adducts in healthy donors (Matullo et al. 2001).

APE1 148Gln is associated with some repair defects and significant interactions with XRCC3 241Met. However, we have not been able to find any biomarker data in the literature to support or refute our observations.

On the basis of our data, we have observed a significant genotype-specific repair defects to the inducing agents, especially XRCC1 399Gln and XRCC3 241Met for X-rays, and XPD 312Asn and XPD 751Gln for UV light. More important, heterozygous and homozygous variant genotypes are consistently associated with higher CA than the wild-type genes. Combinations of variant genotypes also showed an increase in CA compared with the corresponding combined wild-type genes. Our precise observation is supported by a variety of studies in the literature although there are discrepancies. Most of the discrepancies are due to incompatible comparison with different studies; for example, the use of cigarette smokers, cancer patients, and inappropriate biomarkers in the other investigations. We believe that we are able to show the relatively precise response because our experimental conditions are vigorously controlled and the conditions are favorable for the elucidation of the function of the variant genotypes. For example; the use of X rays and UV light to elucidate DNA repair activities is not affected by many confounding confounding

when the effects of two, or more, processes on results cannot be separated, the results are said to be confounded, a cause of bias in disease studies.


confounding factor
 factors that can influence similar investigations using chemicals; for example, individual differences in cellular uptake, metabolism, and distribution of chemicals. The existence of polymorphic chemical-metabolizing genes in the population can further complicate the interpretation of results from studies using chemicals. In addition, the use of different types of CA indicative of repair defects from X rays and UV light allows us to elucidate the efficiency in DNA repair more precisely compared with other biomarkers.

Our data also indicate that the functions of the variant genotypes are complementary to each other in the same repair pathway, with limited overlap of genes from the other pathways. This suggests that individuals who have different variant genotypes that act in the same repair pathway may have further elevated risk for environmental disease due to synergistic interactions among the genotypes.

Using carefully selected DNA damage-inducing agents and appropriate biomarkers, we have provided data to indicate that some of the variant genotypes are associated with specific DNA repair defects. Specifically, XRCCI 399Gln and XRCC3 241Met in BER and XPD 312Asn and XPD 751Gln for NER are significantly defective. In addition, these genotypes interact significantly with each other without significant overlap of different repair pathways. No genotypes, either singly or in combination, are associated with enhanced repair activities that lead to significantly increased CA under our experimental conditions. The information is helpful in understanding the functions of polymorphic DNA repair genes and their role for susceptibility to environmental cancer.
Table 1. Selected characteristics of the study population.

Variable                                All subjects, n (%)

All subjects                                    80
Age, years (mean [+ or -] SE)           34.90 [+ or -] 0.82

Gender
  Female                                      15 (19)
  Male                                        65 (81)

XPD-312
  Asp/Asp                                     40 (50)
  Asp/Asn                                     34 (43)
  Asn/Asn                                      6 (7)

XPD-751
  Lys/Lys                                     39 (49)
  Lys/Gln                                     32 (40)
  Gln/Gln                                     09 (11)

XRCC 1-194
  Arg/Arg                                     54 (68)
  Arg/Trp                                     24 (30)
  Trp/Trp                                      2 (2)

XRCC 1-399
  Arg/Arg                                     32 (40)
  Arg/Gln                                     37 (46)
  Gln/Gln                                     11 (14)

XRCC3-241
  Thr/Thr                                     27 (34)
  Thr/Met                                     48 (60)
  Met/Met                                      5 (6)

APE1-148
  Asp/Asp                                     42 (53)
  Asp/Glu                                     37 (46)
  Glu/Glu                                      1 (1)

Variable                                   X rays, n(%)

All subjects                                    61
Age, years (mean [+ or -] SE)           34.51 [+ or -] 0.89

Gender
  Female                                      14 (23)
  Male                                        47 (77)

XPD-312
  Asp/Asp                                     34 (56)
  Asp/Asn                                     23 (38)
  Asn/Asn                                      4 (6)

XPD-751
  Lys/Lys                                     30 (49)
  Lys/Gln                                     25 (41)
  Gln/Gln                                     06 (10)

XRCC 1-194
  Arg/Arg                                     43 (71)
  Arg/Trp                                     18 (29)
  Trp/Trp                                      0 (0)

XRCC 1-399
  Arg/Arg                                     24 (39)
  Arg/Gln                                     26 (43)
  Gln/Gln                                     11 (18)

XRCC3-241
  Thr/Thr                                     20 (33)
  Thr/Met                                     37 (61)
  Met/Met                                      4 (6)

APE1-148
  Asp/Asp                                     31 (51)
  Asp/Glu                                     29 (47)
  Glu/Glu                                      1 (2)

Variable                                     UV, n (%)

All subjects                                    49
Age, years (mean [+ or -] SE)           34.96 [+ or -] 0.99

Gender
  Female                                      12 (24)
  Male                                        37 (76)

XPD-312
  Asp/Asp                                     27 (55)
  Asp/Asn                                     18 (37)
  Asn/Asn                                      4 (8)

XPD-751
  Lys/Lys                                     26 (53)
  Lys/Gln                                     17 (35)
  Gln/Gln                                     06 (12)

XRCC 1-194
  Arg/Arg                                     31 (63)
  Arg/Trp                                     18 (37)
  Trp/Trp                                      0 (0)

XRCC 1-399
  Arg/Arg                                     19 (39)
  Arg/Gln                                     22 (45)
  Gln/Gln                                      8 (16)

XRCC3-241
  Thr/Thr                                     17 (35)
  Thr/Met                                     29 (59)
  Met/Met                                      3 (6)

APE1-148
  Asp/Asp                                     25 (51)
  Asp/Glu                                     23 (47)
  Glu/Glu                                      1 (2)

Table 2. Effect of X-ray exposure and DNA repair gene polymorphisms on
chromosome aberrations.

                  Chromosomes aberration type (mean [+ or -] SE) (a)

Genotype (n)                       Aberrant cells

XPD-312
  Asp/Asp (34)                   27.50 [+ or -] 1.20
  Asp/Asn + Asn/Asn (27)         25.15 [+ or -] 1.40

XPD-751
  Lys/Lys (30)                   27.50 [+ or -] 1.27
  Lys/Gln + Gln/Gln (31)         25.45 [+ or -] 1.29

XRCC1-194
  Arg/Arg (43)                   26.21 [+ or -] 1.11
  Arg/Trp + Trp/Trp (18)         27.06 [+ or -] 1.61

XRCC 1-399
  Arg/Arg (24)                   24.17 [+ or -] 1.33
  Arg/Gln + Gin/Gin (37)         27.95 [+ or -] 1.17 *

XRCC3-241
  Thr/Thr (20)                   24.45 [+ or -] 1.67
  Thr/Met + Met/Met (41)         27.44 [+ or -] 1.06

APE1-148
  Asp/Asp (31)                   25.00 [+ or -] 1.16
  Asp/Glu + Glu/Glu (30)         27.97 [+ or -] 1.37

Genotype (n)                 Chromosome Chromatid breaks

XPD-312
  Asp/Asp (34)                   1.88 [+ or -] 0.30
  Asp/Asn + Asn/Asn (27)         1.56 [+ or -] 0.33

XPD-751
  Lys/Lys (30)                   1.93 [+ or -] 0.36
  Lys/Gln + Gln/Gln (31)         1.55 [+ or -] 0.26

XRCC1-194
  Arg/Arg (43)                   1.58 [+ or -] 0.26
  Arg/Trp + Trp/Trp (18)         2.11 [+ or -] 0.41

XRCC 1-399
  Arg/Arg (24)                   1.58 [+ or -] 0.34
  Arg/Gln + Gin/Gin (37)         1.84 [+ or -] 0.29

XRCC3-241
  Thr/Thr (20)                   2.00 [+ or -] 0.44
  Thr/Met + Met/Met (41)         1.61 [+ or -] 0.25

APE1-148
  Asp/Asp (31)                   1.61 [+ or -] 0.30
  Asp/Glu + Glu/Glu (30)         1.87 [+ or -] 0.33

Genotype (n)                     Chromatid exchanges

XPD-312
  Asp/Asp (34)                   0.65 [+ or -] 0.22
  Asp/Asn + Asn/Asn (27)         1.33 [+ or -] 0.68

XPD-751
  Lys/Lys (30)                   0.67 [+ or -] 0.22
  Lys/Gln + Gln/Gln (31)         1.23 [+ or -] 0.60

XRCC1-194
  Arg/Arg (43)                   0.51 [+ or -] 0.15
  Arg/Trp + Trp/Trp (18)         2.00 [+ or -] 1.01 *

XRCC 1-399
  Arg/Arg (24)                   0.92 [+ or -] 0.27
  Arg/Gln + Gin/Gin (37)         0.97 [+ or -] 0.51

XRCC3-241
  Thr/Thr (20)                   0.60 [+ or -] 0.26
  Thr/Met + Met/Met (41)         1.12 [+ or -] 0.46

APE1-148
  Asp/Asp (31)                   0.65 [+ or -] 0.23
  Asp/Glu + Glu/Glu (30)         1.27 [+ or -] 0.61

Genotype (n)                          Deletions

XPD-312
  Asp/Asp (34)                   16.94 [+ or -] 1.10
  Asp/Asn + Asn/Asn (27)         16.85 [+ or -] 1.31

XPD-751
  Lys/Lys (30)                   17.17 [+ or -] 1.20
  Lys/Gln + Gln/Gln (31)         16.65 [+ or -] 1.19

XRCC1-194
  Arg/Arg (43)                   16.74 [+ or -] 1.03
  Arg/Trp + Trp/Trp (18)         17.28 [+ or -] 1.47

XRCC 1-399
  Arg/Arg (24)                   14.79 [+ or -] 1.20
  Arg/Gln + Gin/Gin (37)         18.27 [+ or -] 1.10 *

XRCC3-241
  Thr/Thr (20)                   14.20 [+ or -] 1.39
  Thr/Met + Met/Met (41)         18.22 [+ or -] 0.99 *

APE1-148
  Asp/Asp (31)                   15.81 [+ or -] 1.11
  Asp/Glu + Glu/Glu (30)         18.03 [+ or -] 1.24

Genotype (n)                         Dicentrics

XPD-312
  Asp/Asp (34)                   12.21 [+ or -] 0.93
  Asp/Asn + Asn/Asn (27)          9.85 [+ or -] 0.74

XPD-751
  Lys/Lys (30)                   12.47 [+ or -] 1.01
  Lys/Gln + Gln/Gln (31)         09.90 [+ or -] 0.69

XRCC1-194
  Arg/Arg (43)                   11.70 [+ or -] 0.74
  Arg/Trp + Trp/Trp (18)          9.88 [+ or -] 1.17

XRCC 1-399
  Arg/Arg (24)                   10.21 [+ or -] 1.01
  Arg/Gln + Gin/Gin (37)         11.83 [+ or -] 0.80

XRCC3-241
  Thr/Thr (20)                   10.45 [+ or -] 0.95
  Thr/Met + Met/Met (41)         11.55 [+ or -] 0.82

APE1-148
  Asp/Asp (31)                   10.61 [+ or -] 0.85
  Asp/Glu + Glu/Glu (30)         11.79 [+ or -] 0.94

(a) Expressed as aberrations per 100 cells; aberrant cells contain
cells that have any types of aberrations. * p < 0.05, ANOVA.

Table 3. Effect of UV exposure and DNA repair gene polymorphisms on
chromosome aberrations.

           Chromosome aberration type (mean [+ or -] SE) (a)

Genotype (n)                      Aberrant cells

XPD-312
  Asp/Asp (27)                  09.04 [+ or -] 0.68
  Asp/Asn + Asn/Asn (22)        12.82 [+ or -] 1.02 *

XPD-751
  Lys/Lys (26)                  08.46 [+ or -] 0.56
  Lys/Gln + Gln/Gln (23)        13.30 [+ or -] 0.99 *

XRCC1-194
  Arg/Arg (31)                  09.60 [+ or -] 0.76
  Arg/Trp + Trp/Trp (18)        12.53 [+ or -] 1.05 *

XRCC1-399
  Arg/Arg (19)                  10.63 [+ or -] 1.05
  Arg/Gln + Gln/Gln (30)        10.80 [+ or -] 0.83

XRCC3-241
 Thr/Thr (17)                   11.06 [+ or -] 1.06
 Thr/Met + Met/Met (32)         10.56 [+ or -] 0.82

APE1-148
  Asp/Asp (25)                  10.40 [+ or -] 0.89
  Asp/Glu + Glu/Glu (24)        11.08 [+ or -] 0.95

Genotype (n)                     Chromatid breaks

XPD-312
  Asp/Asp (27)                  11.41 [+ or -] 0.98
  Asp/Asn + Asn/Asn (22)        16.09 [+ or -] 1.36 *

XPD-751
  Lys/Lys (26)                  10.54 [+ or -] 0.87
  Lys/Gln + Gln/Gln (23)        16.87 [+ or -] 1.27 *

XRCC1-194
  Arg/Arg (31)                  12.80 [+ or -] 1.18
  Arg/Trp + Trp/Trp (18)        14.63 [+ or -] 1.26

XRCC1-399
  Arg/Arg (19)                  12.84 [+ or -] 1.40
  Arg/Gln + Gln/Gln (30)        13.93 [+ or -] 1.13

XRCC3-241
 Thr/Thr (17)                   13.65 [+ or -] 1.67
 Thr/Met + Met/Met (32)         13.44 [+ or -] 1.02

APE1-148
  Asp/Asp (25)                  13.52 [+ or -] 1.26
  Asp/Glu + Glu/Glu (24)        13.50 [+ or -] 1.24

Genotype (n)                    Chromatid exchanges

XPD-312
  Asp/Asp (27)                  0.44 [+ or -] 0.19
  Asp/Asn + Asn/Asn (22)        1.00 [+ or -] 0.37

XPD-751
  Lys/Lys (26)                  0.38 [+ or -] 0.19
  Lys/Gln + Gln/Gln (23)        1.04 [+ or -] 0.35

XRCC1-194
  Arg/Arg (31)                  0.53 [+ or -] 0.21
  Arg/Trp + Trp/Trp (18)        0.95 [+ or -] 0.39

XRCC1-399
  Arg/Arg (19)                  0.53 [+ or -] 0.34
  Arg/Gln + Gln/Gln (30)        0.80 [+ or -] 0.25

XRCC3-241
 Thr/Thr (17)                   0.94 [+ or -] 0.39
 Thr/Met + Met/Met (32)         0.56 [+ or -] 0.22

APE1-148
  Asp/Asp (25)                  0.64 [+ or -] 0.28
  Asp/Glu + Glu/Glu (24)        0.75 [+ or -] 0.29

Genotype (n)                     Chromosome breaks

XPD-312
  Asp/Asp (27)                  0.07 [+ or -] 0.07
  Asp/Asn + Asn/Asn (22)        0.27 [+ or -] 0.15

XPD-751
  Lys/Lys (26)                  0.15 [+ or -] 0.11
  Lys/Gln + Gln/Gln (23)        0.17 [+ or -] 0.12

XRCC1-194
  Arg/Arg (31)                  0.13 [+ or -] 0.08
  Arg/Trp + Trp/Trp (18)        0.63 [+ or -] 0.14

XRCC1-399
  Arg/Arg (19)                  0.30 [+ or -] 0.16
  Arg/Gln + Gln/Gln (30)        0.07 [+ or -] 0.07

XRCC3-241
 Thr/Thr (17)                   0.35 [+ or -] 0.19
 Thr/Met + Met/Met (32)         0.06 [+ or -] 0.06

APE1-148
  Asp/Asp (25)                  0.15 [+ or -] 0.11
  Asp/Glu + Glu/Glu (24)        0.17 [+ or -] 0.12

(a) Expressed as aberrations per 100 cells; aberrant cells contain
cells that have any types of aberrations. * p < 0.05, ANOVA.

Table 4. Effect of exposure and combined DNA repair gene polymorphisms
on chromosome aberrations.

                           Genotypes

 XPD-312      XPD-751      XRCC1-194      XRCC1-399

WW           WW
WM or MM     WW
WW           WM or MM
WM or MM     WM or MM

                          WW             WW
                          WM or MM       WW
                          WW             WM or MM
                          WM or MM       WM or MM

                                         WW
                                         WM or MM
                                         WW
                                         WM or MM

XPD-312     XRCC3-241     APE1-148

WW
WM or MM
WW
WM or MM

             WW
             WW
             WM or MM
             WM or MM

             WW           WW
             WM or MM     WW
             WW           WM or MM
             WM or MM     WM or MM

                      X Rays
 XPD-312              Mean (a) [+ or -] SE (n)

WW
WM or MM
WW
WM or MM

             Deletions
             12.33 [+ or -] 1.72 (14)
             18.14 [+ or -] 1.99 (10)
             18.85 [+ or -] 1.17 (29) *
             16.28 [+ or -] 2.24 (8)
             p = 0.021 (b)

             Deletions
             12.42 [+ or -] 2.04 (10)
             16.00 [+ or -] 2.02 (10)
             16.50 [+ or -] 1.70 (14)
             19.10 [+ or -] 1.22 (27) *
             p = 0.041(b)

             Deletions
             13.91 [+ or -] 2.03 (10)
             16.65 [+ or -] 1.41 (21)
             14.60 [+ or -] 2.02 (10)
             19.81 [+ or -] 1.43 (20)
             p = 0.066 (b)

                       UV
 XPD-312              Mean (a) [+ or -] SE (n)

             Chromatid breaks
WW           9.96 [+ or -] 1.18 (20)
WM or MM     13.79 [+ or -] 2.16 (6)
WW           15.57 [+ or -] 2.03 (7)
WM or MM     16.93 [+ or -] 1.32 (16) *
             p = 0.002 (b)

Abbreviations: MM, mutant homozygous; WM, wild-type/mutant
heterozygous; WW, wild-type homozygous.

(a) Mean values are adjusted by age and gender in the general
linear model.

(b) p-Value based on ANOVA test. * p < 0.05 compared with WW + WW
genotype, based on post-ANOVA testing with Bonferroni's correction
for multiple comparisons. Interactions among the other combinations
of genotypes were either not significant (see also Figures 1 and 2)
or not meaningful because the sample sizes were too small.


* Current address: The University of Tennessee The University of Tennessee (UT), sometimes called the University of Tennessee at Knoxville (UT Knoxville or UTK), is the flagship institution of the statewide land-grant University of Tennessee public university system in the American state of Tennessee.  at Memphis, Transplant Surgery Division, Memphis, TN 38163 USA.

REFERENCES

Au WW. 1993. Abnormal chromosome repair and risk to develop cancer. Environ Health Perspect 101(suppl 3):303-308.

Au WW, Badary O, Heo MY. 2001. Cytogenetic assays for monitoring populations exposed to environmental mutagens. In: Occupational Medicine: State of the Art Reviews (Wilkinson G, ed). Vol 16. Philadelphia:Hanley and Belfus, 345-357.

Au WW, Walker DM, Ward JB, Whorton E, Legator le·ga·tor  
n.
One that makes a will; a testator.



[Latin lg
 MS, Singh V. 1991. Factors contributing to chromosome damage in lymphocytes of cigarette smokers. Mutat Res 260:137-144.

Benhamou S, Sarasin A. 2002. ERCC2/XPD gene polymorphisms and cancer risk. Mutagenesis mutagenesis /mu·ta·gen·e·sis/ (mu?tah-jen´e-sis)
1. the production of change.

2. the induction of genetic mutation.


mu·ta·gen·e·sis
n. pl.
 17:463-469.

Bishop DK, Ear U, Bhattacharyya A, Calderone C, Beckett M, Weichselbaum RR, et al. 1998. Xrcc3 is required for assembly of Rad51 complexes in vivo in vivo /in vi·vo/ (ve´vo) [L.] within the living body.

in vi·vo
adj.
Within a living organism.



in vivo adv.
. J Biol Chem 273:21482-21488.

Bonassi S, Au WW. 2002. Biomarkers in molecular epidemiology molecular epidemiology Molecular medicine An evolving field that combines the tools of standard epidemiology–case studies, questionnaires and monitoring of exposure to external factors with the tools of molecular biology–eg, restriction endonucleases,  studies for health risk prediction. Mutat Res 511:73-86.

Butkiewicz D, Rusin M, Enewold L, Shields PG, Chorazy M, Harris CC. 2001. Genetic polymorphisms in DNA repair genes and risk of lung cancer. Carcinogenesis car·ci·no·gen·e·sis
n.
The production of cancer.



carcinogenesis

production of cancer.


biological carcinogenesis
viruses and some parasites are capable of initiating neoplasia.
 22:593-597.

Caldecott KW. 2003. RCC RCC - An extensible language. 1 and DNA strand break repair. DNA Repair (Amst) 2:955-969.

Dybdahl M, Frentz G, Vogel U, Wallin H, Nexo BA. 1999. Low DNA repair is a risk factor in skin carcinogenesis: a study of basal cell carcinoma basal cell carcinoma
n.
A slow-growing, locally invasive, but rarely metastasizing neoplasm of the skin derived from basal cells of the epidermis or hair follicles. Also called basal cell epithelioma.
 in psoriasis psoriasis (sôrī`əsĭs), occasionally acute but usually chronic and recurrent inflammation of the skin. The exact cause is unknown, but the disease appears to be an inherited, possibly autoimmune disorder that causes the  patients. Mutat Res 433:15-22.

El Zein R, Tyring S, Au WW. 1995. Chromosomal radiosensitivity radiosensitivity /ra·dio·sen·si·tiv·i·ty/ (ra?de-o-sen?si-tiv´i-te) sensitivity, as of the skin, tumor tissue, etc., to radiant energy, such as x-rays or other radiation.  of lymphocytes from skin-cancer prone patients. Mutat Res 335:143-149.

Friedberg EC. 2003. DNA damage and repair. Nature 421:436-440.

Friedberg, EC, Walker GC, Siede W. 1995. DNA Repair and Mutagenesis. Vol 17. Washington, DC:ASM (1) (Association for Systems Management) An international membership organization based in Cleveland, Ohio. Founded in 1947 and disbanded in 1996, it sponsored conferences in all phases of administrative systems and management.  Press, 698.

Goode EL, Ulrich CM, Potter JD. 2002. Polymorphisms in DNA repair genes and associations with cancer risk. Cancer Epidemiol Biomarkers Prey 11:1513-1530

Hallberg LM, Bechtold WE, Grady J, Legator MS, Au WW. 1997. Abnormal DNA repair activities in lymphocytes of workers exposed to 1,3-butadiene. Mutat Res 383:213-221.

Hou SM, Ryk C, Kannio A, Angelini S, Falt S, Nyberg F, et al. 2003. Influence of common XPO XPO Exportin
XPO Executive Petty Officer (US Coast Guard)
XPO Operations Plans Officer (Wing)
XPO Express Persistent Objects
 and XRCCI variant alleles on p53 mutations in lung tumors. Environ Mol Mutagen mutagen: see mutation.
mutagen

Any agent capable of altering a cell's genetic makeup by changing the structure of the hereditary material, DNA. Many forms of electromagnetic radiation (e.g.
 41:37-42.

Hsieh LL, Chien HT, Chen IH, Liao CT, Wang HM, Jung SM, et al. 2003. The XRCC1 399Gln polymorphism and the frequency of p53 mutations in Taiwanese oral squamous cell carcinomas squamous cell carcinoma
n.
A carcinoma that arises from squamous epithelium and is the most common form of skin cancer. Also called cancroid, epidermoid carcinoma.
. Cancer Epidemiol Biomarkers Prev 12:439-443.

Hu JJ, Mohrenweiser HW, Bell DA, Leadon SA, Miller MS. 2002. Symposium overview: genetic polymorphisms in DNA repair and cancer risk. Toxicol Appl Pharmacol 185:64-73.

Hu JJ, Smith TR, Miller MS, Mohrenweiser HW, Golden A, Case LD. 2001. Amino acid substitution variants of APE1 and XRCC1 genes associated with ionizing radiation sensitivity. Carcinogenesis 22:917-922.

Lehmann AR. 2001. The xeroderma pigmentosum xeroderma pig·men·to·sum
n.
A rare hereditary skin disorder caused by a defect in the enzymes that repair DNA damaged by ultraviolet light and resulting in hypersensitivity to the carcinogenic effect of ultraviolet light.
 group D (XPD) gene: one gene, two functions, three diseases. Genes Dev 15:15-23.

Lunn RM, Langlois RG, Hsieh LL, Thompson CL, Bell DA. 1999. XRCCI polymorphisms: effects on aflatoxin B1-DNA adducts and glycophorin A variant frequencies. Cancer Res 59:2557-2561.

Matullo G, Palli D, Peluso M, Guarrera S, Carturan S, Celentano E, et al. 2001. XRCC1, XRCC3, XPD gene polymorphisms, smoking and (32)P-DNA adducts in a sample of healthy subjects. Carcinogenesis 22:1437-1445.

Miller SA, Dykes DD, Polesky HF. 1988. A simple salting out procedure for extracting DNA from human nucleated nucleated /nu·cle·at·ed/ (noo´kle-at?id) having a nucleus or nuclei.

nu·cle·at·ed
adj.
Having a nucleus or nuclei.



nucleated

having a nucleus or nuclei.
 cells. Nuclei Acids Res 16:1215-5116.

Misra RR, Ratnasinghe D, Tangrea JA, Virtamo J, Andersen MR, Barrett M, et al. 2003. Polymorphisms in the DNA repair genes XPD, XRCC1, XRCC3, and APE/ref-1, and the risk of lung cancer among male smokers in Finland. Cancer Lett 191:171-178.

Mohrenweiser HW, Jones IM. 1998. Variation in DNA repair is a factor in cancer susceptibility: a paradigm for the promises and perils of individual and population risk estimation? Mutat Res 400:15-24.

Mohrenweiser HW, Wilson DM, Jones IM. 2003. Challenges and complexities in estimating both the functional impact and the disease risk associated with the extensive genetic variation in human DNA repair genes. Mutat Res 526:93-125.

Pastorelli R, Cerri A, Mezzetti M, Consonni E, Airoldi L. 2002. Effect of DNA repair gene polymorphisms on BPDE-DNA adducts in human lymphocytes. Int J Cancer 100:9-13.

Shen MR, Jones IM, Mohrenweiser H. 1998. Nonconservative amino acid substitution variants exist at polymorphic frequency in DNA repair genes in healthy humans. Cancer Res 58:604-608.

Smith TR, Miller MS, Lohman K, Lange EM, Case LD, Mohrenweiser HW, et al. 2003. Polymorphisms of XRCC1 and XRCC3 genes and susceptibility to breast cancer. Cancer Lett 190:183-190.

Spitz MR, Wu X, Wang Y, Wang LE, Shete S, Amos CI, et al. 2001. Modulation of nucleotide excision repair capacity by XPD polymorphisms in lung cancer patients. Cancer Res 61:1354-1357.

Stern MC, Johnson LR, Bell DA, Taylor JA. 2002. XPD codon 751 polymorphism, metabolism genes, smoking, and bladder cancer risk. Cancer Epidemiol Biomarkers Prey 11:1004-1011,

Sturgis EM, Dahlstrom KR, Spitz MR, Wei Q. 2002. DNA repair gene ERCC1 and ERCC2/XPD polymorphisms and risk of squamous cell carcinoma of the head and neck. Arch Otolaryngol Head Neck Surg 128:1084-1088.

Tomescu D, Kavanagh IS, Ha T, Campbell H, Melton mel·ton  
n.
A heavy woolen cloth used chiefly for making overcoats and hunting jackets.



[After Melton Mowbray, an urban district of central England.]
 DW. 2001. Nucleotide excision repair gene XPD polymorphisms and genetic predisposition genetic predisposition Molecular medicine The tendency to suffer from certain genetic diseases–eg, Huntington's disease, or inherit certain skills–eg, musical talent  to melanoma, Carcinogenesis 22:403-408.

Wilson DM III, Barsky D. 2001. The major human abasic endonuclease endonuclease /en·do·nu·cle·ase/ (-noo´kle-as) any nuclease specifically catalyzing the hydrolysis of interior bonds of ribonucleotide or deoxyribonucleotide chains. : formation, consequences and repair of abasic lesions in DNA. Mutat Res 485:283-307.

Wu X, Zhao H, Wei Q, Amos CI, Zhang K, Guo A, et al. 2003. XPA polymorphism associated with reduced lung cancer risk and a modulating effect on nucleotide excision repair capacity. Carcinogenesis 24:505-509.

Zhou W, Liu G, Miller DP, Thurston SW, Xu LL, Wain JC, et al. 2003. Polymorphisms in the DNA repair genes XRCC1 and ERCC2, smoking, and lung cancer risk. Cancer Epidemiol Biomarkers Prey 12:359-365.

Received 5 August 2003; accepted 6 October 2003.

William W. Au, (1) Salama A. Salama, (1), * and Carlos H. Sierra-Torres (2)

(1) Department of Preventive Medicine preventive medicine, branch of medicine dealing with the prevention of disease and the maintenance of good health practices. Until recently preventive medicine was largely the domain of the U.S.  and Community Health, The University of Texas Medical Branch "UTMB" redirects here. For other system schools, see University of Texas System.
The University of Texas Medical Branch (UTMB) is a component of the University of Texas System located in Galveston, Texas, about 50 miles (80 km) southeast of downtown Houston.
, Galveston, Texas
"Galveston" redirects here. For the town in the U.S. state of Indiana, see Galveston, Indiana.
Galveston is a city and the seat of Galveston County located along the Gulf Coast region in the U.S.
, USA; (2) Laboratorio de Genetica Humana, Departamento de Ciencas Fisiologicas, Universidad del Cauca, Popayan, Colombia

Address correspondence to W.W. Au, Department of Preventive Medicine and Community Health, 700 Harborside Dr., 2.102 Ewing Hall, The University of Texas Medical Branch, Galveston, Texas 77555-1 110 USA. Telephone: (409) 772-1545. Fax: (409) 772-9108. E-mail: wiiliam.au@utmb.edu

The investigation received partial financial support from a pilot project grant from the National Institute of Environmental Health Sciences The National Institute of Environmental Health Sciences (NIEHS) is one of 27 Institutes and Centers of the National Institutes of Health (NIH),which is a component of the Department of Health and Human Services (DHHS). The Director of the NIEHS is Dr. David A. Schwartz.  center (ES 06676) at the University of Texas Medical Branch. The study used services from the General Clinical Research Center with funding from the National Center for Research Resources The National Center for Research Resources or NCRR, is a United States government agency. NCRR provides funding to laboratory scientists and researchers for facilities and tools in the goal of curing and treating diseases.  (M01 RR-00073). The authors declare they have no conflict of interest.
COPYRIGHT 2003 National Institute of Environmental Health Sciences
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2003, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Toxicogenomics: article
Author:Sierra-Torres, Carlos H.
Publication:Environmental Health Perspectives
Date:Nov 15, 2003
Words:7972
Previous Article:Organization and evolution of the Cyp2 gene cluster on mouse chromosome 7, and comparison with the syntenic human cluster *.(Toxicogenomics: article)
Next Article:Human interactions are crucial for sustainable development.(Guest Editorial)



Related Articles
Toxicogenomics: an emerging discipline. (Focus).
Environmental genome project: focusing on differences to understand the whole. (Spheres of Influence).
On the 50th anniversary of solving the structure of DNA. (Editorials).
Toxicogenomics: roadblocks and new directions. (Standards).
Exploiting genome data to understand the function, regulation, and evolutionary origins of toxicologically relevant genes. (Meeting Report).
The role of genetic polymorphisms in environmental health. (Research Review).
Genetic variation in genes associated with arsenic metabolism: glutathione S-transferase omega 1-1 and purine nucleoside phosphorylase polymorphisms...
The utility of DNA microarrays for characterizing genotoxicity.(Genomics and Risk Assessment: Mini-Monograph)
Toxicogenomics through the Eyes of Informatics: conference overview and recommendations.(Meeting Report)
Comparative Mouse Genomics Centers Consortium (CMGCC): mouse models to improve understanding of the biological significance of human...

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles