Foot-and-mouth disease virus serotype A in Egypt.We describe the characterization of a foot-and-mouth disease foot-and-mouth disease, highly contagious disease almost exclusive to cattle, sheep, swine, goats, and other cloven-hoofed animals. It is caused by a virus that was identified in 1897. (FMD FMD foot-and-mouth disease. ) serotype serotype /se·ro·type/ (ser´o-tip) the type of a microorganism determined by its constituent antigens; a taxonomic subdivision based thereon. se·ro·type n. See serovar. v. A virus responsible for recent outbreaks of disease in Egypt. Phylogenetic phy·lo·ge·net·ic adj. 1. Of or relating to phylogeny or phylogenetics. 2. Relating to or based on evolutionary development or history. analysis of VP1 nucleotide sequences demonstrated a close relationship to recent FMD virus isolates from East Africa, rather than to viruses currently circulating in the Middle East. ********** Foot-and-mouth disease (FMD) is caused by 7 immunologically distinct serotypes, O, A, C, Asia 1, South African Territories (SAT) 1, SAT 2, and SAT 3, which belong to the species Foot-and-mouth disease virus (genus Aphthovirus, family Picornaviridae). Several of these serotypes circulate currently or periodically in the Middle East and North Africa (1). In Egypt, routine prophylactic vaccination has been conducted with a locally produced serotype O vaccine. The last outbreak of serotype O was in June 2000, and other serotypes have not been reported since 1972 when serotype A occurred (2). This report describes an FMD serotype A virus responsible for recent outbreaks of disease in Egypt. Clinical cases of FMD were first recognized on January 22, 2006, on a cattle farm at El Etehad in Ismailia, northeastern Egypt (Figure 1). Samples were submitted for laboratory investigation and serotype determination by using virus isolation, antigen ELISA ELISA (e-li´sah) Enzyme-Linked Immuno-Sorbent Assay; any enzyme immunoassay using an enzyme-labeled immunoreactant and an immunosorbent. ELISA n. , and reverse transcription-PCR (RT-PCR RT-PCR reverse transcriptase-polymerase chain reaction. See PCR1. ). Initial testing with antigen ELISA and RT-PCR assays suggested that multiple FMD virus (FMDV FMDV foot-and-mouth disease virus. ) serotypes may have been involved in the outbreak (data not shown), although only type A was later confirmed. On February 15, 2006, the Agriculture Ministry in Egypt notified international public health authorities (by reporting to the World Organization for Animal Health [OIE OIE Office International des Épizooties (French: International Office of Epizootics; Paris) OIE Oficina Internacional de Epizootias (Spanish: World Organization for Animal Health) ]) of 6 outbreaks of FMDV caused by serotype A in Ismailia and 12 additional outbreaks in 7 other Egyptian governorates: Alexandria (2 outbreaks), Behera (1 outbreak), Cairo (1 outbreak), Dakahlia (1 outbreak), Dumyat (5 outbreaks), Fayum (1 outbreak), and Menofia (1 outbreak). By April 6, 2006, 34 outbreaks of disease had been reported that affected >7,500 animals and involved an additional governorate (Kalubia). Most (96.7%) clinical FMD cases involved cattle; 411 cattle (mainly calves) reportedly died. Attempts to control the outbreaks were hampered by lack of an appropriate vaccine and concurrent outbreaks of highly pathogenic avian influenza avian influenza: see influenza. . FMD became widespread in Egypt, with the following numbers of animals affected per month: 6,189 (January), 1,858 (February), 3,035 (March), 401 (April), and 297 (May). A locally produced bivalent bivalent /bi·va·lent/ (bi-va´lent) 1. divalent. 2. the structure formed by a pair of homologous chromosomes by synapsis along their length during the zygotene and pachytene stages of the first meiotic prophase. FMDV vaccine, containing both [O.sub.1] and A/Egypt/2006 isolates, was released in mid-May 2006 for the first time in Egypt. No new cases have been reported since July 2006. The Study Clinical material from 5 cases (collected from 3 separate locations in Egypt; Table 1) was sent to the Food and Agricultural Organization of the United Nations (FAO FAO, n See Food and Agriculture Organization. ) World Reference Laboratory for FMD (WRLFMD) at the Institute for Animal Health, Pirbright, United Kingdom, for confirmatory diagnosis and characterization of the causative FMDV strain(s). The possibility that these samples contained multiple FMDV serotypes was also investigated. FMDV isolates causing cytopathic effects in primary bovine thyroid (BTy) cell cultures were generated from all samples. The cell culture--grown virus isolates and original clinical submissions were identified as FMDV serotype A by antigen-detection ELISA (3). [FIGURE 1 OMITTED] Total RNA RNA: see nucleic acid. RNA in full ribonucleic acid One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic was extracted from the first virus passage on BTy cells by using RNeasy kits (QIAGEN, Crawley, UK) for all 5 samples (EGY/1/2006-EGY/5/2006) (4). The complete VP 1 region of the genome was amplified by RT-PCR by using 2 primer sets (A-1C562F/EUR-2B52R and A-1C612F/EUR-2B52R; Table 2) and the following thermal profile: 42[degrees]C for 30 min; 94[degrees]C for 5 min; 35 cycles of 94[degrees]C for 60 s, 55[degrees]C for 60 s, and 72[degrees]C for 90 s, followed by a final extension of 72[degrees]C for 5 min. The sequence of each amplicon was determined by cycle sequencing as previously described (4) but with the primers NK72, A-1C612F, and A-1D523R (Table 2). An unrooted neighbor-joining tree was constructed by using MEGA version 3.1 (5). The robustness of the tree topology was assessed with 1,000 bootstrap See boot. (operating system, compiler) bootstrap - To load and initialise the operating system on a computer. Normally abbreviated to "boot". From the curious expression "to pull oneself up by one's bootstraps", one of the legendary feats of Baron von Munchhausen. replicates as implemented in the program. Additionally, maximum parsimony Maximum parsimony, often simply referred to as "parsimony," is a non-parametric statistical method commonly used in computational phylogenetics for estimating phylogenies. Under maximum parsimony, the preferred phylogenetic tree is the tree that requires the least number of (MEGA 3.1), minimum evolution (MEGA 3.1), and maximum likelihood (TREE-PUZZLE 5.2; [6]) trees were constructed; all 4 methods gave similar tree topologies (data not shown). Egyptian sequences shared a closer phylogenetic relationship with recent and historical isolates from East Africa rather than with contemporary serotype A viruses emerging from Iran, currently circulating in the Middle East and European Turkey European Turkey was the term used for the European territories of the Turkish Empire, from the Turkish Straits to the eastern borders of Austria. Today it mostly refers to the Turkish Thrace. (Figure 2). Other conventional "typing" PCRs were performed to investigate whether additional FMDV serotypes were present in these samples. A multiplex agarose agarose more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments. gel-based RT-PCR that targeted VP1 of O, A, C, and Asia 1 (primers P33, P38, P87-92, P40, P74-77) (7) generated a single band corresponding to the size expected (702 bp) for serotype A for all 5 samples (data not shown). In addition, a cocktail of primers (P1, P126, P150-153, P130, P159-161, P168-170) (7) recognizing VP1 of SAT1-3 serotypes did not show any bands after RT-PCR with these samples. However, amplicons of correct size (715 bp) were obtained after RT-PCR with samples EGY/1/2006, EGY/3/2006, and EGY/5/2006 when an additional primer set for SAT 1-3 VP1 (1D209F/ 2B208R) was used (8). Subsequent analysis of these SAT amplicons generated sequences that corresponded to serotype A, identical to the complete VP1 sequences of A/ EGY/1/2006 and A/EGY/2/2006. Together, these findings support the conclusion that FMDV corresponding to a single serotype A was present in this material. [FIGURE 2 OMITTED] For vaccine selection, serologic tests were conducted to evaluate the extent of in vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment. in vi·tro adj. In an artificial environment outside a living organism. cross-neutralization of A/EGY/1/2006 and A/EGY/2/2006 by antisera produced against available FMDV vaccine strains (9). The match ([r.sub.1] value) against the vaccine strains [A.sub.22]/Iraq/64 and A/Iran/96 that are regularly used elsewhere in the Middle East was less than the cut-off value of 0.3 ([r.sub.1] = 0.23 and 0.24, respectively), whereas an acceptable match ([r.sub.1] = 0.42) was found against the A/Eritrea/98 vaccine strain that is of East African Adj. 1. East African - of or relating to or located in East Africa origin. However, A/Eritrea/98 vaccine is not in routine production nor held in vaccine reserves and was therefore not available for immediate supply. A recent in vivo in vivo /in vi·vo/ (ve´vo) [L.] within the living body. in vi·vo adj. Within a living organism. in vivo adv. study demonstrated that a high potency [A.sub.22]/Iraq/64 vaccine could provide clinical protection against challenge with the new A/EGY/2006 virus (B. Haas, pers. comm., 2006). High-potency vaccines are known to protect even when relationship values are lower than the normal cut-off values (10). Conclusions Local interpretation of agarose-based RT-PCR assays and sequence data led the Egyptian authorities to initially suspect the involvement of at least 2 serotypes, A and SAT 2. However, tests performed at the WRLFMD conclusively showed the presence of a single serotype, A, in the samples received from Egypt. Unofficial reports suggest that the disease was introduced by animals imported from Ethiopia for slaughter (11). This hypothesis is consistent with the results of the molecular typing, which suggested a relation between strains of Egyptian and East African origin. The molecular typing confirms only that through the trade in live cattle, an East African type A strain was introduced, which was not contained at the quarantine station. The origin of the infection is unclear, since the animals in quarantine may have acquired infection at various points during shipment, including possible contaminated contaminated, v 1. made radioactive by the addition of small quantities of radioactive material. 2. made contaminated by adding infective or radiographic materials. 3. an infective surface or object. pens or other animals on board the ship, at the port before loading, or in transit from Ethiopia to the port of loading. Veterinary inspection of the quarantined animals also detected cases of lumpy skin disease (LSD LSD or lysergic acid diethylamide (lī'sûr`jĭk, dī'ĕth`ələmĭd, dī'ĕthəlăm`ĭd), alkaloid synthesized from lysergic acid, which is found in the fungus ergot ( ), and possibly the origin of the LSD epidemic in Egypt in 2006 may relate to the Ethiopian animal trade, which is supported by the reports of LSD epidemics in Ethiopia in 2005. Undoubtedly, the lack of reporting of disease preimportation or at the quarantine stations did not assist the authorities in controlling the disease. Because imported animals may acquire infection at any point up until their arrival, they must be vaccinated and tested for the absence of FMDV nonstructural proteins. Acknowledgments We thank Keith Sumption for assistance in the preparation of this article. This work was supported by Defra, UK (Reference Laboratory Contract and Research Grant nos. SE2921 and SE2935). The submission and serotyping of samples were supported by Defra and a grant from the FAO European Commission European Commission, branch of the governing body of the European Union (EU) invested with executive and some legislative powers. Located in Brussels, Belgium, it was founded in 1967 when the three treaty organizations comprising what was then the European Community for the Control of FMD (MTF/INT/003/EEC). The latter also supported an emergency mission of the World Reference Laboratory to Egypt to provide diagnostic support in March 2006. References (1.) Knowles NJ, Samuel AR. Molecular epidemiology molecular epidemiology Molecular medicine An evolving field that combines the tools of standard epidemiology–case studies, questionnaires and monitoring of exposure to external factors with the tools of molecular biology–eg, restriction endonucleases, of foot-and-mouth disease virus. Virus Res. 2003;91:65-80. (2.) Aidaros HA. Regional status and approaches to control of foot-and-mouth disease in the Middle East and North Africa. Rev Sci Tech. 2002;21:451-8. (3.) Ferris NP, Dawson M. Routine application of enzyme-linked immunosorbent assay enzyme-linked immunosorbent assay n. ELISA. Enzyme-linked immunosorbent assay (ELISA) A diagnostic blood test used to screen patients for AIDS or other viruses. in comparison with complement fixation complement fixation n. The binding of active complement to a specific antigen-antibody pair used in diagnostic tests, such as the Wasserman test, to detect the presence of a specific antigen or antibody. for the diagnosis of foot-and-mouth and swine vesicular diseases. Vet Microbiol. 1988;16:201-9. (4.) Knowles NJ, Samuel AR, Davies PR, Midgley RJ, Valarcher J-F. Evolution and spread of a pandemic pandemic /pan·dem·ic/ (pan-dem´ik) 1. a widespread epidemic of a disease. 2. widely epidemic. pan·dem·ic adj. Epidemic over a wide geographic area. n. strain of foot-and-mouth disease virus serotype O. Emerg Infect Dis. 2005;11:1887-93. (5.) Kumar S, Tamura K, Nei M. MEGA3: Integrated software Separate software components or applications that have been combined into one package. See integrated software package. for Molecular Evolutionary Genetics Evolutionary genetics is the broad field of studies that attempts to account for evolution in terms of changes in gene and genotype frequencies within populations and the processes that convert the variation with populations into more or less permanent variation between species. Analysis and sequence alignment. Brief Bioinform. 2004;5:150-63. (6.) Schmidt HA, Strimmer Strimmer Noun Trademark an electrical tool for trimming the edges of lawns Strimmer® n → cortacéspedes m inv (especial para los bordes) K, Vingron M, von Haeseler A. TREE-PUZZLE: maximum likelihood phylogenetic analysis using quartets and parallel computing Solving a problem with multiple computers or computers made up of multiple processors. It is an umbrella term for a variety of architectures, including symmetric multiprocessing (SMP), clusters of SMP systems, massively parallel processors (MPPs) and grid computing. . Bioinformatics. 2002;18:502-4. (7.) Reid SM, Hutchings GH, Ferris NP, De Clercq K. Diagnosis of foot-and-mouth disease by RT-PCR: evaluation of primers for serotypic cbaracterisation of viral RNA in clinical samples. J Virol Methods. 1999;83:l13-23. (8.) Reid SM, Ferris NP, Hutchings GH, Samuel AR, Knowles NJ. Primary diagnosis of foot-and-mouth disease by reverse transcription polymerase chain reaction “RT-PCR” redirects here. For real-time polymerase chain reaction, also called quantitative real time polymerase chain reaction or kinetic polymerase chain reaction, see real-time polymerase chain reaction. . J Virol Methods. 2000;89:167-76. (9.) Rweyemamu MM. Antigenic variation Antigenic variation is the process by which an infectious organism alters its surface proteins in order to evade a host immune response. This change in antigenic profile may occur as the pathogen passes through a host population (also called "antigenic diversity") or may take place in foot-and-mouth disease: studies based on the virus neutralization reaction Neutralization reaction (immunology) A procedure in which the chemical or biological activity of a reagent or a living organism is inhibited, usually by a specific neutralizing antibody. . J Biol Stand. 1984;12:323-37. (10.) Eble PL, de Bruin MG, Bouma A, van Hemert-Kluitenberg F, Dekker A. Comparison of immune responses after intra-typic heterologous heterologous /het·er·ol·o·gous/ (het?er-ol´ah-gus) 1. made up of tissue not normal to the part. 2. xenogeneic. het·er·ol·o·gous adj. 1. and homologous homologous /ho·mol·o·gous/ (ho-mol´ah-gus) 1. corresponding in structure, position, origin, etc. 2. allogeneic. ho·mol·o·gous adj. 1. vaccination against foot-and-mouth disease virus infection in pigs. Vaccine. 2006;24:1274-81. (11.) Sumption K, Pinto J, Lubroth J, Morzaria S, Murray T, De La Rocque S, et al. Foot-and-mouth disease: situation worldwide and major epidemiological events in 2005 2006. EMPRES EMPRES Emergency Prevention System for Transboundary Animals and Plant Pests and Diseases (United Nations-FAO) Focus On Bulletin. 2007;1:1-11. [cited 2007 Aug 21]. Available from http:// www.fao.org/docs/eims/upload/225050/focus_on_1_07_en.pdf Nick J. Knowles, * Jemma Wadsworth, * Scott M. Reid, * Katherine G. Swabey, * Alaa A. El-Kholy, ([dagger]) Adel Omar Abd El-Rahman, ([dagger]) Hatem M. Soliman,([dagger]) Katja Ebert, * Nigel P. Ferris, * Geoffrey H. Hutchings, * Robert J. Statham, * Donald P. King, * and David J. Paton * * Institute for Animal Health, Surrey, United Kingdom; and ([dagger]) Veterinary Sera and Vaccines Research Institute, Cairo, Egypt Address for correspondence: Nick J. Knowles, Institute for Animal Health, Pirbright Laboratory, Ash Rd, Pirbright, Woking GU24 0NF, UK; email: nick.knowles@bbsrc.ac.uk Use of trade names is for identification only and does not imply endorsement by the Public Health Service or by the U.S. Department of Health and Human Services Noun 1. Department of Health and Human Services - the United States federal department that administers all federal programs dealing with health and welfare; created in 1979 Health and Human Services, HHS . Mr Knowles is a molecular virologist virologist microbiologist specializing in virology. at the Institute for Animal Health. His research interest focuses on the molecular epidemiology and evolution of picornaviruses of animals, particularly FMDV.
Table 1. Foot-and-mouth disease type A viruses examined in the study
WRLFMID ref. no.
or virus name * Location
A/ARG/2000 Argentina
A/Trenquelauquen/ Trenquelauquen, Argentina
ARG/2001
[A.sub.24]/Cruzeiro/BRA/55 Cruzeiro, Brazil
A/CAR/15/2000 Lahore Vina, Vina, Adamawa, Cameroon
A/EGY/1/72 Alexandria, Egypt
A/EGY/1/2006 Ismailia, Egypt
A/EGY/2/2006 Ismailia, Egypt
A/EGY/3/2006 Ismailia. Egypt
A/EGY/4/2006 Fayoum, Egypt
A/EGY/5/2006 Domiat, Egypt
A/ETH/7/92 Shena, Ethiopia
A/ETH/1/94 Highland areas of Eastern Ethiopia
A/ETH/23/94 Nazret, East Shoa, Ethiopia
A5/Allier/FRA/60 Allier, France
A/GAM/44/98 Gambia
[A.sub.10]/HOL/42 Groot-Ammers, the Netherlands
A/IND/17/77 ([dagger]) Tamil Nadu, India
A/IRN/2/87 Mardabad, Kardaj, Tehran, Iran
A/IRN/1/96 Zarnan, Shahriar, Tehran, Iran
A/IRN/22/99 Tabriz, East Azerbaijan Province, Iran
A/IRN/1/2005 Ghalch-Sadri, Qom, Qom Province, Iran
[A.sub.22]/IRQ/24/64 Mosul, Iraq
[A.sub.21]/Lumbwa/KEN/64 Lumbwa, Kenya
[A.sub.23]/Kitale/KEN/64 Kitale, Kenya
A/KEN/15/98 Meru, Kenya
A/KEN/16/98A Nakuru, Kenya
A/KEN/29/2005 Embu, Eastern Province, Kenya
A/MAI/2/97 Mali
[A.sub.15]/Bangkok/TAI/60 Bangkok,Thailand
A/TAI/118/87 ([dagger]) Sara Buri, Thailand
AITAI/2/97 Thailand
[A.sub.12]/UK/119/32 Kent, United Kingdom
WRLFMID ref. no. GenBank
or virus name * Date collected Species accession no.
A/ARG/2000 2000 Not known AY593782
A/Trenquelauquen/ Mar 31, 2001 Bovine AY593786
ARG/2001
[A.sub.24]/Cruzeiro/BRA/55 1955 Bovine AJ251476
A/CAR/15/2000 2000 Bovine EF208755
A/EGY/1/72 May 13, 1972 Bovine EF208756
A/EGY/1/2006 Feb 9, 2006 Bovine EF208757
A/EGY/2/2006 Feb 9, 2006 Bovine EF208758
A/EGY/3/2006 Feb 9, 2006 Bovine EF208759
A/EGY/4/2006 Feb 16, 2006 Bovine EF208760
A/EGY/5/2006 Feb 19, 2006 Bovine EF208761
A/ETH/7/92 Oct 3, 1992 Bovine EF208765
A/ETH/1/94 Feb 2, 1994 Bovine EF208766
A/ETH/23/94 Mar 9, 1994 Not known EF208767
A5/Allier/FRA/60 1960 Bovine AY593780
A/GAM/44/98 Feb 4, 1998 Not known EF208768
[A.sub.10]/HOL/42 1942 Bovine M20715
A/IND/17/77 ([dagger]) 1977 Bovine AF204108
A/IRN/2/87 Mar 11,1987 Bovine EF208770
A/IRN/1/96 Nov 13, 1996 Bovine EF208771
A/IRN/22/99 1999 Bovine EF208772
A/IRN/1/2005 Apr 4, 2005 Bovine EF208769
[A.sub.22]/IRQ/24/64 1964 Bovine AJ251474
[A.sub.21]/Lumbwa/KEN/64 1964 Bovine AY593761
[A.sub.23]/Kitale/KEN/64 1964 Bovine AY593766
A/KEN/15/98 Sep 8, 1998 Bovine EF208774
A/KEN/16/98A Sep 15, 1998 Bovine EF208775
A/KEN/29/2005 Aug 24, 2005 Bovine EF208773
A/MAI/2/97 Not known Not known EF208776
[A.sub.15]/Bangkok/TAI/60 1960 Bovine AY593755
A/TAI/118/87 ([dagger]) 1987 Not known EF208777
AITAI/2/97 1997 Not known EF208778
[A.sub.12]/UK/119/32 1932 Bovine AY593752
* WRLFMD, World Reference Laboratory for Foot-and-Mouth Disease.
([dagger]) Not a WRLFMD reference no.
Table 2. Oligonucleotide primers used for RT-PCR and sequencing *
Primer sequence Position
Primer name (5' [right arrow] 3') Sense Gene ([dagger])
A-1C562F TACCAAATTACACACGGGAA Forward VP3 3123-3142
A-1C612F TAGCGCCGGCAAAGACTTTGA Forward VP3 3173-3193
EUR-21352R GACATGTCCTCCTGCATCTGGTTGAT Reverse 2B 3963-3988
NK72 GAAGGGCCCAGGGTTGGACTC Reverse 2A/2B 3897-3917
A-1D523R CGTTTCATRCGCACRAGRA Reverse VP1 3748-3766
* RT-PCR, reverse transcription-PCR.
([dagger]) Position on the genome of [A.sub.21]/
Lumbwa/KEN/64 (GenBank accession no. AY593761).
|
|
||||||||||||||||||
Printer friendly
Cite/link
Email
Feedback
Reader Opinion