Printer Friendly
The Free Library
4,539,227 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Fluoroquinolone resistance linked to GyrA, GyrB, and ParC mutations in Salmonella enterica Typhimurium isolates in humans.


We report two cases of infection with clonally unrelated, high-level ciprofloxacin ciprofloxacin /cip·ro·flox·a·cin/ (sip?ro-flok´sah-sin) a synthetic antibacterial effective against many gram-positive and gram-negative bacteria; used as the hydrochloride salt.

cip·ro·flox·a·cin (s
-resistant, [beta]-lactamase-producing strains of Salmonella enterica Typhimurium. Resistance was caused by four topoisomerase mutations, in GyrA, GyrB, and ParC and increased drug efflux. Ciprofloxacin treatment failed in one case. In the second case, reduced susceptibility to third-generation cephalosporins cephalosporin /ceph·a·lo·spo·rin/ (sef?ah-lo-spor´in) any of a group of broad-spectrum, penicillinase-resistant antibiotics from Acremonium, related to the penicillins in both structure and mode of action. Those used medicinally are semisynthetic derivatives of the natural antibiotic cephalosporin C. occurred after initial treatment with these drugs and may explain the treatment failure with ceftriaxone ceftriaxone /cef·tri·ax·one/ (cef?tri-ak´son) a semisynthetic, ß–resistant, third-generation cephalosporin effective against a wide range of gram-positive and gram-negative bacteria, used as the sodium salt.

cef·tri·ax·one (s
.

**********

Ciprofloxacin, a member of the large and widely used fluoroquinolone group of antimicrobial drugs, is considered the empirical treatment of choice of gastrointestinal infections in adults. The fluoroquinolones have been licensed for use in humans as well as in food-producing animals. This use has raised a worldwide debate on the selection of fluoroquinolone-resistant bacteria in, and the possible circulation between, the different ecosystems concerned (1). While resistance to these drugs occurred quickly in Escherichia coli and several other enterobacteriaceae, high-level resistance to ciprofloxacin (HLRC) has been found exceptionally in salmonellae (2-5). The low prevalence of salmonellae with HLRC has been ascribed to counter selection in the environment (6), an observation corroborated by the difficulty in selecting HLRC mutants in vitro. This type of resistance generally involves multiple mutations in the genes encoding the quinolone target enzymes, gyrase and topoisomerase IV (2), and mutations in regulatory systems (marORAB [7]) or soxRS [8]) or drug efflux systems (AcrAB) (9). We report two cases of infection caused by multiple-resistant Salmonella enterica Typhimurium with HLRC in which initial therapy failed and present data on the fluoroquinolone resistance mechanism.

The Study

Case 1

A 74-year-old man with an aorto-femoral bypass and chronic prostatitis became febrile and was treated empirically with ciprofloxacin. After 2 weeks of persistent fever, he was hospitalized. Pyelonephritis was diagnosed and endocarditis suspected. Urinalysis and blood culture both led to the isolation of a strain of S. Typhimurium (STmA) resistant to ciprofloxacin, amoxicillin, tetracycline, chloramphenicol chloramphenicol /chlor·am·phen·i·col/ (klor?am-fen´i-kol) a broad-spectrum antibiotic effective against rickettsiae, gram-positive and gram-negative bacteria, and certain spirochetes; used also as the palmitate ester and as the sodium succinate derivative., and sulfonamide. Treatment with cefotaxime cefotaxime /cef·o·tax·ime/ (-tak´sem) a semisynthetic, broad-spectrum, ß–resistant, third-generation cephalosporin effective against a wide variety of gram-negative bacteria but less active against gram-positive cocci than are the first- and second-generation cephalosporins; used as the sodium salt. was started, the lever subsided, and the patient recovered and was discharged. He did not go for follow-up consultations.

Case 2

A 3-month-old boy (body weight 6 kg) arrived at the hospital with severe diarrhea and fever. A stool culture indicated a strain of S. Typhimurium (STmB1) resistant to ciprofloxacin, amoxicillin, tetracycline, trimethoprime, chloramphenicol, streptomycin, spectinomycin, and gentamicin. Treatment was initiated with ceftriaxone IV (250 mg/day) and maintained for 7 days. Signs and symptoms improved for a few days, but fever relapsed after 2 weeks. A second stool culture indicated S. Typhimurium strain STmB2, with the resistance phenotype of the original isolate. A second treatment with the same antimicrobial drug IV (300 mg/day) was given for 6 days, again with apparent initial success. However, fever and diarrhea reoccurred after 3 weeks (isolation of strain STmB3 from stool sample). All symptoms disappeared after oral treatment with cefpodoxime cefpodoxime /cef·po·dox·ime/ (sef?po-dok´sem) a ß–resistant third-generation cephalosporin effective against a wide range of gram-positive and gram-negative bacteria; used as c. proxetil. (96 mg/day/7 days). The search for carriers within the family was positive in one, with isolation of strain STmC in a l-year-old sibling who showed no clinical signs of infection.

All STm strains were analyzed for their lysotype, pulsed-field gel electrophoretic (PFGE) pattern, and resistance phenotype and genotype, as previously described (10). Strain STmA was phage nonsusceptible; all STmB and STmC strains were of lysotype 12. The last two had identical PFGE profiles after digestion of genomic DNA with XbaI, patterns that were clearly different from that of STmA (5 of 12 fragments were in common). Polymerase chain reaction (PCR) amplification indicated [beta]-lactamase genes in these strains of type TEM in STmA and of type TEM and OXA-1 in the STmB and STmC strains. MICs of the antimicrobial drugs shown in the Table were determined for the five clinical strains and the reference strain S. Typhimurium NCTC 12416 (phage type LT2), on Mueller-Hinton medium containing serially twofold diluted antimicrobial drugs. MICs of ethidium bromide and of ciprofloxacin, cefotaxime, and ceftriaxone in the presence of the efflux pump inhibitor Phe-Arg-[beta]-naphthylamide (Sigma-Aldrich Chimie, Saint Quentin Fallavier, France) (11) at concentrations of 50 mg/L were also determined. All clinical strains were similarly high-level resistant to fluoroquinolones. Isolate STmA, producing the TEM [beta]lactamase, was more susceptible to cefotaxime and ceftriaxone than the STmB and STmC isolates producing in addition OXA-1, and the post-treatment STm strains B2 and B3 were two- to fourfold less susceptible to the third-generation cephalosporins than STmB1 (Table). In the presence of Phe-Arg-[beta]-naphthylamide at 50 mg/L, a concentration at which no inhibition of growth was observed in the controls, MICs of ciprofloxacin were reduced four-fold and those of cefotaxime and ceftriaxone were reduced twofold. All STm isolates showed strongly reduced susceptibility to ethidium bromide (MIC [greater than or equal to] 1,000 mg/L as opposed to [less than or equal to] 100 mg/L for the reference strain).

To identify mutations responsible for HLRC, the quinolone resistance determining regions (QRDR) of DNA gyrase DNA gyrase (ji´ras) a type II DNA topoisomerase. and topoisomerase IV were determined alter nucleotide sequencing of the corresponding QRDR fragments which were PCR-amplified with the respective pairs of primers: 5'CTGAAGCCGGTACACCGTCG and 5'TCGGCCATCAGTTCGTGGGC for gyrA; 5'TTAT'CGATGCTGCGCGTGCC and 5'TCGCCGCTTTCAGGGCGTTC for gyrB; 5'CGCCTACTTAAACTACTCCA and 5'ATCAGCGTAATCGCCGCTTT for parC; and 5'GACC-GAGCTGTTCCTTGTGG and 5'GCGTAACTGCATCGGGTTCA for parE. The QRDRs of the topoisomerases of the five strains had identical mutations in GyrA (Ser83Phe and Asp87Asn) and in GyrB (Ser464Phe), while distinct mutations were observed in ParC (Glu84Lys in strain STmA and Ser80Arg in all STmB and STmC strains). The recently described quinolone resistance-conferring gene qnr was absent from all STm strains as tested by PCR with the corresponding specific primers (12). Also, nucleotide sequencing did not show any mutation in the PCR-amplified marORA locus.

Electrophoretic (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) analysis of outer membrane proteins indicated the loss of one of them, possibly a porin (data not shown), in the post-treatment isolates STmB2 and STmB3. These changes did not influence the levels of fluoroquinolone resistance but were associated with reduced susceptibility to cefoxitin cefoxitin /ce·fox·i·tin/ (se-fok´si-tin) a strongly ß–resistant cephamycin antibiotic, classified as a second-generation cephalosporin and especially effective against gram-negative organisms; used as the sodium salt. (not shown) and cefotaxime (fourfold) and to ceftriaxone (twofold) (Table).

Conclusions

The two cases reported here show that clonally unrelated HLRC strains of S. Typhimurium, which may cause severe infections, are present in the community. In both cases initial treatment failed, respectively, with a fluoroquinolone and a third-generation cephalosporin. In the first case, the failure may be attributable to the multiple topoisomerase mutations (possibly in conjunction with increased drug efflux), although treatment failures have been reported in cases of lower levels of resistance to ciprofloxacin (13). In the second case, the reason for the initial treatment failure with ceftriaxone is less obvious. Strain STmB1 had the potential to decrease its susceptibility to third-generation cephalosporins under treatment, possibly related to the loss of an outer membrane protein. The high-level resistance to ethidium bromide and the increased susceptibility of the strains to ciprofloxacin in the presence of Phe-Arg-[beta]-naphthylamide were strongly suggestive of an activated drug efflux system, such as AcrAB, the substrates of which also include cephalosporins with lipophilic side chains (2,14). The growth rates of the strains were the same as that of the reference strain, an observation which is at variance with that made with experimental fluoroquinolone-resistant mutants selected in animals (6) and which might imply the existence of additional compensatory mutants in the human STm isolates.

Low-level ciprofloxacin resistance in salmonellae has been observed occasionally in the environment in France (15) and elsewhere (16). Since we did not have a pretreatment isolate at our disposal, we are not certain whether any of the mutations resulting in the high-level fluoroquinolone resistance observed in strain STmA were selected under treatment. On the other hand, HLCR strain STmB may have been acquired as such from the environment or through the food chain, since neither the patient nor his sibling had ever been treated with fluoroquinolones, although no salmonellae with this phenotype have been observed to date from environmental or animal sources in France. In fact, to our knowledge, quadruple mutations affecting three topoisomerase subunits have never been reported before in salmonellae.

The unwelcome occurrence of fluoroquinolone-resistant salmonellae accumulating multiple mechanisms of resistance could compromise standard therapy of infections attributable to such pathogens. For children, an initial high-dose regimen with commonly used third-generation cephalosporins, or with oral cephalosporins, may therefore be indicated for the treatment of infections caused by S. Typhimurium strains such as STmB1.
Table. Antimicrobial drug susceptibilities of the Salmonella
enterica Typhimurium isolates

                       MIC (mg/L) (a)

Isolate        NOR    CIP (b)   CTM      CTX

NCTC 12416    0.06     0.016    0.06     0.125
A              32       16      0.06     0.06
B1             32       32      0.25     0.125
B2             32       32      1        0.25
B3             32       32      1        0.25
C              32       32      0.25     0.125

(a) NOR, norfloxacin; CIP, ciprofloxacin; CTM, cefotaxime;
CTX, ceftriaxone.

(b) MICs of moxifloxacin were identical to those of CIP.


Acknowledgments

We gratefully acknowledge F. Grimont and F.X. Weill for lysotype determinations.

This work was supported in part by a grant from the Ministere de la Recherche et de la Technologie (Programme de Recherche Fondamentale en Microbiologie et Maladies Infectieuses et Parasitaires).

Dr. Casin is a medical microbiologist at the Hopital Saint-Louis, a university teaching hospital in Paris, France. She works on various aspects of bacterial resistance to antimicrobial drugs in gram-negative bacteria, including molecular epidemiology and mechanisms.

References

(1.) Angulo FJ, Johnson KR, Tauxe RV, Cohen ML. Origins and consequences of antimicrobial-resistant non-typhoidal Salmonella: implications for the use of fluoroquinolones in food animals. Microb Drug Resist 2000;6:77-83.

(2.) Piddock LJV. Fluoroquinolone resistance in Salmonella serovars isolated from humans and food animals. FEMS Microb Rev 2002;26:3-16.

(3.) Heisig P, Ksatz B, Halle E, Graser Y, Altwegg M, Rabsch W, et al. Identification of DNA gyrase A mutations in ciprofloxacin-resistant isolates of Salmonella typhimurium from men and cattle in Germany. Microb Drag Resist 1995;1:211-8.

(4.) Herikstad H, Hayes P, Mokhtar M, Fracaro ML, Threlfall EJ, Angulo FJ. Emerging quinolone-resistant Salmonella in the United States. Emerg Infect Dis 1997;3:371-2.

(5.) Nakaya H, Yasuhara A, Yoshimura K, Oshihoi Y, Izumiya H, Watanabe H. Life-threatening infantile diarrhea from fluoroquinolone-resistant Salmonella enterica Typhimurium with mutations in both gyrA and parC. Emerg Infect Dis 2003;9:255-7.

(6.) Giraud E, Brisabois A, Martel JL, Chaslus-Dancla E. Comparative studies of mutations in animal isolates and experimental in vitro--and in vivo-selected mutants of Salmonella spp. suggest a counterselection of highly fluoroquinolone-resistant strains in the field. Antimicrob Agents Chemother 1999;43:2131-7.

(7.) Alekshun MN, Levy SB. Regulation of chromosomally mediated multiple antibiotic resistance: the mar regulon. Antimicrob Agents Chemother 1997;41:2067-75.

(8.) Koutsolioutsou A, Martins EA, White DG, Levy SB, Demple B. A soxRS-constitutive mutation contributing to antibiotic resistance in a clinical isolate of Salmonella enterica (serovar Typhimurium). Antimicrob Agents Chemother 2001;45:38-43.

(9.) Piddock LJV, White DG, Gensberg K, Pumbwe L, Griggs DJ. Evidence of an efflux pump mediating multiple antibiotic resistance in Solmonella enterica serovar Typhimurium. Antimicrob Agents Chemother 2000;44:3118-21.

(10.) Casin I, Breuil J, Brisabois A, Moury F, Grimont F, Collatz E. Multidrug-resistant human and animal Salmonella Typhimurium isolates in France belong predominantly to a DT104 clone with the chromosome--and integron-encoded b-lactamase PSE-1. J Infect Dis 1999;179:1173-82.

(11.) Renau TE, Leger R, Flamme EM, Sangalang J, She MW, Yen R, et al. Inhibitors of efflux pumps in Pseudomonas aeruginosa potentiate the activity of the fluoroquinolone antibacterial levofloxacin. J Med Chem 1999;42:4928-31.

(12.) Tran JH, Jacoby GA. Mechanism of plasmid-mediated quinolone resistance. Proc Natl Acad Sci U S A 2002;99:5638-42.

(13.) Aarestrup FM. Wiuff C, Molbak K, Threlfall EJ. Is it time to change fluoroquinolone breakpoints for Salmonella spp.? Antimicrob Agents Chemother 2003;47:827-9.

(14.) Nikaido H, Basina M, Nguyen V, Rosenberg EY. Multidrug pump AcrAB of Salmonella Typhimurium excretes only those b-lactam antibiotics containing lipophilic side chains. J Bacteriol 1998;180:4686-92.

(15.) Breuil J, Brisabois A, Casin I, Armand-Lefevre L, Fremy S, Collatz E. Antibiotic resistance in salmonellae isolated from humans and animals in France: comparative data from 1994 and 1997. J Antimicrob Chemother 2000;46:965-71.

(16.) Threlfall EJ, Ward LR, Rowe B. Resistance to ciprofloxacin in non-typhoidal salmonellas from humans in England and Wales. Clin Microbiol Infect 1999;5:130-4.

Address for correspondence: Ekkehard Ekkehard I wrote the famous Latin epic Waltharius (c.930), celebrating the deeds of the Alemannic prince Walter.

Ekkehard II, fl. 10th cent., was the tutor of Hedwig of Swabia. He is the hero of Scheffel's novel Ekkehard (1856). Best known is

Ekkehard IV, whose chronicle (c.1100) of St. Gall is an important, if historically inaccurate, account of medieval life. Another Ekkehard (fl. 1100) was an abbot of Aura who also wrote historical works.
 Collatz, University Paris VI, INSERM E0004-LRMA, 15, rue de l'Ecole de Medecine, Paris Cedex 06 75270, France; fax: 33 1 43 25 68 12; email: collatz@ccr.jussieu.fr

Isabelle Casin, * [dagger] Jacques Breuil, [dagger] [double dagger] Jean Pierre Darchis, [section] Claire Guelpa, [paragraph] and Ekkehard Collatz [dagger]

Hopital Saint-Louis, Universite Paris VII, Paris, France; INSERM E0004-LRMA, Universite Paris VI. Paris, France; [double dagger] Centre Hospitalier Villeneuve-Saint Georges, Villeneuve-Saint Georges, France; [section] Centre Hospitalier de Compiegne, Compiegne, France; [paragraph] Hopital du Val d'Yerres, Yerres, France
COPYRIGHT 2003 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2003, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Dispatches
Author:Collatz, Ekkehard
Publication:Emerging Infectious Diseases
Date:Nov 1, 2003
Words:2105
Previous Article:Severe acute respiratory syndrome-associated coronavirus infection.(Dispatches)
Next Article:Cowpox with severe generalized eruption, Finland.(Dispatches)
Topics:



Related Articles
Quinolone and Macrolide Resistance in Campylobacter jejuni and C. coli: Resistance Mechanisms and Trends in Human Isolates.
Increasing quinolone resistance in Salmonella enterica serotype Enteritidis. (Dispatches).
Fluoroquinolone and macrolide treatment failure in pneumococcal pneumonia and selection of multidrug-resistant isolates.(Dispatches)
Fluoroquinolone susceptibility of Campylobacter strains, Senegal.(Dispatches)
Fluoroquinolone resistance in Campylobacter absent from isolates, Australia.(Dispatches)
Relative fitness of fluoroquinolone-resistant Streptococcus pneumoniae.(RESEARCH)
Pseudomonas aeruginosa, staphylococcus aureus, and fluoroquinolone use.(RESEARCH)
Multidrug-resistant Salmonella Typhimurium in four animal facilities.(RESEARCH)
Fluoroquinolone-resistant Salmonella sp. in Carcasses.(public health safety)
Fluoroquinolone resistant Streptococcus pneumoniae.(LETTERS)

Terms of use | Copyright © 2008 Farlex, Inc. | Feedback | For webmasters | Submit articles