Printer Friendly
The Free Library
14,487,175 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

First isolation of West Nile virus from a patient with encephalitis in the United States. (Research).


West Nile virus West Nile virus, microorganism and the infection resulting from it, which typically produces no symptoms or a flulike condition. The virus is a flavivirus and is related to a number of viruses that cause encephalitis.  (WNV) was isolated from a patient who developed encephalitis while undergoing treatment with CHOP (cyclophosphamide cyclophosphamide /cy·clo·phos·pha·mide/ (-fos´fah-mid) a cytotoxic alkylating agent of the nitrogen mustard group; used as an antineoplastic, as an immunosuppressant to prevent transplant rejection, and to treat some diseases , hydroxydoxorubicin, vincristine vincristine /vin·cris·tine/ (vin-kris´ten) an antineoplastic vinca alkaloid; used as the sulfate salt in the treatment of various neoplasms, including Hodgkin's disease, acute lymphocytic leukemia, non-Hodgkin's lymphoma, Kaposi's  [Oncovin], predisone) and rituximab for a non-Hodgkin B-cell lymphoma. Both standard reverse transcription-polymerase chain reaction (RT-PCR RT-PCR

reverse transcriptase-polymerase chain reaction. See PCR1.
) and Taqman RT-PCR established the diagnosis of WNV infection from cerebrospinal fluid (CSF Cerebrospinal Fluid (CSF) Analysis Definition

Cerebrospinal fluid (CSF) analysis is a laboratory test to examine a sample of the fluid surrounding the brain and spinal cord.
). Several whole blood samples and one serum sample underwent further testing. CSF and serum samples were negative for WNV antibody; however, all samples were positive by both RT-PCR assays. Infectious virus was recovered from a blood sample, and its identity was confirmed by using a WNV-specific immunofluorescence assay. The complete WNV genomes determined from CSF and from the virus isolate adapted from cell culture were the same. The results represent the first complete WNV genome sequence obtained directly from human CSF and the first time that infectious WNV has been recovered from a patient with encephalitis in North America.

**********

West Nile virus (WNV), an arthropod-borne virus, is a ember of the Japanese encephalitis virus serocomplex of the genus Flavivirus, family Flaviviridae (1), discovered in Uganda in 1937 (2). Although WNV infections are usually mild or asymptomatic, in some instances, a severe and fatal encephalitis is produced, typically in the elderly (3). This virus was first recognized in the Western Hemisphere in an outbreak in New York in 1999 (4). As of October 2, 2002, a total of 2.671 cases of human illness in the United States have been reported to the Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center.  (CDC See Control Data, century date change and Back Orifice.

CDC - Control Data Corporation
). Although WNV has been recovered from mosquitoes, birds, and horses, no isolations from humans have been reported in the Western Hemisphere. Thus, all prior data regarding the virus responsible for human illness in North America have come from nucleic acid sequencing of the viral genome in either cerebrospinal fluid (CSF) or brain tissue. We describe the first isolation of WNV from a human case-patient associated with the U.S. outbreak. Because the virus was also directly detected by reverse transcription-polymerase chain reaction (RT-PCR) in specimens from the same patient, we were able to compare the entire genomic sequence of the directly detected virus with that of the cell-culture isolate.

Case Report

The patient was a 70-year-old woman, who has been diagnosed with intermediate-grade, CD 20-positive, B-cell non-Hodgkin lymphoma, involving a left intraparotid lymph node. Staging workup demonstrated stage 1-A disease. Treatment plans for the patient included three courses of CHOP (cyclophosphamide, hydroxydoxorubicin, vincristine [Oncovin], and predisone) chemotherapy plus rituximab (chimeric CD 20 monoclonal antibody), to be followed by involved field radiation. After the first cycle of chemotherapy in July 2001, neutropenia developed and the patient was treated with granulocyte granulocyte /gran·u·lo·cyte/ (gran´u-lo-sit?) granular leukocyte.granulocyt´ic

band-form granulocyte  band cell.


gran·u·lo·cyte
n.
 colony stimulating factor colony stimulating factor
n.
A hormone produced in the cells lining the blood vessels that stimulates the bone marrow to synthesize white blood cells.
 (GCSF) following both the second and third cycles of chemotherapy. The third cycle of chemotherapy was administered on September 11, 2001. Four days later, she was treated with oral levofloxacin for low-grade fever. On day 7 after chemotherapy, she was admitted to the hospital with fever, cough, chills, rhinorrhea, joint aches, decreased appetite, lethargy, and lightheadedness. She had no recollection of any ill contacts or insect bites. She was a resident of southern Nassau County, New York
There is also a Town of Nassau in Rensselaer County.


Nassau County is a suburban county in the New York Metropolitan Area east of New York City in the U.S. state of New York. As of the 2000 census, the population was 1,334,544.
, and did not have a history of travel. Physical examination was within normal limits. The patient was neutropenic; G-CSF G-CSF granulocyte colony-stimulating factor.

G-CSF

granulocyte-colony stimulating factor.

G-CSF Granulocyte colony-stimulating factor Molecular therapeutics A biological response modifier, the recombinant DNA form of
 was continued, and she was given cefipime and gentamicin gentamicin /gen·ta·mi·cin/ (jen?tah-mi´sin) an aminoglycoside antibiotic complex isolated from bacteria of the genus Micromonospora, . One day after admission, she continued to have fever and experienced mild headaches that responded to acetaminophen. Urine cultures showed penicillin-sensitive enterococci, and blood cultures were negative. Two days after admission, the patient continued to have fever, headaches, and dizziness. A computed tomography (CT) scan of the brain revealed no acute cerebral processes. On the 3rd day after admission, the patient was noted to be confused. Further deterioration of mental status was noted, with incomprehensible speech, but she was able to follow commands. Arterial blood-gas analysis showed an acute respiratory acidosis pattern, and the patient was subsequently intubated and transferred to the intensive care unit. The patient had a hypotensive hypotensive /hy·po·ten·sive/ (-ten´siv) marked by low blood pressure or serving to reduce blood pressure.

hy·po·ten·sive
adj.
1. Of or characterized by low blood pressure.

2.
 episode secondary to atrial flutter, which required cardioversion for stabilization. Ceftriaxone and ampicillin were added to the antibiotic coverage, and antifungal treatment was also initiated with lipid complex amphotericin B. After the patient's hematologic hematological, hematologic

pertaining to or emanating from blood cells.


hematological tests
total and differential white cell counts, hematocrit estimation, erythrocyte count.
 parameters improved, G-CSF was discontinued on day 9 of hospitalization, and the patient continued to be afebrile afebrile /afe·brile/ (a-feb´ril) without fever.

a·feb·rile
adj.
Apyretic.



afebrile

without fever.

afebrile adjective Feverless
. Because of the clinical picture of encephalitis and because the patient lived in an area where WNV was endemic, lumbar puncture was performed on day 8, and a CSF specimen was sent to the New York State Department of Health laboratories for comprehensive PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 testing. Renal tubular necrosis renal tubular necrosis See Acute tubular necrosis.  developed in the patient, leading to acute renal failure acute renal failure Acute kidney failure Nephrology An abrupt decline in renal function, triggered by various processes–eg, sepsis, shock, trauma, kidney stones, drug toxicity-aspirin, lithium, substances of abuse, toxins, iodinated radiocontrast.  by day 10, with further deterioration of her mental status. Dialysis was initiated on day 16, and antibiotic therapy was discontinued on day 17 as the patient remained afebrile and the neutropenia resolved. The patient remained unresponsive, staphylococcal septicemia septicemia (sĕptĭsē`mēə), invasion of the bloodstream by virulent bacteria that multiply and discharge their toxic products. The disorder, which is serious and sometimes fatal, is commonly known as blood poisoning.  developed, and she died on day 35 of hospitalization. Autopsy showed a small focus of perivascular perivascular /peri·vas·cu·lar/ (-vas´ku-lar) near or around a vessel.

perivascular

around a vessel.


perivascular cellulitis
 lymphocyte cuffing in the mamillary bodies of the brain, consistent with viral encephalitis. No evidence of residual lymphoma was found.

Materials and Methods

The PCR Laboratory associated with the Virology Diagnostic Services, Wadsworth Center, New York State Department of Health, has developed a panel of PCR and RT-PCR assays that allow tests on CSF and brain tissue for a wide range of viruses associated with human central nervous system (CNS See Continuous net settlement.

CNS

See continuous net settlement (CNS).
) infections. Specifically, the test battery includes herpes simplex viruses (types 1 and 2), varicella-zoster virus, cytomegalovirus, Epstein-Barr virus (Human herpesvirus herpesvirus, any of the family (Herpesviridae) of common DNA-containing viruses, many of which are associated with human disease. See cytomegalovirus; Epstein-Barr virus; herpes simplex; herpes zoster.  4), enteroviruses Enteroviruses
Viruses which live in the gastrointestinal tract. Coxsackie viruses, viruses that cause hand-foot-mouth disease, are an enterovirus.

Mentioned in: Hand-Foot-and-Mouth Disease
, and the following arboviruses arboviruses (ar´bōvī´rsz),
n.
: Eastern equine encephalitis Eastern equine encephalitis A rare, sporadic, and aggressive enzootic infection by a single-stranded RNA Togavirus that primarily affects birds Vector Ornithophilic mosquito, Culiseta melanura , California serogroup (LaCrosse virus [LACV], Jamestown Canyon, and others), Powassan virus (POWV), St. Louis encephalitis St. Louis encephalitis

see St. Louis encephalitis.
 virus (SLEV), WNV, and Cache Valley virus Cache Valley virus

one of the California serotype bunyaviruses associated with equine viral encephalomyelitis.

Cache Valley virus Virology A common Bunyamwera virus, isolated in Utah in 1956 and recovered primarily from mosquitos–genera
.

RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 and DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 were simultaneously extracted from 0.25 mL of CSF sample with Trizol LS reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. Briefly, RNA was first transcribed into cDNA with random primers (Roche Diagnostics Corp., Indianapolis, IN), and an aliquot of this eDNA (5 [micro]L) was used in PCR reactions with primers for detecting viruses in the test panel. Aliquots of DNA were also examined for the presence of the herpesviruses Herpesviruses
A family of viruses responsible for cold sores, chicken pox, and genital herpes.

Mentioned in: Skin Resurfacing
 in the panel. Amplification products were analyzed on a 2% agarose (EM Science, Gibbstown, NJ) gel containing ethidium bromide. Routinely, for any virus for which a band corresponding to a positive result is observed, the band is run into low melting agarose, and sequenced directly on the gel slice without further purification. DyeTerminator sequencing was performed on an Applied Biosystems Model 373A automated sequencer (Foster City, CA). For the TaqMan assay, one-step RT-PCR Ready-Mix Kit (Applied Biosystems) was used. The primers and probe for the quantification of the RNA copy number of WNV used in this study are listed in Table 1.

Virus was isolated by using monolayers of Vero cells grown in tubes. Aliquots of 0.01 and 0.05 mL of whole blood were pretreated with antibiotics (penicillin and streptomycin) for 30 min at room temperature (22[degrees]C); 1 mL of Eagle's minimal essential medium Eagle's minimal essential medium (EMEM) is a cell culture medium by Harry Eagle that can be used to maintain cells in tissue culture.

It contains:
  • amino acids
  • salts (potassium chloride, magnesium sulfate, sodium chloride, and sodium dihydrogen phosphate)
 containing 2% fetal bovine serum Fetal bovine serum ( or foetal bovine serum) is serum taken from the fetuses of cows. Fetal Bovine Serum (or FBS) is the most widely used serum in the culturing of cells. In some papers the expression foetal calf serum is used.  was added to the treated blood samples, and the mixtures were used to inoculate the Vero cell monolayers.

After incubation for 24 hr at 37[degrees]C, the monolayers were rinsed with phosphate-buffered saline, 2 mL of fresh medium was added, and the culture was subsequently monitored daily for cytopathic effects (CPE (Customer Premises Equipment) Communications equipment that resides on the customer's premises.

CPE - Customer Premises Equipment
). Cell monolayers that showed CPE were harvested. To confirm that the infectious agent was WNV, an aliquot of the supematant serially diluted ([10.sup.-4]-[10.sup.-6]) was used to infect fresh Vero cell monolayers. Virus-infected monolayers from the second passage were examined for WNV antigen by immunofluorescence assay (IFA Immunofluorescent assay (IFA)
A blood test sometimes used to confirm ELISA results instead of using the Western blotting. In an IFA test, HIV antigen is mixed with a fluorescent compound and then with a sample of the patient's blood.
) by using monoclonal antibody H5-46 (provided by CDC, Fort Collins, CO). This monoclonal immunoglobulin (Ig) M antibody is specific for a glycoprotein epitope on WNV.

Results

Diagnosis of WNV Infection

CSF was simultaneously examined for a panel of 11 viruses by RT-PCR/PCR as described in Material and Methods. No amplification product was observed for any other virus in the PCR battery except WNV. Two primer pairs (CU9093/CL9279 and D87F/D156R) in the N[S.sub.5] region (5,6) of the WNV genome were used in the initial screening by standard RT-PCR (Table 1). PCR products of appropriate size for both primer pairs were obtained (Figure 1). RT-PCR was independently repeated on another aliquot of CSF by using four primer pairs located in various genomic regions of WNV. PCR bands with the expected sizes were present in all four reactions (data not shown). The identity of the PCR bands was confirmed by sequence data obtained directly from the PCR amplicon. The diagnosis of WNV infection was based on the detection and sequence of the WNV genome in CSF. Although the serologic test (IgM capture enzyme-linked immunosorbent assay enzyme-linked immunosorbent assay
n.
ELISA.


Enzyme-linked immunosorbent assay (ELISA)
A diagnostic blood test used to screen patients for AIDS or other viruses.
 [ELISA ELISA (e-li´sah) Enzyme-Linked Immuno-Sorbent Assay; any enzyme immunoassay using an enzyme-labeled immunoreactant and an immunosorbent.

ELISA
n.
]) on the CSF sample was negative for WNV, according to the interpretations set forth by CDC, the detection of viral genome sequence in CSF meets the definition of a confirmed case.

[FIGURE 1 OMITTED]

TaqMan Assays

To follow up this case, three whole-blood samples and one serum sample were examined by both standard RT-PCR (primers in N[S.sub.5] region) and TaqMan (primers in ENV region) assays; the results are summarized in Table 2. The highest RNA copy number, 2.5 x [10.sup.6] copies/mL, was found in the blood sample that was collected 3 days after the patient's neurologic symptoms appeared. WNV genome was also detected in a serum sample collected on day 19 after onset of symptoms. Serologic tests (IgM capture ELISA and IgG ELISA) on serum for Eastern equine encephalitis virus Eastern equine encephalomyelitis virus (EEE), commonly called sleeping sickness or "Triple E", is a zoonotic alphavirus and arbovirus present in North, Central and South America and the Caribbean. , LACV, POWV, SLEV, and WNV were all negative.

Other Clinical Data

Laboratory studies of the CSF indicated the following values: leukocyte (WBC WBC white blood cell; see leukocyte.

WBC
abbr.
white blood cell


WBC,
n stands for white
blood
cell.
) count 8 [mm.sup.3] with 66% neutrophils, 4% lymphocytes, 4% atypical lymphocytes, and 26% monocytes monocytes,
n.pl the largest of the white blood cells. They have one nucleus and a large amount of grayish-blue cytoplasm. Develop into macrophages and both consume foreign material and alert T cells to its presence.
; erythrocyte count 0; glucose level 76 mg/dL; total protein level 55 mg/dL, and lactate dehydrogenase level 35 IU/L. Figure 2 presents fever curve, WBC curve, and viremia data. The serum immunoglobulins at the time of infection with WNV were IgG 492 mg/dL (normal level [nl]) 700-1,500 mg/dL), IgA 86 mg/dL (nl 65-450 mg/dL), and IgM 80 mg/dL (nl 45-230 mg/dL).

[FIGURE 2 OMITTED]

Virus Isolation

The attempt to isolate WNV was carried out in a biosafety level 3 laboratory not routinely used for arbovirus arbovirus

Any of a large group of viruses that develop in arthropods (chiefly mosquitoes and ticks). The name derives from “arthropod-borne virus.” The spheroidal virus particle is encased in a fatty membrane and contains RNA; it causes no apparent harm to the
 work and located in a building separate from the facility where PCR testing was conducted. This procedure had the dual advantage of minimizing the possibility that any virus recovered originated from a source other than the human specimen and also ensuring that any isolate obtained would not lead to future spurious PCR results. A blood sample collected on September 24, 2001, and a CSF specimen collected on September 26, 2001, were chosen for recovery of the virus because of the presence of high-copy-number viral RNA. On day 6 postinfection, CPE was observed in the tubes inoculated with 0.01 mL and 0.05 mL of blood, but not in the tube inoculated with 0.1 mL of CSF. WNV was confirmed in the second-passage cell cultures by IFA by using WNV-specific monoclonal antibody H5-46.

Sequence Analysis

Since only a very small amount of CSF remained after the diagnostic work-up, we carefully designed a protocol to generate PCR bands with sizes ranging from 500 to 1000 bp. This protocol allowed the complete genome sequence of the virus in the CSF to be determined by sequencing overlapping PCR bands (GenBank accession no. AF533540). We used a similar protocol to obtain the genome sequence of the isolate adapted from cell culture and found that the sequence data from the virus in the CSF and from the WNV isolate were identical. A 1648-bp fragment encoding the PreM, M, and part of the 5'-E gene was used for phylogenetic studies (Figure 3). The analysis showed that the sequence data from this case are similar to the sequence data obtained from human (7) (GenBank accession no. AF202541), horse (8) GenBank accession no. AF260967), and bird (9) (GenBank accession no. AF196835) WNV isolates in New York in 1999.

[FIGURE 3 OMITTED]

Discussion

This case is important for several reasons. It represents the first instance in which WNV was recovered from a person in the United States. It is also the first time that the entire genomic sequence of WNV has been obtained from CSF from a human case-patient. The sequence data from the virus directly detected in the CSF and from the WNV isolate from cell cultures are identical. Hindiyeh et al. (10) reported the isolation of WNV from the blood of viremic patients who were not immunocompromised and who seroconverted later. In contrast, the patient in this case was elderly and was undergoing treatment for lymphoma. She was unable to mount an immune response as shown by the fact that the results of serologic tests on both CSF and serum specimens were negative.

To our knowledge, all previous attempts to recover WNV from human patients associated with the North American outbreak have been unsuccessful. The ability to recover an infectious isolate in this report may have been contingent on the fact that the patient was immunologically impaired. She had lymphoma and had been undergoing treatment with CHOP plus rituximab for 2 months at the time the WNV infection developed. The relative role of immunosuppression caused by the lymphoma itself compared with the immunosuppression due to treatment of the lymphoma is unclear. At the time of the WNV infection, the patient's serum IgG levels were moderately suppressed. This was most likely the result of lymphoma, because a reduction in immunoglobulins, secondary to impaired B-cell function from rituximab, usually occurs after 3 months of therapy (11). In a previous randomized ran·dom·ize  
tr.v. ran·dom·ized, ran·dom·iz·ing, ran·dom·iz·es
To make random in arrangement, especially in order to control the variables in an experiment.
 study, elderly patients receiving CHOP chemotherapy and rituximab had increased their overall survival and had not experienced an increase in toxic clinical effects compared with effects from CHOP treatment alone (12). However, rituximab used as a single agent has been reported to lead to excessive bacterial and viral infections, including respiratory tract infections and herpes (13). Rituximab is also implicated as a risk factor for unusual viral infections when used as an immunotherapy agent in the peritransplant period of autologous stem cell transplant in non-Hodgkin lymphoma patients (14). Another consideration is the fact that the patient was neutropenic. The relationship between neutrophil function and the severity of WNV infection is unknown. The virus may be cleared by neutrophils, and the severity of the viral infection may have been due to the fact that the patient was neutropenic at the time of the acute infection. What lends credence to this hypothesis is the observation that the highest viral titer as determined by PCR coincided with the recovery of the WBC count. Following the resolution of the myelosuppression, the RNA copy number of the WNV in blood samples declined rapidly (from 1.1 x [10.sup.6] to 5.4 x [10.sup.4] copies/mL).

In summary, this report is the first of WN encephalopathy in an immunocompromised patient undergoing treatment for lymphoma. The patient's serologic tests remained negative, and the diagnosis was made by RT-PCR from both CSF and peripheral blood, and by in vitro cultivation of the virus from blood. WNV infection should therefore be considered in the differential diagnosis of patients with lymphoma who exhibit encephalopathy, even if serologic tests are negative for WNV. Extra care should be taken to prevent patients with lymphoma, especially those undergoing treatment, from being exposed to WNV.
Table 1. Oligonucleotide primers and probe used in the standard RT-PCR
and TaqMan assays (a)
                              Genome
Primer     Genome target    position (b)        Sequence (5'-3')

CU9093      N[S.sub.5]       9097-9120      AGYMGRGCHATHTGGTWYATGTGG
CL9279      N[S.sub.5]       9302-9283        TTCCAVCCDGCKGTRTCATC
D87F        N[S.sub.5]      10034-10051        GCTCCGCTGTCCCTGTGA
D156R       N[S.sub.5]      10103-10083      CACTCTCCTCCTGCATGGATG
Forward         ENV          1160-1180       TCAGCGATCTCTCCACCAAAG
Reverse         ENV          1229-1209       GGGTCAGCACGTTTGTCATTG
Probe           ENV          1186-1207       TGCCCGACCATGGGAGAAGCTC

Primer     RT-PCR product size (bp)

CU9093               206
CL9279
D87F                  70
D156R
Forward               70
Reverse
Probe

(a) RT-PCR, reverse transcription-polymerase chain reaction.

(b) Genome position according to GenBank accession no. AF196835.

Table 2. Detection of West Nile virus in human specimens by TaqMan and
standard RT-PCR assays (a)

Specimen    Collection date     RNA (copy/mL)      [C.sub.T]    Rn

Blood          9/21/2001       2.2 x [10.sup.3]      31.6      0.48
Blood          9/24/2001       2.5 x [10.sup.6]      20.4      3.71
CSF            9/26/2001       1.1 x [10.sup.6]      20.4      3.71
Blood         10/02/2001       5.4 x [10.sup.4]      25.8      2.70
Serum         10/10/2001       3.7 x [10.sup.3]      28.5      0.70

Specimen    STD RT-PCR    Serology    Cell cultures

Blood        Positive       n.d.          n.d.
Blood        Positive       n.d.        Positive
CSF          Positive     Negative      Negative
Blood        Positive       n.d.          n.d.
Serum        Positive     Negative        n.d.

(a) CT, threshold cycle number, the cycle number at which fluorescence
increases above a fixed threshold value; Rn, normalized fluorescent
signal, the fluorescent signal generated by the reporter dye; STD,
standard; RT-PCR, reverse transcription-polymerase chain reaction;
n.d.: not done, CSF, cerebrospinal fluid.


Acknowledgments

The authors thank Blair Rosen for performing the Taqman RTPCR, Rocco Ferrera for his technical support, the Diagnostic Immunology Laboratory at the Wadsworth Center for conducting serologic testing, R. Lanciotti for performing all arbovirus serologic tests, and the Molecular Genetics Core at the Wadsworth Center for providing the oligonucleotides and for automated sequencing.

This work was supported in part by the Epidemiology and Laboratory Capacity for Infectious Diseases cooperative agreement (U50/ CCU CCU
abbr.
1. coronary care unit

2. critical care unit



CCU

critical care unit.

CCU Critical care unit, see there
212415-04) and the Emerging Infections Program cooperative agreement (U50/CCU213698-03) with the Centers for Disease Control and Prevention. Its contents are solely the responsibility of the authors and do not necessarily represent the official views of CDC.

References

(1.) Calisher CH, Karabatsos N, Dalrymple JM, Shope RE, Porterfield JS, Westaway EG, et al. Antigenic relationships between flaviviruses as determined by cross-neutralization tests with polyclonal antisera. J Gen Virol 1989;70:37-43.

(2.) Smithburn KC, Hughes TP, Burke AW, Paul JH. A neurotropic neurotropic

pertaining to or emanating from neurotrophy, e.g. neurotropic osteopathy.
 virus isolated from the blood of a native of Uganda. Am J Trop Med Hyg 1940;20:471-92.

(3.) Hayes CG. West Nile fever West Nile fever West Nile meningoencephalitis Infectious disease An acute, mosquito-borne flaviviral infection endemic–rarely, epidemic–in the Near East, Africa, former Soviet Union, India Clinical After a 3-6 day incubation, children present with a . In: T.P. Monath, editor. The arboviruses: epidemiology and ecology. Vol. 7. Boca Raton (FL): CRC (Cyclical Redundancy Checking) An error checking technique used to ensure the accuracy of transmitting digital data. The transmitted messages are divided into predetermined lengths which, used as dividends, are divided by a fixed divisor.  Press Inc.;1989. p.59-88.

(4.) Centers for Disease Control and Prevention. 1999 Outbreak of West Nile-like viral encephalitis--New York. MMWR MMWR Morbidity & Mortality Weekly Report Epidemiology A news bulletin published by the CDC, which provides epidemiologic data–eg, statistics on the incidence of AIDS, rabies, rubella, STDs and other communicable diseases, causes of mortality–eg,  Morb Mortal Wkly Rep 1999;48:845-9.

(5.) Briese T, Jia XY, Huang C, Grady LJ, Lipkin WI. Identification of a Kunjin/West Nile-like flavivirus in brains of patients with New York encephalitis. Lancet 1999;354:1261-2.

(6.) Briese T, Glass WG, Lipkin WI. Detection of West Nile sequences in cerebrospinal fluid. Lancet 2000;355:1614-5.

(7.) Jia, XY, Briese T, Jordan I, Rambaut A, Chi HC, Mackenzie JS, et al. Genetic analysis of West Nile New York 1999 encephalitis virus. Lancet 1999;354:1971-2.

(8.) Lanciotti RS, Ebel GD, Deubel V, Kerst AJ, Murri S, Meyer R, et al. Complete genome sequences and phylogenetic analysis of West Nile virus strains isolated from the United States, Europe, and the Middle East. Virology 2002;298:96-105.

(9.) Lanciotti RS, Roehrig JT, Deubel V, Smith J, Parker M, Steele K, et al. Origin of the West Nile virus responsible for an outbreak of encephalitis in the northeastern U. S. Science 1999;1286: 2333-7.

(10.) Hindiyeh M, Shulman LM, Mendelson E, Weiss L, Grossman Z, Bin H. Isolation and characterization of West Nile virus from the blood of viremic patients during the 2000 outbreak in Israel. Emerg Infect Dis 2001;7:748-50.

(11.) Mclaughlin P, Grillo-Lopez AJ, Link BK, Levy R, Czuczman MS, Williams ME, et al. Rituximab chimeric anti-CH20 monoclonal antibody therapy Monoclonal antibody therapy is the use of monoclonal antibodies (or Mab) to specifically target cells. The main objective is stimulating the patient's immune system to attack the malignant tumor cells and the prevention of tumor growth by blocking specific cell receptors.  for relapsed indolent lymphoma: half of patients respond to a four-dose treatment program. J Clin Oncol 1998;16:2825-33.

(12.) Coiffier B, Lepage E, Briere J, Herbrecht R, Tilly H, Bouabdallah R, et al. CHOP chemotherapy plus rituximab compared with CHOP alone in elderly patients with diffuse large-B-cell lymphoma. N Engl J Med 2002;346:235-42.

(13.) Foran JM, Rahatiner AZS, Cunningham D, Popescu RA, Solal-Celigny P, Ghielmini M, et al. European phase-II study of rituximab (chimeric CD20 monoclonal antibody) for patients with newly diagnosed mantle-cell lymphoma and previously treated mantle-cell lymphoma, immunocytoma, and small B-cell lymphocytic lymphoma. J Clin Oncol 2000;18:317-24.

(14.) Goldberg SL, Pecora AL, Alter RS, Kroll MS, Rowley SD, Waintraub SE, et al. Unusual viral infections (progressive multifocal leukoencephalopathy Progressive Multifocal Leukoencephalopathy Definition

Progressive multifocal leukoencephalopathy (PML) is a rapidly progressive neuromuscular disease caused by opportunistic infection of brain cells (oligodendrocytes and astrocytes) by the JC virus
 and cytomegalovirus disease) after high dose chemotherapy with autologous stem cell rescue and peritransplantation rituximab. Blood 2002;99:1486-8.

Cinnia Huang, * Brett Slater, * Robert Rudd, * Nandakishore Parchuri, ([dagger]) Rene Hull, * Michelle Dupuis, * and Alexander Hindenburg ([dagger])

* Wadsworth Center, New York State Department of Health, Albany, New York For other uses, see Albany.
Albany is the capital of the State of New York and the county seat of Albany County. Albany lies 136 miles (219 km) north of New York City, and slightly to the south of the juncture of the Mohawk and Hudson Rivers.
, USA; and ([dagger]) Winthrop University Hospital, Mineola, New York Mineola is a village in Nassau County, New York, USA. The population was 19,233 at the 2000 census. The name is derived from a Native American word meaning a "pleasant place."

It is the county seat of Nassau CountyGR6.
, USA

Dr. Huang is director of the Encephalitis PCR Laboratory, Wadsworth Center, New York State Department of Health. Her scientific interests include molecular characterization of several arboviruses of public health importance.

Address for correspondence: Cinnia Huang, Wadsworth Center, New York State Department of Health, Box 509, Albany, NY 12201-0509, USA; fax: 518- 869-6487; e-mail: Cinnia.huang@wadsworth.org
COPYRIGHT 2002 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2002, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Hindenburg, Alexander
Publication:Emerging Infectious Diseases
Geographic Code:1USA
Date:Dec 1, 2002
Words:3525
Previous Article:About the cover. (News & Notes).(Amedeo Modigliani)(Brief Article)
Next Article:West Nile virus epidemic in horses, Tuscany region, Italy. (Research).
Topics:



Related Articles
Equine West Nile Encephalitis, United States.(Statistical Data Included)
The Relationships between West Nile and Kunjin Viruses.(Statistical Data Included)
West Nile Virus Outbreak Among Horses in New York State, 1999 and 2000.(Statistical Data Included)
Fatal Encephalitis and Myocarditis in Young Domestic Geese (Anser anser domesticus) Caused by West Nile Virus.(Statistical Data Included)
Immunization with heterologous flaviviruses protective against fatal West Nile encephalitis. (Research).(Statistical Data Included)
Phylogenetic relationships of southern African West Nile virus isolates. (Research).(Statistical Data Included)
Efficacy of killed virus vaccine, live attenuated chimeric virus vaccine, and passive immunization for prevention of West Nile virus encephalitis in...
Persistence of virus-reactive serum immunoglobulin M antibody in confirmed West Nile virus encephalitis cases. (Dispatches).
After West Nile virus: what will it do to the birds and beasts of North America?
West Nile virus infection presenting as cerebellar ataxia and fever: case report. (Case Report).

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles