Printer Friendly
The Free Library
14,505,585 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Fatal disseminated Acanthamoeba lenticulata infection in a heart transplant patient.


We report a fatal case of disseminated acanthamebiasis caused by Acanthamoeba Acanthamoeba /Acan·tha·moe·ba/ (ah-kan?thah-me´bah) a genus of free-living ameboid protozoa (order Amoebida) found usually in fresh water or moist soil. Certain species, such as A. astronyxis, A. castellanii, A. culbertsoni, A.  lenticulata (genotype T5) in a 39-year-old heart transplant recipient. The diagnosis was based on skin histopathologic results and confirmed by isolation of the ameba from involved skin and molecular analysis of a partial 18S rRNA (DF3).

**********

Acanthamoeba is 1 of 3 genera of free-living amebae that commonly cause disease in humans (1). These protozoa have been implicated in local infections, such as amebic amebic /ame·bic/ (ah-me´bik) pertaining to or of the nature of an ameba.

a·me·bic or a·moe·bic
adj.
Relating to, resembling, or caused by amebas.
 keratitis keratitis

Inflammation of the cornea (see eye). The conjunctiva may also be inflamed (keratoconjunctivitis). Depending on the cause, including dryness of the eye (from low tear production or inability to close the eye), chemical or physical injury, or certain
, mainly in immunocompetent im·mu·no·com·pe·tent
adj.
Having the normal bodily capacity to develop an immune response following exposure to an antigen.



im
 contact lens wearers, and in the mostly fatal, granulomatous granulomatous /gran·u·lom·a·tous/ (-lom´ah-tus) containing granulomas.
Granulomatous
Resembling a tumor made of granular material.
 amebic encephalitis in immunocompromised patients with HIV/ AIDS and immunosuppressant-treated patients, including organ transplant recipients (2-4). Disseminated acanthamebiasis (DA), which is defined as widespread extracerebral disease, is extremely rare, but its incidence has increased in recent years (5). Among DA reported, only 5 occurred in solid organ (3 lung and 2 kidney) transplant recipients (4). We report a fatal case of DA in a heart transplant recipient and identify Acanthamoeba lenticulata (genotype T5) as the cause of life-threatening disease.

The Case

A 39-year-old man from Martinique had received a second heart transplant in March 2004 because of chronic rejection. He had received his first transplant 14 years earlier because of alcohol-related dilated cardiomyopathy. Skin complications included epidermoid carcinoma on the fight leg in 1995 and diffuse viral warts on the trunk in 2003. Maintenance immunosuppression after the second heart transplant in 2004 included cyclosporine (220 mg/ day), prednisone (20 mg/day), and mycophenolate mofetil (500 mg/day). The latter drug was withdrawn because of pancytopenia pancytopenia /pan·cy·to·pe·nia/ (-sit-ah-pe´ne-ah) abnormal depression of all the cellular elements of the blood.

pan·cy·to·pe·ni·a
n.
. Postsurgery complications included acute refractory bleeding (aortic anastomosis), cytomegalovirus infection of the gut, bacterial pulmonary infection, and postoperative renal failure that required chronic hemodialysis that prolonged his stay in the intensive care unit (ICU ICU intensive care unit.

ICU
abbr.
intensive care unit



ICU

see intensive care unit.

ICU 
) to 5 months.

In January 2006, after a short visit to Martinique, the patient was transferred to our institution because of fever, dyspnea, and acute costal and back pain, with suspected osteitis osteitis /os·te·itis/ (os?te-i´tis) inflammation of bone.

condensing osteitis  osteitis with hard deposits of earthy salts in affected bone.
 underlying cutaneous lesions. Two months earlier, 4 trunk and leg abscesses or carbunclelike skin lesions had developed. Despite oral antistaphylococcal therapy, these lesions spread and became ulcerated Ulcerated
Damaged so that the surface tissue is lost and/or necrotic (dead).

Mentioned in: Adenoid Hyperplasia
 and painful. Three ulcerated, violaceous violaceous /vi·o·la·ceous/ (vi?o-la´shus) having a violet color, usually describing a discoloration of the skin.  plaques with undermined deep-infiltrated margins were present: 1 on the trunk (largest diameter 5 cm) (Figure, panel A) and 1 on each thigh. Three subcutaneous abscesses were present on the trunk and their puncture yielded a brown liquid. The differential diagnosis included pyoderma gangrenosum, neutrophilic dermatoses, mycobacteriosis, cutaneous bacterial infection, and calciphylaxis (chronic hemodialysis).

[FIGURE OMITTED]

The first histologic examination of a periulcerated skin lesion (punch biopsy specimen) showed diffuse dermal and hypodermal hy·po·der·mal  
adj.
1. Of or relating to the hypodermis.

2. Lying below the epidermis.

Adj. 1. hypodermal - of or relating to the hypodermis
 neutrophil infiltration and sparse histiocytelike cells (Figure, panel B). No infectious elements were identified. Biologic data indicated an inflammatory syndrome (Creactive protein 250 mg/L [normal <5 mg/L], procalcitonin 25 ng/mL [normal <1 ng/mL]), with increased elevated circulating neutrophil counts (10.9 x [10.sup.9] cells/L) and anemia (hemoglobin 7 g/dL). Cultures of blood, abscess fluid, and involved skin were repeatedly negative for bacterial, mycotic mycotic /my·cot·ic/ (mi-kot´ik)
1. pertaining to mycosis.

2. caused by a fungus.


my·cot·ic
adj.
1. Relating to mycosis.

2.
, or parasitic agents. A computed tomographic body scan showed a massive abscess under the left kidney associated with pulmonary nodules without cutaneous calciphylaxis. Positron emission tomography positron emission tomography: see PET scan.
positron emission tomography (PET)

Imaging technique used in diagnosis and biomedical research.
 scan confirmed those abnormalities and showed extensive and severe bone osteomyelitis.

Atypical pyoderma gangrenosum with visceral involvement was considered and treated with 3 intravenous prednisolone pulses. After minor initial improvement, the patient's condition deteriorated, and 10 days later septic shock associated with multiorgan failure developed. Surgical periulcer skin biopsy specimens were obtained in the ICU and specific parasite investigations were conducted. DA was then diagnosed. Hematoxylin hematoxylin /he·ma·tox·y·lin/ (he?mah-tok´si-lin) an acid coloring matter from the heartwood of Haematoxylon campechianum; used as a histologic stain and also as an indicator.  and eosin staining of histologic sections showed cysts and trophozoites (30 lam diameter) in the dermal-hypodermal junction within polymorphous inflammatory granulomas associated with ischemic necrosis (Figure, panels C and D). The presence of Acanthamoeba sp. was confirmed by culturing amebae from involved skin on agar plates coated with Escherichia coli. In an indirect assay, the patient's serum showed weak immunofluorescence labeling against his own cultured cysts or vegetative amebae.

Molecular identification of DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 extracted from the isolated amebae was made by using the UNSET un·set  
adj.
1. Not yet firm or solidified: unset gelatin; unset cement.

2. Not mounted in a setting: an unset gem. 
 method (6). A diagnostic small subunit rDNA fragment (ASA Asa (ā`sə), in the Bible, king of Judah, son and successor of Abijah. He was a good king, zealous in his extirpation of idols. When Baasha of Israel took Ramah (a few miles N of Jerusalem), Asa bought the help of Benhadad of Damascus and .S1) was amplified by using JDP1 and JDP2 primers, and its differentiating fragment (DF3) was sequenced by using an internal 892c primer (7). The sequence of the DF3 subset that contains the highly variable and informative section in the ASA.S 1 region of the Acanthamoeba isolate was visually compared with those of different published genotypes (T1-T15) (Table). Genotype T5 was identified (European Molecular Biology Laboratory The European Molecular Biology Laboratory (EMBL) is a molecular biology research institution supported by 19 countries comprising nearly all of western Europe and Israel.  accession no. AM411530). No drug-of-choice exists for treating DA. Despite treatment with pentamidine pentamidine /pen·tam·i·dine/ (pen-tam´i-den) an antiinfective used as the isethionate salt in the treatment of pneumonia, leishmaniasis, and early African trypanosomiasis. , 5-fluorocytosine, and itraconazole itraconazole /it·ra·co·na·zole/ (it?rah-kon´ah-zol) a triazoleantifungal used in a variety of infections.

it·ra·con·a·zole
n.
, the infection was rapidly fatal. Although analysis of cerebrospinal fluid obtained on days 5 and 18 after admission to the ICU showed no biochemical or parasite data suggestive of granulomatous amebic encephalitis, callus callus: see corns and calluses.
callus

In botany, soft tissue that forms over a wounded or cut plant surface, leading to healing. A callus arises from cells of the cambium.
 corpus necrosis was observed on a computed tomographic brain scan on day 18. The patient died of multiorgan failure on day 23. Family members refused to allow an autopsy.

Conclusions

Protozoan protozoan (prō'təzō`ən), informal term for the unicellular heterotrophs of the kingdom Protista. Protozoans comprise a large, diverse assortment of microscopic or near-microscopic organisms that live as single cells or in simple  infections are rare in heart transplant recipients, unlike in lung transplant recipients (8,9). To our knowledge, our patient, whose DA involved skin, bones, lungs, intraabdominal organs, and perhaps the brain, represents the first case to be reported to be spoken of; to be mentioned, whether favorably or unfavorably.

See also: Report
 in a heart transplant recipient. In a recent review of the literature, Duarte et al. (4) reported 5 cases of DA in lung (60%) or kidney (40%) transplant recipients. DA was difficult to diagnose in the patient, with 60% of the diagnoses made postmortem, which is similar to 74% of the diagnoses in 23 HIV/AIDS HIV/AIDS Human Immunodeficiency Virus/Acquired Immune Deficiency Syndrome  patients (2). The patient's clinical picture was atypical because his lesions were pyodermalike ulcers with subcutaneous abscesses, whereas the most frequently reported clinical skin manifestations were painful nodules, purpura, and pustules (10). Furthermore, the first histologic examination did not identify cysts. Acanthamoeba trophozoites with characteristic acanthopodia, cytoplasmic vacuoles, and a prominent nucleolus nucleolus: see cell. , especially in dermal vessels, were observed only after staining of the second biopsy specimen with hematoxylin and eosin in a context of strong clinical suspicion of DA. When reexamined retrospectively, the first skin biopsy specimen contained some pathogens, but trophozoites had been misidentified as histiocytelike cells.

Another important finding was the identification of the DA-causative agent as genotype T5, which is commonly found in the environment (11) and corresponds to A. lenticulata. This species has been isolated from nasal mucosa of persons without documented amebic infection (12). Although A. lenticulata has been shown to be pathogenic (12), genotype T5 was only recently isolated from a patient with keratitis (13). To our knowledge, our patient has the first case in which genotype T5 is the etiologic agent of a nonkeratitis, life-threatening DA infection.

Acanthamoeba spp. are free-living amebae found in soil, water, air, humans, and various animals (14). Depending on the molecular methods used (i.e., nuclear 18S rRNA or 16S rRNA mitochondrial mitochondrial

pertaining to mitochondria.


mitochondrial RNAs
a unique set of tRNAs, mRNAs, rRNAs, transcribed from mitochondrial DNA by a mitochondrial-specific RNA polymerase, that account for about 4% of the total cell RNA that
 gene amplification), 15 genotype sequences have been identified in environmental and human strains (T1-T15, Table). While genotype T4 is the most prevalent (79% of isolates) (15), only 1 A. lenticulata strain isolated from a patient with ocular keratitis had genotype T5 (13).

This case should alert physicians to a rare but life-threatening infection with A. lenticulata (genotype T5) in a heart transplant recipient. In organ transplant patients, when sterile cutaneous ulcers or subcutaneous abscesses develop that fail to respond to antibacterial treatments and pulse corticosteroids, histologic analysis should emphasize identifying Acanthamoeba spp.

Acknowledgments

We thank Janet Jacobson for editorial assistance.

References

(1.) Marciano-Cabral F, Cabral G. Acanthamoeba spp. as agents of disease in humans. Clin Microbiol Rev. 2003; 16:273-307.

(2.) Murakawa GJ, McCalmont T, Altman J, Telang GH, Hoffman MD, Kantor GR, et al. Disseminated acanthamebiasis in patients with AIDS. A report of five cases and a review of the literature. Arch Dermatol. 1995;131:1291-6.

(3.) Shirwadkar CG, Samant R, Sankhe M, Deshpande R, Yagi S, Schuster FL, et al. Acanthamoeba encephalitis in patient with systemic lupus, India. Emerg Infect Dis. 2006;12:984-6.

(4.) Duarte AG, Sattar F, Granwehr B, Aronson JF, Wang Z, Lick S. Disseminated acanthamoebiasis after lung transplantation. J Heart Lung Transplant. 2006;25:237-40.

(5.) Steinberg JP, Galindo RL, Kraus ES, Ghanem KG. Disseminated acanthamebiasis in a renal transplant recipient with osteomyelitis and cutaneous lesions: case report and literature review. Clin Infect Dis. 2002;35:e43-9.

(6.) Hugo ER, Stewart VJ, Gast R J, Byers TJ. Purification of amoeba amoeba: see ameba.
amoeba

One-celled protozoan that can form temporary extensions of cytoplasm (pseudopodia) in order to move about. Some amoebas are found on the bottom of freshwater streams and ponds.
 mtDNA using the UNSET procedure. In: Soldo Sol´do

n. 1. A small Italian coin worth a sou or a cent; the twentieth part of a lira.
 AT, Lee JJ, editors. Protocols in protozoology protozoology /pro·to·zo·ol·o·gy/ (-zo-ol´ah-je) the study of protozoa.

pro·to·zo·ol·o·gy
n.
The biological study of protozoa.



protozoology

the scientific study of protozoa.
. Lawrence (KS): Allen Press; 1992. p. D-7.1-2.

(7.) Booton GC, Kelly DJ, Chu YW, Seal DV, Houang E, Lam DS, et al. 18S ribosomal DNA typing and tracking of Acanthamoeba species isolates from corneal scrape specimens, contact lenses, lens cases, and home water supplies of Acanthamoeba keratitis patients in Hong Kong. J Clin Microbiol. 2002;40:1621-5.

(8.) Smart FW, Naftel DC, Costanzo MR, Levine TB, Pelletier GB, Yancy CW Jr, et al. Risk factors for early, cumulative, and fatal infections alter heart transplantation: a multiinstitutional study. J Heart Lung Transplant. 1996;15:329-41.

(9.) Kotloff RM, Ahya VN, Crawford SW. Pulmonary complications of solid organ and hematopoietic stem cell transplantation hematopoietic stem cell transplantation Hematology A therapy in which defective hematopoietic cells are replaced with normal BM cells after chemotherapy and/or RT Indications AML, breast CA, CML, germ cell tumors, lymphoma, myelodysplastic syndrome, myeloma, . Am J Respir Crit Care Med. 2004;170:22-48.

(10.) van Hamme C, Dumont M, Delos M, Lachapelle JM. Cutaneous acanthamoebiasis in a lung transplant patient. Ann Dermatol Venereol. 2001;128:1237-40.

(11). Schroeder JM, Booton GC, Hay J, Niszl IA, Seal DV, Markus MB, et al. Use of subgenic 18S ribosomal DNA PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 and sequencing for genus and genotype identification of acanthamoebae from humans with keratitis and from sewage sludge. J Clin Microbiol. 2001;39:1903-11.

(12.) de Jonckheere JF, Michel R. Species identification and virulence of Acanthamoeba strains from human nasal mucosa. Parasitol Res. 1988;74:314-6.

(13.) Spanakos G, Tzanetou K, Miltsakakis D, Patsoula E, Malamou-Lada E, Vakalis NC. Genotyping of pathogenic acanthamoebae isolated from clinical samples in Greece: report of a clinical isolate presenting T5 genotype. Parasitol Int. 2006;55:147-9.

(14.) de Jonckheere JF. Ecology of Acanthamoeba. Rev Infect Dis. 1991;13(Suppl 5):S385-7.

(15.) Booton GC, Visvesvara GS, Byers TJ, Kelly DJ, Fuerst PA. Identification and distribution of Acanthamoeba species genotypes associated with nonkeratitis infections. J Clin Microbiol. 2005;43: 1689-93.

Dr Barete is a dermatologist at the Hopital Tenon of the Universite Pierre-et-Marie-Curie in Paris. His research interests include infectious complications, mycotic skin infections, Kaposi sarcoma, and Epstein-Barr virus lymphoproliferation in organ transplant recipients.

Address for correspondence: Stephane Barete, Department of Dermatology and Allergy, Hopital Tenon, Assistance Publique Hopitaux de Paris, 4 rue de la Chine chine

the animal's backline.
, 75970 Paris CEDEX 20, France; email: stephane.barete@ psl.aphp.fr

Stephane Barete, * Alain Combes, ([dagger]) Johan F. de Jonckheere, ([double dagger]) Annick Datry, ([dagger]) Shaida Varnous, ([dagger]) Valdrie Martinez, ([dagger]) Sara Garcia Ptacek, * Eric Caumes, ([dagger]) Frederique Capron, ([dagger]) Camille Frances, * Claude Gibert, ([dagger]) and Olivier Chosidow *

* Hopital Tenon, Paris, France; ([dagger]) Hopital Pitie-Salpetriere, Paris, France; and ([double dagger]) Scientific Institute of Public Health, Brussels, Belgium
Table. rDNA sequences of Acanthamoeba isolate (2/533) from the
patient, a keratitis isolate (GAK1), 3 environmental T5 subtypes,
and 4 other genotypes from persons with nonkeratitis infections

Genotype (strain)             DF3 sequence (5' [right arrow] 3') *

T5(2/533)                     CAAAACACCGCCGTTAATCCTTTTT--
                              CGGGGGTTAACGGTTGGTGAAT

T5(GAK1)                      CAAAACACCGCCGTTAATCCTTT--
                              CGGGGGTTAATGGTTGGTGAAT

T5(72/2) ([dagger])           CAAAACACCGCCGTTAATCCTTT--
                              CGGGGGTTAATGGTTGGTGAAT

T5(PD2S) ([double dagger])    CAAAACACCGCTGTTAATCCTTT--
                              CGGGGGTTAATAGTTGGTGAAT

T5(FLAIV) ([section])         CAAAACACCGCCGTTAATCCTTTT-
                              CAACGGGGGTTAACGGTTGGTGAAT

T4                            CAAAACACCAATCGGCGCGGTCGTCCTTGGCGTCGGT
                              CCTTCACGGGGCCGGCGCGAGGGCGGCTTAGCCCGGT
                              GGCACC

T1                            CAAAACACCACCATCAGGCAGTGGGGTCGTGCTTCGC
                              TTTTCCGGCAACGGGGAAGTGGAGGCGGTCTCATTCC
                              CCTGATGG

T10                           CAAAACACCATCCATTTAGCAYGGTCGTTTTCAAATA
                              TTCCTTTTTGCGAAGGTTGTTTGGGAACGATTCGTCC
                              TGATGGATC

T12                           CAAAACACCACCATTAACACGATCGTTTTTTGCAAAT
                              ATGCCACATGCGCAAGTGTGTGGTTGTGTTTGAAGGA
                              ACGATTTG

* Sequence differences are shown in boldface.

([dagger]) Five isolates at European Molecular Biology Laboratory
(EMBL).

([double dagger]) Eight isolates at EMBL.

([section]) One isolate at EMBL.
COPYRIGHT 2007 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2007, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:DISPATCHES
Author:Chosidow, Olivier
Publication:Emerging Infectious Diseases
Article Type:Disease/Disorder overview
Date:May 1, 2007
Words:1920
Previous Article:Rudolf Virchow and the recognition of alveolar Echinococcosis, 1850s.
Next Article:Leptospirosis in urban wild boars, Berlin, Germany.
Topics:



Related Articles
Bridge-to-transplant given good marks. (temporary use of artificial hearts)
Cardiac transplantation: a review.(Special Series: Cardiopulmonary Physical Therapy)
Acanthamoeba sinusitis with subsequent dissemination in an AIDS patient.(Brief Article)(Statistical Data Included)
Virus in transplanted hearts bodes ill.(children who have received a heart transplant)(Brief Article)
THERAPEUTIC RECREATION'S ROLE IN MEETING THE NEEDS OF HEART TRANSPLANT PATIENTS.
SUR9 Heart-lung-liver transplant for cystic fibrosis. (Surgery).(Brief Article)
Transfusion-associated babesiosis after heart transplant. (Dispatches).
Acanthamoeba encephalitis in patient with systemic lupus, India.(DISPATCHES)(infectious diseases research)
Fatal reactive hemophagocytosis related to disseminated histoplasmosis with endocarditis: an unusual case diagnosed at autopsy.(Clinical report)
Rapidly fatal acanthamoeba encephalitis and treatment of cryoglobulinemia.(DISPATCHES)(Author abstract)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles