Expressed sequence tag analysis of genes expressed during development of the tropical abalone Haliotis asinine.ABSTRACT The tropical abalone abalone (ăbəlō`nē), popular name in the United States for a univalve gastropod mollusk of the genus Haliotis, members of which are also called ear shells, or sea ears, as their shape resembles the human ear. , Haliotis asinina, is an ideal species to investigate the molecular mechanisms that control development, growth, reproduction and shell formation in all cultured haliotids. Here we describe the analysis of 232 expressed sequence tags An expressed sequence tag or EST is a short sub-sequence of a transcribed spliced nucleotide sequence (either protein-coding or not). They may be used to identify gene transcripts, and are instrumental in gene discovery and gene sequence determination. (EST EST electroshock therapy. EST abbr. electroshock therapy ) obtained from a developmental H. asinina cDNA library A cDNA library is a collection of clones containing cDNAs. cDNA libraries are often intended to represent as many as possible of the mRNAs contained within a cell. Because working with mRNA is difficult (as mRNA is unstable and is easily degraded by RNases which can be found even intended for future microarray studies. From this data set we identified 183 unique gene clusters. Of these, 90 clusters showed significant homology homology (hōmŏl`əjē), in biology, the correspondence between structures of different species that is attributable to their evolutionary descent from a common ancestor. with sequences lodged in GenBank, ranging in function from general housekeeping to signal transduction Signal transduction The transmission of molecular signals from a cell's exterior to its interior. Molecular signals are transmitted between cells by the secretion of hormones and other chemical factors, which are then picked up by different cells. , gene regulation and cell-cell communication. Seventy-one clusters possessed completely novel ORFs greater than 50 codons in length, highlighting the paucity of sequence data from molluscs and other lophotrochozoans. This study of developmental gene expression in H. asinina provides the foundation for further detailed analyses of abalone growth, development and reproduction. KEY WORDS: abalone, EST, Lophotrochozoan, development, Haliotis asinine INTRODUCTION Abalone (Haliotis spp.) are a particularly attractive aquaculture aquaculture, the raising and harvesting of fresh- and saltwater plants and animals. The most economically important form of aquaculture is fish farming, an industry that accounts for an ever increasing share of world fisheries production. species because of their high demand, high market value and limited supply (Gordon & Cook 2001, Oakes & Ponte 1996). Whereas temperate abalone form the majority of abalone exports worldwide, there is a growing demand for tropical species (Jarayabhand & Paphavasit 1996). The tropical Indo-Pacific, including Australia, is well positioned to capture and further develop this market through the aquaculture of the rapidly growing tropical species Haliotis asinina Linnaeus. This species reaches marketable size far quicker than the temperate species (Capinpin & Corre 1996, Capinpin et al. 1999) and is ideal for the new "cocktail"-sized abalone market (Nateewathana & Hylleberg 1986, Singhagraiwan & Doi 1993). We have been using the tropical abalone to address questions pertaining to development (e.g., Giusti et al. 2000, Hinman & Degnan 2002, Hinman et al. 2003, O'Brien & Degnan 2002a, 2002b, O'Brien & Degnan 2003, Jackson et al. 2005) and as a model to investigate the molecular basis of commercially important developmental and physiological traits (Jackson et al. 2005, Selvamani et al. 2001, Selvamani et al. 2000). With a frequent and predictable spawning cycle (Counihan et al. 2001, Jebreen et al. 2000) and established techniques for culturing to sexual reproduction sexual reproduction n. Reproduction by the union of male and female gametes to form a zygote. Also called syngenesis. (Jackson et al. 2001), gene expression can be easily studied at any stage of the life cycle. As a member of the Lophotrochozoa, the least investigated bilaterian superphylum (Adoutte et al. 2000), analyses of H. asinina development also contributes to a general understanding of metazoan metazoan member of the zoological division of Metazoa. evolution and development. As a prelude to the sequencing of the human genome The human genome is the genome of Homo sapiens, which is composed of 24 distinct pairs of chromosomes (22 autosomal + X + Y) with a total of approximately 3 billion DNA base pairs containing an estimated 20,000–25,000 genes. , over 170,000 ESTs were sequenced in an attempt to identify new genes and their expression patterns (Adams et al. 1995). This approach has been applied to a wide range of species, permitting the identification of homologous homologous /ho·mol·o·gous/ (ho-mol´ah-gus) 1. corresponding in structure, position, origin, etc. 2. allogeneic. ho·mol·o·gous adj. 1. genes from organisms not previously studied (see http://www.ncbi.nlm.nih.gov/dbEST/ dbEST summary.html for a comprehensive list). Included in this public database are a number of marine invertebrates: the ascidians, Ciona intestinalis Ciona intestinalis is a Urochordata (sea squirt) whose genome has been sequenced and which has become, over the past decade, a major experimental model for developmental biologists. Four subspecies have been described. (684,319 ESTs), Halocynthia roretzi (4192 ESTs) and Polyandrocarpa misakiensis (465 ESTs), the lancelet lancelet, name for small, fishlike lower chordate (see Chordata), also called amphioxus; it shows many affinities with the vertebrates. There are about 30 lancelet species, most belonging to the genus Brachiostoma (formerly Amphioxus). Branchiostoma floridae (277,538), the sea urchin sea urchin, spherical-shaped echinoderm with movable spines covering the body. The body wall is a firm, globose shell, or test, made of fused skeletal plates and marked by regularly arranged tubercles to which the movable spines are attached. Strongylocentrotus purpuratus Strongylocentrotus purpuratus, or the purple sea urchin, is one of the sharp-spined sea urchin species. The spines are used as a means of defense against would-be predators. This urchin is deep purple in color, and grows to a diameter of about 4 inches. (130,988 ESTs), the oyster Crassostrea virginica (9018 ESTs) and the prawn prawn: see shrimp. Penaeus monodon Penaeus monodon (common names include giant tiger prawn, black tiger prawn, leader prawn, sugpo and grass prawn) is a marine crustacean that is widely reared for food. (1611 ESTs) (dbEST release July 22, 2005). However there is a significant bias in this database towards vertebrates, model organisms and terrestrial species of commercial value. Here we describe a small-scale EST analysis of cDNAs obtained from a cDNA library constructed from a range of developmental stages of the tropical abalone H. asinina. MATERIALS AND METHODS RNA RNA: see nucleic acid. RNA in full ribonucleic acid One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic Extraction and Library Construction Total RNA was extracted according to according to prep. 1. As stated or indicated by; on the authority of: according to historians. 2. In keeping with: according to instructions. 3. the method of Chomczynski and Sacchi (1987) from the following developmental stages: egg, gastrula gastrula /gas·tru·la/ (gas´troo-lah) the embryo in the stage following the blastula or blastocyst; the simplest type consists of two layers of cells, the ectoderm and endoderm, which have invaginated to form the archenteron and an , early trochophore troch·o·phore n. The small, free-swimming, ciliated aquatic larva of various invertebrates, including certain mollusks and annelids. [Greek trokhos, wheel (from trekhein, (13 h post fertilization; hpf), mid torsion torsion, stress on a body when external forces tend to twist it about an axis. See strength of materials. (18 hpf), early veliger ve·li·ger n. A larval stage of a mollusk characterized by the presence of a velum. [New Latin v (24 hpf), mid veliger (40 hpf), early competent veliger (72 hpf), late competent veliger (134 hpf), 1 day post metamorphosis and 5 days post metamorphosis. All RNAs were quantified spectrophotometrically and quality-assessed by inspection of samples that had been electrophoresed through a 1% formaldehyde gel (Sambrook & Russell 2001). To maximize gene representation in the cDNA library 200 ng of total RNA from each stage was combined for library construction using the directional Clontech SMART cDNA library synthesis kit. Following the manufacturers instructions, double stranded cDNA was PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) amplified for 23 cycles prior to cloning. Five-thousand plaques were individually hand picked following methods outlined by Sambrook and Russell (2001) for microarray printing. Of these 288 plaques were PCR amplified using the [lambda]Triple X forward (CTCGGGAAGCGCGCCATTGTGTTGGT) and reverse (TAATACGACTCACTATAGGGCGAATTGGCC) primers. Successful PCR reactions were subsequently purified with the Millipore multiscreen PCR clean up kit. Two-hundred and thirty-two clones were single-pass sequenced using the [lambda]Triple X forward primer and ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother. (Application Binary Interface) A specification for a specific hardware platform combined with the operating system. Big Dye terminator mix (version 2) following standard procedures (2001). Sequence Analysis Sequencing chromatograms were assessed manually using 4Peaks (v1.5) and were truncated to eliminate ambiguous terminal base calls and vector sequence. BLASTx and BLASTn homology searches were conducted against the NCBI nr databases using the default conditions (low complexity filter on, an expect value of 10 and the BLOSUM BLOSUM Blocks Substitution Matrix 62 matrix with existence 11 and extension 1 gap costs). Sequences that returned BLAST matches with an E value of 1[e.sup.-06] or less were considered significant, and allowed a functional classification to be loosely made following the scheme of Lee et al. (1999). To assess sequence redundancy or "uniqueness," sequences were clustered using ClustalW (http://www.ebi.ac.uk/ clustalw/index.html?), (Chenna et al. 2003). The integrity of each cluster was assessed manually by visually inspecting cluster alignments for overlap quality. Where cluster members were found to share more than 95% identity the cluster was usually maintained. ESTs were also assessed for the presence of a putative poly (A) tail and an associated polyadenylation signal based on the classification of Beaudoing et al. (2000). Those sequences that did not return any significant BLAST result were assessed for the presence of an open reading frame (ORF) using the European Bioinformatics Institute The European Bioinformatics Institute (EBI) is a centre for research and services in bioinformatics, and is part of European Molecular Biology Laboratory (EMBL). It is a pioneer of novel and developmental bioinformatics research. Transeq server (http://www.ebi.ac.uk/emboss/transeq/). Only ORFs longer than 50 amino acid amino acid (əmē`nō), any one of a class of simple organic compounds containing carbon, hydrogen, oxygen, nitrogen, and in certain cases sulfur. These compounds are the building blocks of proteins. residues were accepted (Lee et al. 1999, Lehninger et al. 1993). RESULTS The Haliotis asinina developmental cDNA library contained 5 x [10.sup.7] pfu/mL, of which approximately 93% were recombinant clones. These had an average insert size of 1044 [+ or -] 411 bp. Clustering of the 232 sequences revealed that 157 sequences occurred only once, 16 sequences occurred twice, 3 sequences occurred three times, 3 sequences occurred four times, 3 sequences occurred 5 times and 1 sequence occurred 7 times, producing 183 unique clusters (Table 1). Homology searches using the BLASTx and BLASTn algorithms were conducted for all sequences. 90 clusters returned a significant BLAST result and are grouped according to function in Table 2. Sixty-eight clusters fell into the category of genes used by many cell types, 8 clusters showed homology with genes involved in cell-cell communication, 3 clusters showed homology with transcription factors, and they are likely to play important developmental or biosynthetic bi·o·syn·the·sis n. Formation of a chemical compound by a living organism. Also called biogenesis. bi roles in H. asinina. Eleven clusters showed significant homology with an undescribed ORF and could not be classified (Fig. 1; Table 1). These EST sequences have been submitted to GenBank under accession numbers DY402832DY403158. [FIGURE 1 OMITTED] Polyadenylation Signal and ORF Analysis Of the 183 unique clusters, 81 were completely sequenced in one pass and possessed a poly (A)-rich region at the 3' end of the sequence. Of these 81, 54 possessed a putative polyadenylation signal a mean distance of 17 nucleotides upstream of the poly (A) tail. The frequency of polyadenylation signals alternative to the predominant AATAAA signal was remarkably similar to that of human signals reported by Beaudoing et al. (2000) (Table 3). We also found that out of all ESTs with a polyadenylation signal, 5 (2.1%) had dual polyadenylation signals an appropriate distance upstream (both within 35 bp) of the poly A tail. This compares with 16.6% of human genes with dual polyadenylation signals reported by Beaudoing et al. (2000). Of the 93 clusters that did not produce a significant BLAST result, 71 possessed ORFs equal to or longer than 50 codons (150 nucleotides), suggesting that they represent transcribed genes with no reported homologue homologue /ho·mo·logue/ (hom´ah-log) 1. any homologous organ or part. 2. in chemistry, one of a series of compounds distinguished by addition of a CH2 group in successive members. . DISCUSSION A decade ago Adams et al. (1995) established a set of stringent criteria for selection of cDNA libraries of adequate quality to be used in a large scale human EST analysis. These criteria included the following parameters: (1) less than 20% of the clones in library should have no insert or ribosomal and mitochondrial mitochondrial pertaining to mitochondria. mitochondrial RNAs a unique set of tRNAs, mRNAs, rRNAs, transcribed from mitochondrial DNA by a mitochondrial-specific RNA polymerase, that account for about 4% of the total cell RNA that sequences; (2) the average insert lengths should be 1 kb or greater; (3) at least 50% of the cDNAs should encode novel genes and (4) no gene or group of genes should dominate the distribution. These authors advocate the sequencing of 100-200 clones as an excellent means of assessing library quality based on these criteria. Here we have constructed a cDNA library from 10 distinct stages of development from the tropical abalone Haliotis asinina. Upon sequencing 232 randomly selected clones, we found that this library satisfies all of the criteria outlined by Adams et al.(1995). Searching the NCBI databases using the BLAST algorithms, 90 of the 183 clusters (49.1%) are significantly similar to previously described sequences. As Lee et al. (1999) points out, one of the great advantages of an EST analysis of a novel cDNA library constructed from relatively poorly studied tissues is the generation of probes for "interesting" genes. This study has revealed a number of ESTs that deserve further investigation in terms of their temporal and spatial expression profiles, and the developmental and physiological roles that they play in the tropical abalone. For example, a significant proportion of the ESTs encode proteins that appear to be involved with stress response, detoxification Detoxification Definition Detoxification is one of the more widely used treatments and concepts in alternative medicine. It is based on the principle that illnesses can be caused by the accumulation of toxic substances (toxins) in the body. , cell defense and innate immunity innate immunity n. Immunity that occurs naturally as a result of a person's genetic constitution or physiology and does not arise from a previous infection or vaccination. (Fig. 1). Analyses of differential gene expression in the ascidians Boltenia villosa and Herdmania momus The solitary ascidian Herdmania momus is one of the most commonly encountered species of ascidians. While commonly referred to simply as sea squirts, this name is ambiguous, as it can refer to any member of the sub-phylum Urochordata. during larval larval 1. pertaining to larvae. 2. larvate. larval migrans see cutaneous and visceral larva migrans. development and metamorphosis have revealed that a significant proportion of the expressed genes are involved with the innate immune system
bi·o·ta n. The flora and fauna of a region. associated with coralline algae coralline algae: see Rhodophyta. may be responsible for induction of abalone settlement and metamorphosis (Bryan & Qian 1998, Roberts 2001). Genes involved in cellular metabolism are also well represented in this EST set (7 clusters). Because larvae Larvae, in Roman religion Larvae: see lemures. of H. asinina are lecithotrophic (nonfeeding), maternal energy reserves are utilized during larval development and metamorphosis. Genes encoding certain digestive enzymes Digestive enzymes Molecules that catalyze the breakdown of large molecules (usually food) into smaller molecules. Mentioned in: Heartburn digestive enzymes however only appear to be activated during late larval development (Degnan et al. 1995, Spaulding & Morse 1991), whereas enzymes required for algal algal pertaining to or caused by algae. algal infection is very rare but systemic and udder infections are recorded. See protothecosis. algal mastitis the algae Prototheca trispora and P. digestion are not detectable until postlarvae are significantly older (Takami et al. 1998). The proteases and metabolic enzymes identified here provide a platform from which to further our understanding of the processes that regulate and limit larval and juvenile growth. An FMRF-encoding gene was also detected in this EST survey. In the gastropod gastropod, member of the class Gastropoda, the largest and most successful class of mollusks (phylum Mollusca), containing over 35,000 living species and 15,000 fossil forms. mollusc mollusc members of the phylum Mollusca, which comprises about 50,000 species. Includes snails, slugs and the aquatic molluscs—oysters, mussels, clams, cockles, arkshells, scallop, abalone, cuttlefish, squid. Lymnaea stagnalis Lymnaea stagnalis, the great pond snail, is a species of freshwater gastropod from the family Lymnaeidae. Description Height of shell: 45-60 mm. Width of shell: 20-30 (34) mm. Distribution and biotope Distribuiton: Holarctic. , expression of this gene is affected by infection of a schistosome schistosome /schis·to·some/ (shis´-) (skis´to-som) an individual of the genus Schistosoma. schis·to·some n. parasite. This seems to be a strategy of the parasite to induce physiological (growth and reproduction) and behavioral changes in the host (Hoek et al. 1997). Among natural populations H. asinina can become infected by a digenean digenean pertaining to or of the nature of members of the fluke subclass Digenea. parasite that has been suggested to influence the antagonism between growth and reproduction cycles (Lucas et al. 2005), with infected animals effectively being castrated cas·trate tr.v. cas·trat·ed, cas·trat·ing, cas·trates 1. To remove the testicles of (a male); geld or emasculate. 2. To remove the ovaries of (a female); spay. 3. . The FMRF-neuropeptide identified here provides a means with which to study this phenomenon (Rice & Degnan, unpublished data). Of the 90 unique clusters that returned significant BLAST matches, 11 (12.2%) could not be assigned a function. This value is less than that reported by Adams et al. (1995) for a human EST study (24.8% of 266,714 ESTs), but much larger than 5.2% reported by Lee et al. (1999) for a sea urchin EST analysis, and 4.1% reported by Davidson and Swalla (2002) for an ascidian EST ascidian: see Chordata; tunicate. analysis. These figures reflect both the exponential increase in the number of annotated sequences housed in the NCBI database since 1995 (the 1995 Genbank database was 3.7% the size of the 2001 database), and the fact that 14. asinina belongs to the poorly studied Lophotrochozoan clade clade Cladus, subtype Genetics A branch of biological taxa or species that share features inherited from a common ancestor; a single phylogenetic group or line. See Inheritance, Species. in terms of sequence representation and annotation 1. (programming, compiler) annotation - Extra information associated with a particular point in a document or program. Annotations may be added either by a compiler or by the programmer. . After an analysis of those ESTs that showed no homology with any sequences in the GenBank database, Lee et al. (1999) estimated that 65% to 80% of these sequences were genuine protein coding sequences that were simply too divergent to match anything in the largely mammalian GenBank database. This estimate was based on an analysis of observed versus expected ORF length within each EST. Briefly, randomly generated sequences equal in length to those ESTs analyzed were assessed for the presence of the longest ORF. These derived ORFs rarely exceeded 150 base pairs. Here we analyzed novel clusters (clusters that showed no homology with GenBank sequences) for the presence of ORFs greater than 150 nucleotides in length, in an effort to identity genuine coding transcripts that have no homologues within GenBank. Of the 93 novel clusters, 71 (76.3%) possessed an ORF in excess of 50 codons. This is similar to Lee et al.'s (1999) estimate of Strongylocentrotus purpuratus specific mRNAs of 65% to 80%. Current developmental studies on H. asinina further support the notion of a high proportion of H. asinina specific genes (Jackson et al. 2005). Interestingly, studies on C. elegans C. elegans A nematode (Caenorhabditis elegans) that lives in soil, feeds on bacteria, and reaches lengths of about 1 mm (0.04 inch). It was the first animal whose genome was completely sequenced, and is widely used as a "model organism" by and Drosophila Drosophila: see fruit fly. drosophila Any member of about 1,000 species in the dipteran genus Drosophila, commonly known as fruit flies but also called vinegar flies. Some species, particularly D. , for which entire genomes are available, have revealed lower estimates of organism-specific coding sequences: 50% and 30% respectively of all recognized coding sequences (Harrison et al. 2002). If representative, this high proportion of novel coding mRNA transcripts for H. asinina further highlights the need for more studies of this kind to be conducted on the poorly studied Lophotrochozoan clade. CONCLUSION This small EST project has demonstrated that the H. asinina library we have constructed consists of a diverse set of cDNAs that are of a large enough size to be useful in future microarray and gene characterization studies. It has also shown that during development, embryos and larvae of the tropical abalone express genes involved in a range of functions, ranging from cell defense and innate immunity to signal transduction and metabolism. The percentage of EST sequences that do not have homologues in the NCBI database highlights the need for further EST projects to be conducted on more diverse organisms, especially taxa taxa: see taxon. belonging to the Lophotrochozoa. ACKNOWLEDGMENTS This research was funded by an Australian Research Council The Australian Research Council (ARC) is the Australian Government’s main agency for allocating research funding to academics and researchers in Australian universities. grant to BMD BMD In currencies, this is the abbreviation for the Bermudian Dollar. Notes: The currency market, also known as the Foreign Exchange market, is the largest financial market in the world, with a daily average volume of over US $1 trillion. . LITERATURE CITED Adams, M. D., A. R. Kerlavage, R. D. Fleischmann, R. A. Fuldner, C. J. Bult, N. H. Lee, E. F. Kirkness, K. G. Weinstock, J. D. Gocayne & O. White. 1995. Initial assessment of human gene diversity and expression patterns based upon 83 million nucleotides of cDNA sequence. Nature 377(Supplement 6547):3-174. Adoutte, A., G. Balavoine, N. Lartillot, O. Lespinet, B. Prud'homme & R. de Rosa De Rosa may refer to:
Beaudoing, E., S. Freier, J. R. Wyatt, J. M. Claverie & D. Gauheret. 2000. Patterns of variant polyadenylation signal usage in human genes. Gen. Res. 10:1001-1010. Bryan, P. J. & P. Y. Qian. 1998. Induction of larval attachment and metamorphosis in the abalone Haliotis diversicolor (Reeve). J. Exp. Mar. Biol. Ecol. 223:39-51. Capinpin, E. C. & K. G. Corre. 1996. Growth rate of the Philippine abalone, Haliotis asinina fed an artificial diet and macroalgae. Aquaculture 144:81-89. Capinpin, E. C., J. D. Toledo, V. C. Encena & M. Doi. 1999. Density dependent growth of the tropical abalone Haliotis asinina in cage culture. Aquaculture 171:227-235. Chenna, R., H. Sugawara, T. Koike, R. Lopez, T. J. Gibson, D. G. Higgins & J. D. Thompson. 2003. Multiple sequence alignment A multiple sequence alignment (MSA) is a sequence alignment of three or more biological sequences, generally protein, DNA, or RNA. In general, the input set of query sequences are assumed to have an evolutionary relationship by which they share a lineage and are descended from a with the Clustal series of programs. Nucleic Acids Nucleic acids The cellular molecules DNA and RNA that act as coded instructions for the production of proteins and are copied for transmission of inherited traits. Res. 31:3497-3500. Chomczynski, P. & N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction Guanidinium thiocyanate-phenol-chloroform extraction is an extraction method for isolating RNA, DNA and protein. This method is widely used in molecular biology, and is often referred to as the TRIzol method, after the name of the Invitrogen product. . Anal. Biochem. 162:156-159. Counihan, R., D. C. McNamara, D. C. Souter, E. J. Jebreen, N. P. Preston, C. R. Johnson & B. M. Degnan. 2001. Pattern, synchrony synchrony /syn·chro·ny/ (-krah-ne) the occurrence of two events simultaneously or with a fixed time interval between them. atrioventricular (AV) synchrony and predictability of spawning of the tropical abalone Haliotis asinina from Heron Reef, Australia. Mar. Ecol. Prog. Ser. 213:193-202. Davidson, B. & B. J. Swalla. 2002. A molecular analysis of ascidian metamorphosis reveals activation of an innate immune response immune response n. An integrated bodily response to an antigen, especially one mediated by lymphocytes and involving recognition of antigens by specific antibodies or previously sensitized lymphocytes. . Development 129:4739-4751. Degnan, B. M., J. C. Groppe & D. E. Morse. 1995. Chymotrypsin chymotrypsin (kī'mōtrĭp`sĭn), proteolytic, or protein-digesting, enzyme active in the mammalian intestinal tract. It catalyzes the hydrolysis of proteins, degrading them into smaller molecules called peptides. mRNA expression in digestive gland digestive gland n. A gland, such as the liver or pancreas, that secretes into the alimentary canal substances necessary for digestion. amoebocytes: cell specification occurs prior tn metamorphosis and gut morphogenesis morphogenesis /mor·pho·gen·e·sis/ (mor?fo-jen´e-sis) the evolution and development of form, as the development of the shape of a particular organ or part of the body, or the development undergone by individuals who attain the type to in the gastropod, Haliotis rufescens. Roux Roux , Pierre Paul Émile 1853-1933. French bacteriologist. His work with the diphtheria bacillus led to the development of antitoxins to neutralize pathogenic toxins. . Arch. Dev. Biol. 205:97-101. Giusti, A. F., V. F. Hinman, S. M. Degnan, B. M. Degnan & D. E. Morse. 2000. Expression of a Scr/Hox5 gene in the larval central nervous system of the gastropod Haliotis, a non-segmented spiralian lophotrochozoan. Evol. Dev. 2:294-302. Gordon, H. R. & P. Cook. 2001. World abalone supply, markets and pricing: historical, current and future. J. Shellfish Res. 20:567-570. Harrison, P. M., A. Kumar, N. Lang, M. Snyder & M. Gerstein. 2002. A question of size: the eukaryotic eukaryotic /eu·kary·ot·ic/ (u?kar-e-ot´ik) pertaining to a eukaryon or to a eukaryote. eukaryotic pertaining to eukaryosis. eukaryotic cells see cell. proteome pro·te·ome n. The complete set of proteins that are produced by the genes of an organism. proteome the entire complement of proteins produced by a cell. and the problems in defining it. Nucleic Acids Res. 30:1083-1090. Hinman, V. F. & B. M. Degnan. 2002. Mox homeobox homeobox Any of various DNA sequences containing about 180 nucleotides that encode for corresponding sequences of usually 60 amino acids, called homeodomains, found in proteins that bind DNA and regulate gene transcription. expression in muscle lineage of the gastropod Haliotis asinina: evidence for a conserved role in bilaterian myogenesis. Dev. Genes Evol. 212:141-144. Hinman, V. F., E. K. O'Brien, G. S. Richards & B. M. Degnan. 2003. Expression of anterior Hox genes in larvae of the gastropod. Haliotis asinina. Evol. Dev. 5:508 521. Hock hock: see wine. , R. M., R. E. van Kesteren, A. B. Smit, M. de Jong-Brink & W. P. M. Geraerts. 1997. Altered gene expression in the host brain caused by a trematode trematode: see fluke; Platyhelminthes. parasite: Neuropeptide neuropeptide /neu·ro·pep·tide/ (noor?o-pep´tid) any of the molecules composed of short chains of amino acids (endorphins, enkephalins, vasopressin, etc.) found in brain tissue. neu·ro·pep·tide n. genes are preferentially affected during parasitosis par·a·si·to·sis n. pl. par·a·si·to·ses Infestation with parasites. parasitosis a disease caused by a parasitic infestation. See also helminthiasis. . Proc. Natl. Acad. Sci. USA 94:14072-14076. Jackson, D., K. Williams & B. M. Degnan. 2001. Suitability of Australian formulated diets for the aquaculture of the tropical abalone Haliotis asinina Linnaeus. J. Shellfish Res. 20:627-636. Jackson, D. J., N. Ellemor & B. M. Degnan. 2005. Correlating gene expression with larval competence, and the effect of age and parentage PARENTAGE. Kindred. Vide 2 Bouv. Inst. n. 1955; Branch; Line. on metamorphosis in the tropical abalone Haliotis asinina. Mar. Biol. 147:681-697. Jarayabhand, P. & N. Paphavasit. 1996. A review of the culture of tropical abalone with special reference to Thailand. Aquaculture 140:159-168. Jebreen, E. J., R. T. Counihan, D. R. Fielder & B. M. Degnan. 2000. Synchronous oogenesis during the semilunar semilunar /semi·lu·nar/ (-loo´nahr) resembling a crescent or half-moon. sem·i·lu·nar or sem·i·lu·nate adj. Shaped like a half-moon; crescent-shaped; lunar. spawning cycle of the tropical abalone Haliotis asinina. J. Shellfish Res. 19:845-851. Lee, Y.-H., G. M. Huang, R. A. Cameron, G. Graham, E. H. Davidson, L. Hood & R. J. Britten. 1999. EST analysis of gene expression in early cleavage-stage urchin urchin - munchkin embryos. Development 126:3857-3867. Lehninger, A. L., D. L. Nelson & M. M. Cox. 1993. Principles of biochemistry. New York New York, state, United States New York, Middle Atlantic state of the United States. It is bordered by Vermont, Massachusetts, Connecticut, and the Atlantic Ocean (E), New Jersey and Pennsylvania (S), Lakes Erie and Ontario and the Canadian province of : Worth Publishers. Lucas, T., E. K. O'Brien, T. Cribb & B. M. Degnan. 2005. Digenean trematodes infecting the tropical abalone Haliotis asinina have species-specific cercarial cercarial pertaining to or emanating from cercariae. cercarial dermatitis see trichobilharzia. emergence patterns that follow daily or semilunar spawning cycles. Mar. Biol. 148:285-292. Nateewathana, A. & J. Hylleberg. 1986. Thai species of abalone (Haliotis spp.). Is aquaculture feasible? Thai Fisheries Gazette 39:10-17. O'Brien, E. K. & B. M. Degnan. 2002a. Developmental expression of a class IV POU POU Point Of Use POU Program Organization Unit POU Poughkeepsie, NY, USA - Dutchess County (Airport Code) POU Pay Own Utilities (used in housing advertisements) POU Petrick Outsourcing Unlimited, Inc. gene in the gastropod Haliotis asinina supports a conserved role in sensory cell development in bilaterians. Dev. Genes Evo. 212:394-398. O'Brien, E. K. & B. M. Degnan. 2002b. Pleiotropic developmental expression of HasPOUIII, a class III POU gene, in the gastropod Haliotis asinina. Mech. Dev. 114:129-202. O'Brien, E. K. & B. M. Degnan. 2003. Expression of Pax258 in the gastropod statocyst stat·o·cyst n. A small organ of balance in many invertebrates, consisting of a fluid-filled sac containing statoliths that stimulate sensory cells and help indicate position when the animal moves. Also called otocyst. : insights into the antiquity of metazoan geosensory organs. Evol. Dev. 5:572-578. Oakes, F. R. & R. D. Ponte. 1996. The abalone market: opportunities for cultured abalone. Aquaculture 140:187-195. Roberts, R. 2001. A review of settlement cues for larval abalone (Haliotis spp.). J. Shellfish Res. 20:571-586. Sambrook, J. & D. W. Russell. 2001. Molecular cloning Molecular cloning refers to the procedure of isolating a defined DNA sequence and obtaining multiple copies of it in vivo. Cloning is frequently employed to amplify DNA fragments containing genes, but it can be used to amplify any DNA sequence such as promoters, non-coding : a laboratory manual. Cold Spring Harbor, New York
Cold Spring Harbor is a hamlet (and census-designated place) in Suffolk County, New York on the North Shore of Long Island. As of the United States 2000 Census, the CDP population was 4,975. : Cold Spring Harbor Laboratory  The Cold Spring Harbor Laboratory Press.
Selvamani, M. J. P., S. M. Degnan & B. N. Degnan. 2001. Microsatellite See miniaturized satellite. genotyping of individual abalone larvae: parentage assignment in aquaculture. Mar. Biotechnol. 3:478-485. Selvamani, M. J. P., S. M. Degnan, D. Paetkau & B. M. Degnan. 2000. Highly polymorphic polymorphic - polymorphism microsatellite loci loci [L.] plural of locus. loci Plural of locus, see there in the Heron Reef population of the tropical abalone Haliotis asinina. Mol. Ecol. 9:1184-1186. Singhagraiwan, T. & M. Doi. M. 1993. Seed production and culture of a tropical abalone, Haliotis asinina Linne: the research project of fishery resource development in the kingdom of Thailand. Spaulding, D. C. & D. E. Morse. 1991. Purification and characterization of sulfatases from Haliotis rufescens: evidence for changes in synthesis and heterogeneity during development. J. Comp. Physiol. 161:498-515. Takami, H., T. Kawamura & Y. Yamashita. 1998. Development of polysaccharide polysaccharide: see carbohydrate. polysaccharide Any of a large class of long-chain sugars composed of monosaccharides. Because the chains may be unbranched or branched and the monosaccharides may be of one, two, or occasionally more kinds, degredation activity in postlarval abalone Haliotis discus discus /dis·cus/ (dis´kus) pl. dis´ci [L.] disk. dis·cus n. pl. dis·ci A flat circular surface; a disk. discus pl. disci [L.] 1. hannai. J. Shellfish Res. 17:723-727. Woods, R. G., K. Roper, M. Gauthier, L. Bebell, K. Sung, M. F. Lavin & B. M. Degnan. 2004. Gene expression during early ascidian metamorphosis requires signaling by Hemps, an EGF-like protein. Development 131:2921-2933. DANIEL J. JACKSON AND BERNARD M. DEGNAN * School of Integrative Biology, University of Queensland The University of Queensland (UQ) is the longest-established university in the state of Queensland, Australia, a member of Australia's Group of Eight, and the Sandstone Universities. It is also a founding member of the international Universitas 21 organisation. , Brisbane QLD QLD or Qld Queensland 4072 Australia * Corresponding author. E-mail: b.degnan@uq.edu.au
TABLE 1.
Summary of ESTs grouped by category and BLAST results.
No. of No. of
Code Class Clusters Clones
A. Functions that many kinds of cells use
AI Transport and binding proteins for
ions and other small molecules 1 1
AII RNA processing, polymerising, splicing
and binding proteins 4 4
AIII Cell replication, histones, cyclins
and allied kinases, DNA polymerases 4 5
AIV Cytoskeleton and membrane proteins,
cellular organisers 7 8
AV Protein synthesis cofactors, ribosomal
proteins, rRNAs 29 47
AVI Intermediary metabolism and catabolism
enzymes 7 7
AVII Stress response, detoxification, and
cell defense proteins 8 18
AVIV Protein degradation and processing,
proteases 3 3
AIX Transportation and binding proteins
for proteins and other
macromolecules 3 4
AX Proteins involved in motility
including muscle components 2 1
Total 68 98
B. Cell-cell communication
BI Signalling receptors and ligands 4 4
BII Intracellular signaling molecules,
including kinases and signal
intermediates 3 3
BIII Extracellular matrix proteins and cell
adhesion 1 1
Total 8 8
C. Transcription factors and other regulatory proteins
CI Sequence-specific DNA-binding proteins 3 3
CII Non-DNA binding proteins that have
positive or negative roles 0 0
CII Chromatin proteins other than AIII
with regulatory function 0 0
Total 3 3
D. Not enough information to classify
DI Not enough information to classify 11 11
DII No significant similarities to known
proteins 93 112
Total 104 123
Overall total 183 232
Single copy sequences 157
Total no. of ESTs represented more
than once 75
Total no. of redundant sequences 49
Total number of unique sequences
(total number of clusters) 183
Clusters returning significant BLAST
match 90
Clusters without any GenBank homologue 93
TABLE 2. Significant BLAST results grouped according to function.
Clone e Value Accession Gene Name Organism
AI. Transport and binding proteins for ions and other small molecules
2G2 5e-14 CAGO4534 GM2 ganglioside
activator * Pufferfish
AII. RNA processing, polymerising, splicing and binding proteins
and enzymes
1H1 1e-45 AAH20773 Exosome component 8 Human
2C9 3e-18 XP_391989 Similar to
thickveins Honey bee
15C8 6e-27 CAF93482 G patch domain * Pufferfish
15D4 2e-30 IFS2_D RNA polymerase II
elongation
factor * Human
AIII. Cell replication, histones, DNA polymerases, topoisomerases,
DNA modification
2B6 1e-48 P08991 Historic H2A variant Urchin
15B4 6e-44 AAC47489 Enhancer of
rudimentary Mosquito
15G2 2e-21 CAA28177 Historic H1-beta * Painted urchin
2C7 4e-13 XM_315130 Chief historic H3 *
(2)# Mosquito
AIV. Cytoskeleton and membrane proteins, cellular organisers
1A11 4e-38 NP 990573 Low density
lipoprotein Chicken
1B5 2e-49 CAF21863 Gelsolin Sponge
1D7 1e-108 U30467 Alpha-tubulin Spoon worm
1H7 3e-45 CAD91425 Actin related
protein Oyster
2G1 2e-15 CAG07401 Low density
lipoprotein * Pufferfish
15D9 2e-82 AY026071 Beta-tubulin Choanoflagellate
15D10 2e-43 AF510206 Beta-tubulin Ciliate
AV. Protein synthesis cofactors, tRNA synthetase, ribisomal proteins,
rRNAs
15H3 e-147 AY163259 16S ribosomal RNA
(7)# Tropical abalone
2A7 4e-42 AAN05608 Ribosomal protein
L26 (2)# Scallop
15E5 3e-13 U51989 16S ribosomal RNA
gene (2)# Abalone
2H5 e-105 AY163259 16S ribosomal RNA
(4)# Tropical abalone
2A5 1e-60 AY145418 28S ribosomal RNA
(2)# Abalone
15F5 1e-52 AY588938 Mitochondrion,
complete genome
(2)# Black lip abalone
15C9 8e-97 AY163259 16S ribosomal RNA
(2)# Tropical abalone
1B10 3e-48 AAP33157 Beta-NAC-like
protein Termite
1E3 4e-25 AAC15656 60S ribosomal
protein P2 Chiton
1E10 1e-22 Z18289 16S rRNA gene Red alga
1G4 5e-34 AF120512 18S ribosomal RNA Slit shell
1G10 2e-98 AY588938 Mitochondrion, Black lip abalone
complete genome
2A12 5e-30 X80345 28S ribosomal RNA Aquatic fungus
2B3 2e-11 EAA59486 Eukaryotic initia-
tion factor * Fungi
2E12 4e-98 AY145418 28S ribosomal RNA Abalone
2F7 e-114 AY145418 28S ribosomal RNA Abalone
2H12 2e-42 M98364 Ribosomal RNA Ciliate
15A3 4e-57 AAA70102 40S ribosomal
protein S24 Slime mould
15A4 9e-12 CAG13823 Mitochondrial
ribosomal protein
L27 * Pufferfish
15A7 9e-35 EAA01025 60S ribosomal
protein L6 * Mosquito
15B1 8e-25 AY691376 23S ribosomal RNA Bacteria
15B2 9e-40 AAM94271 Ribosomal protein S2 Scallop
15B7 1e-74 AY588938 Mitochondrion,
complete genome Black lip abalone
15B12 4e-24 BX950290 Ribosomal protein
L38 * Chicken
15E4 4e-66 AAN05595 Ribosomal protein S8 Scallop
15E8 6e-29 AAP21827 Ribosomal protein
S29 Amphioxus
15F10 2e-32 AAH86809 Translation
initiation
factor * Zebrafish
15G9 6e-40 CAG02712 Elongation Factor
Tu * Pufferfish
15G10 5e-70 AB003720 Elongation factor 1 Turbo
AVI. Intermediary metabolism and catabolism enzymes
2D3 6e-17 AY431429 Carboxypeptidase A Mosquito
1C1 2e-26 NP_918077 Putative carboxyme-
thylenebmenolidase Rice
1F4 1e-38 XP_316948 Nudix * Mosquito
1F10 1e-76 CAE70680 Isocitrate dehydro-
genase * Nematode
1H6 3e-27 XP_308198 Pancreatic lipase * Mosquito
15C3 2e-20 CAA93088 Giutathione S-trans-
ferase * Nematode
15G3 9e-11 EAL31332 Maleylacetoacetate
isomerase * Fly
AVII. Stress response, detoxification, and cell defence proteins
15E2 2e-53 YP 026076 Cytochrome b (3)# Black lip abalone
2E5 1e-37 AAR11781 Heat shock protein
90 (2)# Scallop
2E10 1e-15 AAK56498 Putative metallo-
thionein (2)# Periwinkle
15F3 4e-09 AAM20842 SARP-19 precursor
(5)# Periwinkle
1F9 3e-27 CAF99069 Ubiquinol-cytochrome
C * Fish
1G9 1e-14 ZP_00316378 Fucose binding
lectin * Bacteria
2H11 5e-11 EAA03739 UQCRH protein * Mosquito
15B9 1e-25 AAP31550 HSB 1-like protein Fruit fly
AVIII. Protein degradation and processing, proteases
2C2 3e-26 AAH87343 Proteasome 26S
subunit * African clawed
frog
2C4 3e-52 AAH42820 PSMA8 protein Human
2E11 2e-29 XP_394993 Proteasome subunit
beta Honey bee
AIX. Transportation and binding proteins for proteins and other
macromolecules
1B12 1e-67 AAT44866 Translocon-associa-
ted protein (2)# Amphioxus
1B9 6e-14 XP_518767 Heme binding
protein * Chimpanzee
15F6 3e-24 AAH54875 TIMM9 protein Human
AX. Proteins involved in motility including muscle components
15F12 8e-50 XP_537691 Dynein light chain-2 Dog
2F9 1e-10 EAL32148 Myosin II * Fly
BI. Signalling receptors including cytokine and hormone receptors,
and signalling ligands
1A12 2e-13 1744840 FMRF amide Pond snail
1C5 4e-7 AF076823 Lysin precursor Red abalone
1E11 1e-14 NP_001008891 Signal sequence
receptor Rat
2F12 4e-37 AAT00460 Endozepine Carp
BII. Intracellular signal transduction pathway molecules, including
kinases and signal intermediates
15D12 4e-12 EAL51743 Protein kinase Entamoeba
15E1 3e-11 AAD34418 Calmodulin mutant Synthetic
construct
15F11 1e-24 AA062074 Rho-GTPase-
activating protein Mouse
BIII. Extracellular matrix proteins and cell adhesion
2H9 8e-11 Q01528 Aggregation factor Horseshoe crab
CI. Sequence-specific DNA-binding proteins
2A9 7e-10 XP_470396 Putative pirin-like
protein Rice
2C10 2e-19 AAN31640 High mobility group
protein 1 Snail
2F1 5e-38 AAP97158 EVORF Human
Clone e Value Accession Scientific Name
AI. Transport and binding proteins for ions and other small molecules
2G2 5e-14 CAGO4534 T. nigroviridis
AII. RNA processing, polymerising, splicing and binding proteins and
enzymes
1H1 1e-45 AAH20773 H. sapiens
2C9 3e-18 XP_391989 A. mellifera
15C8 6e-27 CAF93482 T. nigroviridis
15D4 2e-30 IFS2_D H. sapiens
AIII. Cell replication, histones, DNA polymerases, topoisomerases,
DNA modification
2B6 1e-48 P08991 S. purpuratus
15B4 6e-44 AAC47489 A. aegypti
15G2 2e-21 CAA28177 L. pictus
2C7 4e-13 XM_315130 A. gambiae
AIV. Cytoskeleton and membrane proteins, cellular organisers
1A11 4e-38 NP 990573 G. gallus
1B5 2e-49 CAF21863 S. ficus
1D7 1e-108 U30467 U. caupo
1H7 3e-45 CAD91425 C. gigas
2G1 2e-15 CAG07401 T. nigroviridis
15D9 2e-82 AY026071 M. brevicollis
15D10 2e-43 AF510206 0.longa
AV. Protein synthesis cofactors, tRNA synthetase, ribisomal proteins,
rRNAs
15H3 e-147 AY163259 H. asinina
2A7 4e-42 AAN05608 A. irradians
15E5 3e-13 U51989 H. diversicolr
2H5 e-105 AY163259 H. asinina
2A5 1e-60 AY145418 H. discus
15F5 1e-52 AY588938 H. rubra
15C9 8e-97 AY163259 H. asinina
1B10 3e-48 AAP33157 R. flavipes
IE3 4e-25 AAC15656 C. stelleri
1E10 1e-22 Z18289 P. palmata
1G4 5e-34 AF120512 S. confusa
1G10 2e-98 AY588938 H. rubra
2A12 5e-30 X80345 H. catenoides
2B3 2e-11 EAA59486 A. nidulans
2E12 4e-98 AY145418 H. discus
2F7 e-114 AY145418 H. discus
2H2 2e-42 M98364 Coleps sp.
15A3 4e-57 AAA70102 D. discoideum
15A4 9e-12 CAG13823 T. nigroviridis
15A7 9e-35 EAA01025 A. gambiae
15B1 8e-25 AY691376 Burkholdera sp.
15B2 9e-40 AAM94271 C. farreri
15B7 1e-74 AY588938 H. rubra
15B12 4e-24 BX950290 G. gallus
15E4 4e-66 AAN05595 A. irradians
15E8 6e-29 AAP21827 B. tsingtaunese
15F10 2e-32 AAH86809 D. rerio
15G9 6e-40 CAG02712 T. nigroviridis
15G10 5e-70 AB003720 B. cornutus
AVI. Intermediary metabolism and catabolism enzymes
2D3 6e-17 AY431429 A. aegypti
lC1 2e-26 NP_918077 O. sativa
1F4 1e-38 XP_316948 A. gambiae
1F10 1e-76 CAE70680 C. elegans
1H6 3e-27 XP_308198 A. gambiae
15C3 2e-20 CAA93088 C. elegans
15G3 9e-11 EAL31332 D. pseudoobscura
AVII. Stress response, detoxification, and cell defence proteins
15E2 2e-53 YP 026076 H. rubra
2E5 1e-37 AAR11781 C. farreri
2E10 1e-15 AAK56498 L. littorea
15F3 4e-09 AAM20842 L. littorea
1F9 3e-27 CAF99069 T. nigroviridis
1G9 1e-14 ZP_00316378 M. degradans
2H11 5e-11 EAA03739 A. gambiae
15B9 1e-25 AAP31550 D. melanogaster
AVIII. Protein degradation and processing, proteases
2C2 3e-26 AAH87343 X. laevis
2C4 3e-52 AAH42820 H. sapiens
2E11 2e-29 XP_394993 A. mellifera
AIX. Transportation and binding proteins for proteins and other
macromolecules
1B12 1e-67 AAT44866 B. tsingtaunese
1B9 6e-14 XP_518767 P. troglodytes
15F6 3e-24 AAH54875 H. sapiens
AX. Proteins involved in motility including muscle components
15F12 8e-50 XP_537691 C. familiaris
2F9 1e-10 EAL32148 D. miranda
BI. Signalling receptors including cytokine and hormone receptors,
and signalling ligands
1A12 2e-13 1744840 L. stagnalis
1C5 4e-7 AF076823 H. rufescens
1E11 1e-14 NP_001008891 R. norvegicus
2F12 4e-37 AAT00460 C. carpio
BII. Intracellular signal transduction pathway molecules, including
kinases and signal intermediates
15D12 4e-12 EAL51743 E. histolytica
15E1 3e-11 AAD34418 x
15F11 1e-24 AA062074 M. musculus
BIII. Extracellular matrix proteins and cell adhesion
2H9 8e-11 Q01528 L. polyphemus
CI. Sequence-specific DNA-binding proteins
2A9 7e-10 XP_470396 O. sativa
2C10 2e-19 AAN31640 B. glabrata
2F1 5e-38 AAP97158 H..sapiens
* Indicates gene names that do not belong to the most significant BLAST
match for that EST. The presented gene name is taken from the next most
significant BLAST match that allowed classification.
Numbers in bold parenthesis represent the total number of clones
in that cluster.
Note: Figures in bold inidcated with #.
TABLE 3.
Prevalence of polyadenylation signals among abalone and human
mRNA transcripts.
Prevalence (%) Prevalence (%)
Polyadenylation and Location (1) in and Location (1) in
Signal Abalone ESTs Human ESTs
AATAAA (55.1) 15.3 [+ or -] 3.9 (58.2) 16 [+ or -] 4.7
ATTAAA (12.3) 19.3 [+ or -] 7.9 (14.9) 17 [+ or -] 5.3
AGTAAA (6.1) 16.7 [+ or -] 1.5 (2.7) 16 [+ or -] 5.9
TATAAA (0.0) (3.2) 18 [+ or -] 7.8
CATAAA (2.0) 13.0 [+ or -] NA (1.3) 17 [+ or -] 5.9
GATAAA (2.0) 18 [+ or -] NA (1.3) 18 [+ or -] 6.9
AATATA (4.1) 18 [+ or -] 1.4 (1.7) 18 [+ or -] 6.9
AATACA (2.0) 24 [+ or -] NA (1.2) 18 [+ or -] 8.7
AATAGA (2.0) 15 [+ or -] NA (0.7) 18 [+ or -] 6.3
AAAAAG (4.1) 22.5 [+ or -] 13.4 (0.8) 18 [+ or -] 8.9
ACTAAA (2.0) 26 [+ or -] NA (0.6) 17 [+ or -] 8.1
GACAAA (2) (2.0) 21 [+ or -] NA --
ATGAAA (2) (4.1) 18 [+ or -] 2.8 --
AGAAAA (2) (2.0) 16 [+ or -] NA --
Total 100% 87%
(1) The location reported here is the position of the sixth nucleotide
of the hexamer relative to the beginning of the poly A tail.
(2) These 3 hexamers were not reported by Beaudoing et al. (2000) but
are included here as they only differ by one nucleotide from recognized
polyadenylation signals, and were located within 30 nucleotides of the
poly A rich 3' region, suggesting that they may be alternative abalone
polyadenylation signals.
|
|
||||||||||||||||||
Printer friendly
Cite/link
Email
Feedback
Reader Opinion