Estradiol and bisphenol a stimulate androgen receptor and estrogen receptor gene expression in fetal mouse prostate mesenchyme cells.BACKGROUND: Hormonal alterations during development have lifelong effects on the prostate gland. Endogenous estrogens Estrogens Hormones produced by the ovaries, the female sex glands. Mentioned in: Acne, Polycystic Ovary Syndrome estrogens (es´trōjenz), n. , including 17[beta]-estradiol ([E.sub.2]), and synthetic estrogenic endocrine disruptors, such as bisphenol A (BPA BPA British Paediatric Association. ), have similar effects on prostate development. Increasing exposure to estrogens within the low-dose, physiologic range results in permanent increases in the size and androgen responsiveness of the prostate, whereas exposure within the high-dose, pharmacologic range has the opposite effects. OBJECTIVES: We tested the hypothesis that the low-dose effects of estrogens on the developing prostate are associated with increased expression of androgen receptor (Ar) and estrogen receptor estrogen receptor A protein of a superfamily of nuclear receptors for small hydrophilic ligands–eg, steroid hormones, thyroid hormone, vitamin D, retinoids; the presence of ERs in breast CA generally is associated with a better prognosis, as they respond to 1 ([alpha]) (Esr1) genes in mesenchyme mesenchyme /mes·en·chyme/ (mez´eng-kim) the meshwork of embryonic connective tissue in the mesoderm from which are formed the connective tissues of the body and the blood and lymphatic vessels. cells. METHODS: Ar and Esr1 mRNA levels were quantified in primary cultures of fetal mouse prostate mesenchyme cells treated with [E.sub.2] and BPA. DISCUSSION: Ar and Esr1 mRNA expression increased in response to [E.sub.2], with thresholds of 0.001 and 0.037 nM, respectively; and in response to BPA, with a threshold of 1 nM for both mRNAs. We did not observe the expected inhibition of Ar mRNA expression by pharmacologic levels of [E.sub.2] relative to unexposed cells. CONCLUSIONS: The observed induction of gene expression occurred at concentrations within the range of free [E.sub.2] previously shown to permanently increase prostate size, thus supporting the involvement of direct effects of estrogens on gene expression in prostate mesenchyme. The effects of BPA occurred within the range of concentrations currently measured in human serum, demonstrating the vulnerability of developing tissues to xenoestrogens. KEY WORDS: 17[beta]-estradiol, androgen receptor gene, bisphenol A, dose-response relationship, estrogen receptor 1 ([alpha]) gene, prostate, sexual differentiation sexual differentiation See Hermaphroditism, hirsutism, Müllerian ducts, Precocious puberty, Pseudoprecocious puberty, Tanner staging, Testis-determining factor, Virilization, Wolffian ducts, XXX, XXY, XXXY, XYY syndromes, Y Chromosome. . Environ Health Perspect 115:902-908 (2007). doi:10.1289/ehp.9804 available via http://dx.doi.org/ [Online 27 February 2007] ********** During fetal life, alterations in normal prostate gland development can produce permanent changes that persist throughout adulthood and may increase the risk of disease in later life (Ho et al. 2006; Risbridger et al. 2005). The prostate differentiates from the cranial cranial /cra·ni·al/ (-al) 1. pertaining to the cranium. 2. toward the head end of the body; a synonym of superior in humans and other bipeds. cra·ni·al adj. region of the urogenital sinus urogenital sinus n. The ventral part of the cloaca after its separation from the rectum, giving rise to the lower part of the bladder in both sexes, to the prostatic portion of the male urethra, and to the urethra and vestibule in the female. (UGS UGS In currencies, this is the abbreviation for the Uganda Shilling. Notes: The currency market, also known as the Foreign Exchange market, is the largest financial market in the world, with a daily average volume of over US $1 trillion. ) (Marker et al. 2003). In humans, the first epithelial buds are observed in the lateral region lateral region n. The region of the abdomen lying on either side of the umbilical region and between the hypochondriac and inguinal regions. of the UGS during the tenth week of gestation in a pattern that shows a remarkable similarity to that of bud development in mice and rats during the early phase of gland genesis (Timms et al. 1994). Prostate ductal budding begins on gestation day (GD) 17 in mice (2 days before birth) (Timms et al. 1994). Prostate development is dependent on 5[alpha]-dihydrotestosterone (DHT (Distributed Hash Table) A method for storing hash tables in geographically distributed locations in order to provide a failsafe lookup mechanism for distributed computing. ) production from testosterone within the UGS mesenchyme (Marker et al. 2003). Androgen receptor expression in prostatic mesenchyme is required for directing growth and branching morphogenesis morphogenesis /mor·pho·gen·e·sis/ (mor?fo-jen´e-sis) the evolution and development of form, as the development of the shape of a particular organ or part of the body, or the development undergone by individuals who attain the type to of epithelial buds, presumably pre·sum·a·ble adj. That can be presumed or taken for granted; reasonable as a supposition: presumable causes of the disaster. by induction of paracrine paracrine /para·crine/ (par´ah-krin) 1. denoting a type of hormone function in which hormone synthesized in and released from endocrine cells binds to its receptor in nearby cells and affects their function. 2. factors secreted by mesenchyme (Cunha and Donjacour 1987; Kokontis and Liao 1999). During development, prostatic epithelial cells Epithelial cells Cells that form a thin surface coating on the outside of a body structure. Mentioned in: Corneal Transplantation exhibit little androgen binding, and androgen receptor protein expression in epithelium is not required for differentiation (Cunha and Donjacour 1987; Prins and Birch 1995; Timms et al. 1999). Therefore, fetal mouse UGS mesenchyme cells provide an informative model of endocrine control of prostate development. There is now considerable evidence that estrogens modulate the activity of androgens in regulating prostate development. The UGS mesenchyme in mice and rats responds to estrogens via estrogen receptor 1 ([alpha]), whereas in the human prostate estrogen receptor 2 ([beta]) may mediate most responses to estrogens during development (Adams et al. 2002; Prins et al. 1998). Prostatic growth and androgen receptor ligand-binding activity are permanently decreased in response to high, pharmacologic doses of both natural and xenobiotic xen·o·bi·ot·ic adj. Foreign to the body or to living organisms. Used of chemical compounds. n. A xenobiotic chemical. xenobiotic any substance, harmful or not, that is foreign to the animal's biological system. estrogens during development (Prins and Birch 1995; Rajfer and Coffey 1978; vom Saal et al. 1997). In contrast, increases in prenatal estrogen levels within the physiologic range (the normal range for endogenous estradiol) stimulate prostate development, leading to permanently increased prostate size and androgen receptor ligand-binding activity (Gupta 2000; Timms et al. 1999; vom Saal et al. 1997). Estrogenic endocrine disruptors have the potential to alter prostate development in a manner similar to that of endogenous estradiol. In this study, we chose to examine bisphenol A (BPA), the monomer used to make polycarbonate A category of plastic materials used to make a myriad of products, including CDs and CD-ROMs. plastic and as an additive in many other plastic products. BPA is produced in excess of 6 billion pounds per year, and the potential for human exposure is great due to leaching from plastic and plasticlined metal food and beverage F&B is a common abbreviation in the United States and Commonwealth countries, including Hong Kong. F&B is typically the widely accepted abbreviation for "Food and Beverage," which is the sector/industry that specializes in the conceptualization, the making of, and delivery of foods. containers, as well as from dental sealants (Takao et al. 2002; Welshons et al. 2006). We have proposed that one mechanism by which fetal estrogen exposure stimulates prostate development is by increasing prostatic androgen receptor gene [Ar; GenBank accession no. X53779 (Benson et al. 2007)] expression, thereby increasing the androgen responsiveness of the developing prostate, leading to enhanced gland genesis and growth (Richter et al. 2005; vom Saal et al. 1997). In the present study we sought to determine whether the endogenous hormone 17[beta]-estradiol ([E.sub.2]), within its physiologic range, and the manmade estrogenic endocrine disruptor BPA, within the range measured in human serum (Schonfelder et al. 2002), directly influence Ar and estrogen receptor 1 ([alpha]) (Esr1; GenBank accession no. NM_007956.2) gene expression at the transcriptional level in fetal mouse UGS mesenchyme. Materials and Methods Animals, housing, mating, and organ collection. CD-1 mice were purchased from Charles River Laboratories (Wilmington, MA) and bred at the University of Missouri in a facility accredited accredited recognition by an appropriate authority that the performance of a particular institution has satisfied a prestated set of criteria. accredited herds cattle herds which have achieved a low level of reactors to, e.g. by the Association for Assessment and Accreditation of Laboratory Animal Care. Animals were housed on corncob bedding in standard polypropylene cages. They received water purified by ion exchange ion exchange n. A reversible chemical reaction occurring between an insoluble solid and a solution during which ions may be interchanged, used in the separation of radioactive isotopes. and carbon filtration from glass bottles. Pregnant and lactating lac·tate 1 intr.v. lac·tat·ed, lac·tat·ing, lac·tates To secrete or produce milk. [Latin lact females were fed Purina 5008 chow (Purina Mills, St. Louis, MO). After being weaned, animals were fed Purina 5001 chow (Ralston Purina). Rooms were maintained at 25 [+ or -] 2[degrees]C under a 12 hr:12 hr light:dark cycle. Animals were treated humanely and with regard for alleviation of suffering. Animal procedures were approved by the University of Missouri Animal Care and Use Committee and conformed to the NIH "Not invented here." See digispeak. NIH - The United States National Institutes of Health. Guide for the Care and Use of Laboratory Animals (Institute of Laboratory Animal Resources 1996). Tissue collection, primary cell culture, and dosing. Timed-pregnant females were killed on GD17 (mating = GD0) by C[O.sub.2] asphyxiation asphyxiation /as·phyx·i·a·tion/ (as-fix?e-a´shun) suffocation; the stoppage of respiration. Asphyxiation Oxygen starvation of tissues. , and fetuses were removed from the uterine horns. The bladder and UGS were removed from male fetuses as previously described (Timms et al. 1999; vom Saal et al. 1997). The prostatic region of the UGS was removed from the bladder at the bladder neck Bladder neck The place where the urethra and bladder join. Mentioned in: Urinary Incontinence , and mesenchymal cells were isolated as described by Gupta (1999). Briefly, UGS tissue was disrupted by digestion with 3 mg collagenase collagenase /col·la·ge·nase/ (kah-laj´e-nas) an enzyme that catalyzes the hydrolysis of peptide bonds in triple helical regions of collagen. col·lag·e·nase n. type I/mL (Sigma Chemical Co., St. Louis, MO) for 30-50 min at 37[degrees]C in a shaking water bath followed by manual pipetting. Clumps of epithelium were allowed to settle out, and suspended mesenchymal cells were collected and cultured in complete medium [RPMI-1640 without phenol red phenol red n. A bright to dark red, water-soluble crystalline dye used as an acid-base indicator and to test kidney function and renal blood flow. Also called phenolsulfonphthalein. (Gibco, Grand Island, NY) supplemented with 2 mM L-glutamine, 100 U penicillin G penicillin G n. The most commonly used penicillin compound, used primarily in the form of its stable salts. Also called benzylpenicillin. sodium/mL, 100 mg streptomycin streptomycin (strĕp'tōmī`sĭn), antibiotic produced by soil bacteria of the genus Streptomyces and active against both gram-positive and gram-negative bacteria (see Gram's stain), including species resistant to other sulfate/mL, and 0.25 mg fungizone/mL] with 10% (vol/vol) fetal bovine serum Fetal bovine serum ( or foetal bovine serum) is serum taken from the fetuses of cows. Fetal Bovine Serum (or FBS) is the most widely used serum in the culturing of cells. In some papers the expression foetal calf serum is used. (FBS FBS abbr. fasting blood sugar FBS Fasting blood sugar. See Fasting glucose. ; U.S. Bio-Technologies, Parkerford, PA). Cells were grown to 95% confluence and then passaged by digestion with 0.05% trypsin trypsin, enzyme that acts to degrade protein; it is often referred to as a proteolytic enzyme, or proteinase. Trypsin is one of the three principal digestive proteinases, the other two being pepsin and chymotrypsin. in 0.53 mM EDTA EDTA: see chelating agents. (Gibco) for 5 min at room temperature. Cell viability was assayed with alamarBlue (BioSource International, Camarillo, CA) according to the manufacturer's instructions. We characterized the cell-type composition of the UGS cell primary cultures by immunofluorescent staining of cytokeratins with mouse anti-pan-cytokeratin clone PCK-26 fluorescein isothiocyanate conjugate conjugate /con·ju·gate/ (kon´jdbobr-gat) 1. paired, or equally coupled; working in unison. 2. a conjugate diameter of the pelvic inlet; used alone usually to denote the true conjugate diameter; see (Sigma), and co-staining of the mesenchymal cell marker vimentin with goat anti-vimentin (Sigma) and rabbit anti-goat Cy3 conjugate (Sigma) (Prins et al. 1991). During experimental treatments with [E.sub.2], BPA, tamoxifen tamoxifen (təmŏk`sĭfĕn'), synthetic hormone used in the treatment of breast cancer. Introduced in 1978, tamoxifen is used to prevent recurrences of cancer in women who have already undergone surgery to remove their tumors. , and raloxifene, FBS was charcoal-stripped to remove all hormones, and cells were maintained in a constant background of 690 pM DHT (200 pg/mL). Cells were treated with DHT rather than testosterone to control for potential treatment effects on the intracellular concentration of this high-affinity ligand for the androgen receptor, which is formed from testosterone in UGS mesenchyme cells in vivo in vivo /in vi·vo/ (ve´vo) [L.] within the living body. in vi·vo adj. Within a living organism. in vivo adv. , and also to avoid the intracellular metabolism of testosterone to [E.sub.2] by aromatase; DHT is not a substrate for aromatase (Kokontis and Liao 1999). First passage cells were seeded onto 24-well plates at 7 x [10.sup.4] cells/well in estrogen-free complete medium with 5% (vol/vol) charcoal-stripped FBS, 5% (vol/vol) charcoalstripped horse serum (Sigma), 690 pM DHT (Steraloids, Wilton, NH), and ITS supplement (insulin-transferrin-selenium; Cambrex, Walkersville, MD) for final concentrations of 10 [micro]g insulin/mL, 10 [micro]g transferrin/mL, and 10 ng selenium/mL. Cells were maintained in this estrogen-free medium for 3 days, with one medium change, before the start of treatments. [E.sub.2], BPA, and tamoxifen were obtained from Sigma. Raloxifene (LY 156,758) was obtained from Eli Lilly (Indianapolis, IN). During treatments with [E.sub.2] and BPA, cells were grown for 4 days, and the medium was changed every day, except where noted. The concentration of [E.sub.2] in culture medium during treatments was measured by radioimmunoassay as previously described by vom Saal et al. (1990). Real time RT-PCR RT-PCR reverse transcriptase-polymerase chain reaction. See PCR1. measurement of gene expression. Total RNA RNA: see nucleic acid. RNA in full ribonucleic acid One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic was isolated with the RNAqueous kit (Ambion, Austin, TX) according to the manufacturer's instructions. Total RNA was quantified by absorbance absorbance /ab·sor·bance/ (-sor´bans) 1. in analytical chemistry, a measure of the light that a solution does not transmit compared to a pure solution. Symbol . 2. at 260 nm. Expression of specific mRNAs were measured by one-step real-time reverse transcription-polymerase chain reaction (RT-PCR) as described by Bustin (2000), with the TaqMan EZ RT-PCR kit (PE Applied Biosystems, Foster City, CA) on the ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother. (Application Binary Interface) A specification for a specific hardware platform combined with the operating system. PRISM 7700 Sequence Detection System (PE Applied Biosystems). The concentrations of [Mn.sup.2+], probe, and primers were optimized for each primer/probe set. Primer/probe sets for Ar, vimentin (Vim; GenBank accession no. NM_011701.3), and acidic ribosomal phosphoprotein phosphoprotein /phos·pho·pro·tein/ (-pro´ten) a conjugated protein in which phosphoric acid is esterified with a hydroxy amino acid. phos·pho·pro·tein n. P0 (Arbp; GenBank accession no. NM_007475.2) were designed using Primer Express software (PE Applied Biosystems) and are shown in Table 1. Primers were designed to span exon Exon In split genes, a portion that is included in the ribonucleic acid (RNA) transcript of a gene and survives processing of the RNA in the cell nucleus to become part of a spliced messenger RNA (mRNA) or structural RNA in the cell cytoplasm. boundaries in order to prevent amplification of genomic DNA. Primers were synthesized by Invitrogen (Carlsbad, CA), and probes were synthesized by PE Applied Biosystems. The primer/probe set for Esr1 was TaqMan Gene Expression Assay ID Mm00433149_m1 (PE Applied Biosystems), which spans Esr1 exons 3-4. The relative concentrations of specific mRNAs in each sample were normalized to total RNA per well, as described by Bustin (2000) and Latil et al. (2001). Normalization In relational database management, a process that breaks down data into record groups for efficient processing. There are six stages. By the third stage (third normal form), data are identified only by the key field in their record. to total RNA allowed for comparisons between independent experiments. In parallel experiments, total DNA DNA: see nucleic acid. DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. per well was measured by fluorescence of Hoechst 33258 (Sigma), as described by Labarca and Paigen (1980). From these data, the average RNA/DNA ratio was calculated for each treatment; we used these values to convert the mRNA/total RNA measurements to mRNA/DNA to assess the effect of [E.sub.2] and BPA on gene expression per cell. Statistical analyses. Treatments were replicated in three wells per experiment and at least two, and in most cases more (up to 10), replicate experiments. Outliers were detected with Grubbs' test (Grubbs 1969) and removed. Treatment effects were evaluated on untransformed data for RNA, and on reciprocals for DNA and gene expression, with the analysis of variance (ANOVA anova see analysis of variance. ANOVA Analysis of variance, see there ) general linear model procedure using SAS (1) (SAS Institute Inc., Cary, NC, www.sas.com) A software company that specializes in data warehousing and decision support software based on the SAS System. Founded in 1976, SAS is one of the world's largest privately held software companies. See SAS System. software (SAS Institute Inc., Cary, NC). We made planned comparisons of means for each treatment relative to controls using the least-squares means test only if the overall ANOVA showed significant treatment effects. To avoid inflation of error rates, we did not use multiple comparisons among all treatments. The criterion for statistical significance was p < 0.05. Results Characterization of UGS cells and nominal [E.sub.2] concentration in primary culture. Consistent with previous reports (Gupta 1999), immunofluorescent staining for the mesenchymal cell marker vimentin revealed no epithelial cells in first passage cells treated for 5 days with 0.1 nM [E.sub.2] or with no [E.sub.2] (data not shown). The UGS primary cell cultures that we examined were thus homogenous homogenous - homogeneous populations of mesenchyme cells that retained mesenchymal differentiation markers throughout the incubation period incubation period n. 1. See latent period. 2. See incubative stage. Incubation period . After the initial administration of [E.sub.2] in culture medium, the [E.sub.2] concentration slowly decreased, presumably by metabolism, sequestration sequestration In law, a writ authorizing a law-enforcement official to take into custody the property of a defendant in order to enforce a judgment or to preserve the property until a judgment is rendered. in cells, and/or binding to the tissue culture dish. In more detail, [E.sub.2] was administered at a concentration of 1 nM, in the middle of the dose range in our experiment. The concentration of [E.sub.2] in medium decreased by 2 hr to approximately 90% and by 18 hr to approximately 60% of the administered dose, and then remained stable through the remaining time period examined (up to 48 hr). In the experiments we conducted, test chemicals were added to medium every 24 hr. Thus, at the midpoint mid·point n. 1. Mathematics The point of a line segment or curvilinear arc that divides it into two parts of the same length. 2. A position midway between two extremes. of the dose-response curve tested, the actual [E.sub.2] concentration in the culture medium was approximately 60% of the initial concentration at the time we collected the cells for analysis of mRNA. Measurement of DNA and RNA content and induction of gene expression confirmed that bioactive amounts of [E.sub.2] were thus present at nominal concentrations < 0.001 nM (Figures 1 and 2). [E.sub.2] induces growth of UGS mesenchyme cells. [E.sub.2] treatment induced a small increase in cell growth and proliferation as indicated by DNA and RNA content at doses of 0.01-10,000 nM (Figure 1A, 1B). At 100,000 nM [E.sub.2], inhibition of cell growth and proliferation was observed (Figure 1A, 1B). Cell viability was not affected at any [E.sub.2] dose tested (data not shown). Subsequent experiments used a dose range of 0.0001-10,000 nM in order to avoid the cell growth-inhibiting effects of very high doses of [E.sub.2]. Relative total RNA was induced to a greater degree than DNA (Figure 1A, 1B). The housekeeping genes Vim, a component of the cytoskeleton cytoskeleton System of microscopic filaments or fibres, present in the cytoplasm of eukaryotic cells (see eukaryote), that organizes other cell components, maintains cell shape, and is responsible for cell locomotion and for movement of the organelles within it. in mesenchyme cells, and Arbp, a component of the ribosome ribosome: see cell; nucleic acid. ribosome Tiny particle, the site of protein synthesis, that is present in large numbers in living cells. They occur both as free particles within cells and, in eukaryotes, as particles attached to the membranes of , were examined to determine whether either could be used as a reference gene. However, both of these genes increased expression in response to [E.sub.2], consistent with a general induction of cell growth (Figure 1C, 1D). Vimentin and acidic ribosomal phosphoprotein P0 exhibited differently shaped dose-response curves, suggesting differences in their mechanisms of transcriptional regulation by [E.sub.2]. Because neither housekeeping gene was an appropriate control gene, expression of specific mRNAs was normalized to DNA. [E.sub.2] induces the steroid receptor mRNAs Ar and Esr1. Ar mRNA expression was induced by [E.sub.2] up to just over 2-fold above control levels (Figure 2A). The observed threshold of induction, 0.001 nM, is slightly higher than the measured free serum [E.sub.2] concentration of 0.00077 nM or 0.21 pg/mL in male mouse fetuses on GD18 (vom Saal et al. 1997). The increase in Ar mRNA with [E.sub.2] dose was monotonic monotonic - In domain theory, a function f : D -> C is monotonic (or monotone) if for all x,y in D, x <= y => f(x) <= f(y). ("<=" is written in LaTeX as \sqsubseteq). up to 100 nM [E.sub.2]. At doses of [greater than or equal to] 1,000 nM [E.sub.2], Ar mRNA levels declined relative to the maximum observed induction at 100 nM [E.sub.2]. Inhibition of cell growth was only evident at 100,000 nM [E.sub.2]. The induction of Ar mRNA by a physiologically relevant level of [E.sub.2], 0.037 nM (10 pg/mL), was significantly inhibited by antiestrogen treatment (Figure 3A). The antiestrogen raloxifene (100 nM) had similar effects to 100 nM tamoxifen (raloxifene data not shown). The inhibition of the Ar response to [E.sub.2] by tamoxifen was overcome by addition of a pharmacologic dose of 100 nM [E.sub.2], demonstrating that the inhibition by tamoxifen observed at 0.037 nM [E.sub.2] is not due to cytotoxicity or other nonspecific effects (Figure 3A). Esr1 mRNA expression was induced by [E.sub.2] by approximately 3-fold over the control, with a threshold at 0.037 nM (Figure 3B) and a peak at 10-100 nM [E.sub.2] (Figure 2B). The induction of Esr1 mRNA by 0.037 nM [E.sub.2] was not significantly inhibited by antiestrogen treatment (Figure 3B). BPA acts as an estrogen agonist in UGS mesenchyme cells. The effects of BPA on cell growth as indicated by DNA and RNA content (Figure 4) were much less pronounced than the effects of [E.sub.2] (Figure 1). The dose-response curve for RNA was biphasic bi·pha·sic adj. Having two distinct phases: a biphasic waveform; a biphasic response to a stimulus. , with significant reductions in RNA content, but not DNA, at very low concentrations of BPA (Figure 4). Ar and Esr1 mRNA expression were induced by BPA treatment (Figure 5). The dose-response curves for BPA were shifted to the right by approximately 1,000-fold for Ar and approximately 30-fold for Esr1, relative to [E.sub.2] (based on the significant stimulation of Esr1 in response to 0.037 nM [E.sub.2]; Figure 3B). As indicated in Figure 5A and 5B, a significant increase in both Ar and Esr1 transcription occurred at BPA concentrations within the range typically reported in human blood and tissues, including fetal blood (Schonfelder et al. 2002; Welshons et al. 2006). The induction of both Ar and Esr1 mRNAs by a physiologically relevant low dose of BPA (10 nM) was inhibited by a 100-nM dose of tamoxifen. For both genes, the inhibition by tamoxifen was overcome by a high dose of BPA (1,000 nM) (Figure 6). Discussion The aims of the present study were to investigate whether there were direct effects on Ar and Esr1 gene activity that could be related to the previously observed stimulatory effect on prostate development caused by prenatal exposure to serum concentrations of bioactive [E.sub.2] in fetal mice and the concentration of bioactive BPA currently measured in human fetal serum. We found that both the natural estrogen [E.sub.2] and the synthetic estrogenic endocrine disruptor BPA stimulated increases in prostate Ar and Esr1 mRNAs. The stimulation occurred at physiologically relevant part-per-trillion doses of [E.sub.2], and at parts-perbillion doses of BPA, which are within the range found in human fetal blood (reviewed by Welshons et al. 2006). Exposure of male mouse and rat fetuses to slightly elevated estrogen levels results in permanent prostate enlargement and elevated androgen receptor levels in adulthood (Timms et al. 1999; vom Saal et al. 1997). Some confusion concerning effects of estrogen on the prostate has been created by studies in which only very high, pharmacologic (supraphysiologic) doses of estrogen were tested. Effects of pharmacologic doses of estrogenic chemicals on prostate development are not predictive of effects at physiologic doses. The dramatic effects of physiologic doses of estrogens have been revealed in studies in which pregnant mice were administered low doses of [E.sub.2], the drugs diethylstilbestrol diethylstilbestrol: see DES. (DES) and ethinylestradiol, BPA, or the estrogenic insecticide methoxychlor methoxychlor one of the group of chlorinated hydrocarbon insecticides which cause typical signs of that poisoning. , resulting in a permanent increase in prostate size in male offspring (Gupta 2000; Nagel et al. 1997; Thayer et al. 2001; vom Saal et al. 1997; Welshons et al. 1999). As the dose of [E.sub.2] or DES was increased into the pharmacologic range, the stimulating effect observed at low doses disappeared and inhibition of prostate development occurred (Gupta 2000; Timms et al. 2005; vom Saal et al. 1997). Thus, the inhibitory effects of pharmacologic doses of estrogens on the developing prostate are opposite to effects of physiologic doses of the same estrogenic chemicals. Available data on short-term effects of developmental estrogen exposures are consistent with the long-term effects observed in adulthood. For example, a high, pharmacologic dose of estradiol benzoate given to neonatal rats induced down-regulation of androgen receptor protein expression as early as postnatal postnatal /post·na·tal/ (-na´t'l) occurring after birth, with reference to the newborn. post·na·tal adj. Of or occurring after birth, especially in the period immediately after birth. day (PND (Personal Navigation Device) A portable GPS-based navigation system that can be used when walking, hiking or in any vehicle. See GPS. ) 6 (Prins and Birch 1995). In contrast, low, physiologically relevant doses of estrogenic chemicals (DES and BPA) fed to pregnant mice induced up-regulation of prostatic androgen receptor ligand binding activity in male offspring as early as PND3; this observation was replicated in organ culture of fetal mouse prostate treated with 0.1 pg/mL DES or 50 pg/mL BPA (Gupta 2000). The increase in prostate size in response to 50 pg/mL (0.22 nM) BPA in organ culture is below the threshold observed for stimulation of either Ar or Esr1 gene expression observed in the present study. Our findings support the hypothesis that prenatal exposure to elevated estrogen levels permanently increases prostate size and androgen responsiveness at least in part by inducing Ar mRNA expression. Importantly, the effects on Ar mRNA expression occurred with a threshold at 0.001 nM [E.sub.2] (0.28 pg/mL), consistent with concentrations previously shown to alter prostate development in vivo. Specifically, the total serum [E.sub.2] concentration in male mouse fetuses on GD18 is approximately 0.35 nM (94 pg/mL), and the free (unconjugated and unbound unbound said of electrolytes, e.g. iron and calcium, and other substances which are circulating in the bloodstream and are not bound to plasma proteins so that they are available immediately for metabolic processes. See also calcium, iron. to plasma proteins) serum concentration of [E.sub.2] is 0.00077 nM (0.21 pg/mL), or 0.2% of total serum [E.sub.2] (vom Saal et al. 1997), similar to findings in rats (Montano et al. 1995). An increase in free serum [E.sub.2] in male mouse fetuses (due to maternal administration of [E.sub.2] via Silastic Silastic /Si·las·tic/ (si-las´tik) trademark for polymeric silicone substances that have the properties of rubber but are biologically inert; used in surgical prostheses. capsule) to 0.0012 nM (0.31 pg/mL) significantly increased prostate size and the number of prostatic androgen receptors in adulthood (vom Saal et al. 1997). Our results show that at these same physiologic doses, [E.sub.2] acts directly on fetal UGS mesenchyme cells to increase Ar mRNA expression. This response was inhibited by the antiestrogens raloxifene (data not shown) and tamoxifen (Figure 3), suggesting that the induction of Ar mRNA by [E.sub.2] is mediated through the classical genomic estrogen receptor pathway. The differences in the shapes of the dose-response curves for Ar and Esr1 suggest that the receptors are regulated by distinct mechanisms. Distinct dose-response relationships were also noted for vimentin, acidic ribosomal protein P0, total RNA content, and DNA content. These findings are consistent with data from microarray studies demonstrating considerable diversity in dose-response relationships of different estrogen-responsive genes; in particular, as one moves across the dose-response curve, entirely different sets of genes are activated or inhibited (Coser et al. 2003; Shioda et al. 2006). Induction of Ar and Esr1 also displayed different responses to inhibition by antiestrogens, in that Esr1 induction was not significantly inhibited by antiestrogen cotreatment (Figure 3). The threshold for effects on Esr1 expression was between 0.01 nM (2.3 ng/mL) and 0.037 nM (8.4 ng/mL) [E.sub.2] (Figures 2B and 3B). This is above the normal range of free [E.sub.2] in serum in male mouse fetuses. However, serum estradiol may underestimate estrogen levels in prostate tissue because cells in the developing prostate express aromatase, which metabolizes testosterone to [E.sub.2] (Ellem and Risbridger 2006; Risbridger et al. 2003), and because estrogen receptor agonists, including xenoestrogens, exhibit additive effects in combination (Rajapakse et al. 2002). The induction of Esr1 expression by [E.sub.2] suggests that estrogen exposure may create a positive feedback loop in the UGS, such that exposure to estrogens increases sensitivity to future or continuing exposure. Although the observed effects of physiologic concentrations of [E.sub.2] on Ar mRNA expression are consistent with established in vivo effects, our pharmacologic dose range (e.g., 100 nM) in vitro observations are not consistent with established in vivo effects (Gupta 2000; Prins and Birch 1995; vom Saal et al. 1997), which predicted a decline in Ar mRNA expression relative to control levels at this high dose of [E.sub.2] (Figure 2A). The in vivo regulation of androgen receptors by pharmacologic doses of estrogens may thus involve systemic and posttranscriptional post·tran·scrip·tion·al adj. Of or relating to a substance or process, such as splicing, that occurs or is formed after transcription of RNA: posttranscriptional modification of RNA. effects that are not observable in terms of Ar mRNA levels in isolated mesenchyme cells. The involvement of posttranscriptional mechanisms is supported by the observation that developmental exposure to pharmacologic doses of estrogens permanently up-regulates androgen receptor degradation by the proteasome Proteasomes are large protein complexes inside all eukaryotes and archaea, as well as in some bacteria. In eukaryotes, they are located in the nucleus and the cytoplasm.[1] (Woodham et al. 2003). The behavior of BPA in this system is consistent with the established activity of BPA as an estrogen receptor agonist (reviewed by vom Saal and Hughes 2005; vom Saal and Welshons 2006; Welshons et al. 2006), which was first reported in 1936 (Dodds and Lawson). The weak effects of BPA on cell growth, measured as DNA and RNA content, are consistent with previous reports that the relative potency of BPA is greater in stimulating estrogen receptor-dependent gene transcription than in stimulating growth of uterine tissue (Nagel et al. 2001). There are several interesting differences between the dose-response curves of Ar and Esr1 in response to BPA compared with [E.sub.2]. Based on the thresholds of induction of gene expression, BPA is approximately 1,000-fold less potent than [E.sub.2] for induction of Ar, but only about 30-fold less potent than [E.sub.2] for induction of Esr1 (based on a threshold of Esr1 induction of 0.037 nM [E.sub.2]; Figure 3B). In addition, the shape of the dose-response curve for Esr1 differs between [E.sub.2] and BPA; induction of Esr1 by BPA was inhibited by tamoxifen, whereas induction of Esr1 by [E.sub.2] was not significantly inhibited by tamoxifen. These differences between [E.sub.2] and BPA, which are seen in the Esr1 dose-response curves but not the Ar dose-response curves, underline the probability that distinct mechanisms are at work in the induction of Ar and Esr1 by estrogens. Of great importance, the doses of BPA required for induction of both Ar and Esr1 are within the range of typical levels of BPA measured in human serum, which range from approximately 1 to 10 nM (Figure 5) (Schonfelder et al. 2002; Welshons et al. 2006). Because our experiments measured the response to BPA in the absence of other estrogens, they are likely to underestimate the induction of Ar and Esr1 expression in response to the additive mixture of endogenous estrogens, BPA, and other xenoestrogens to which humans are continuously exposed in our modern world (Colborn et al. 1993). The consequences of developmental induction of Ar and Esr1 for the adult phenotype of the prostate have not been directly examined, but exposure during fetal life to very low doses of BPA (2-50 [micro]g/kg/day) permanently increases prostate size in mice (Gupta 2000; Nagel et al. 1997). Neonatal exposure to a 10 [micro]g/kg/day dose of BPA results in precancerous precancerous /pre·can·cer·ous/ (-kan´ser-us) pertaining to a pathologic process that tends to become malignant. pre·can·cer·ous adj. lesions (prostate interepithelial neoplasia neoplasia /neo·pla·sia/ (-pla´zhah) the formation of a neoplasm. cervical intraepithelial neoplasia ) in adult male rats, associated with epigenetic epigenetic /epi·ge·net·ic/ (-je-net´ik) 1. pertaining to epigenesis. 2. altering the activity of genes without changing their structure. changes (Ho et al. 2006). The report of Ho et al. (2006) is consistent with the finding that estrogenic chemicals stimulate an abnormal rate of proliferation in basal epithelial cells in the primary ducts of the mouse fetal prostate (Timms et al. 2005). Basal cells are progenitor cells proposed to be involved in prostate cancer (Kirschenbaum et al. 2006). We are currently examining whether the permanent increase in prostate AR receptor protein in mice exposed during fetal life to low doses of estrogenic chemicals is caused by a permanent increase in expression of the Ar gene, and whether this is associated with a change in DNA methylation at the Ar gene. Conclusions Ar mRNA in mesenchyme cells isolated from fetal mouse prostate is up-regulated by [E.sub.2] within its physiologic range, and by BPA within the range detected in human fetal serum. Induction of Ar mRNA by [E.sub.2] or BPA was inhibited by antiestrogen co-treatment. Therefore, the low-dose effects of estrogens on prostatic Ar regulation are estrogen receptor -dependent, act at the transcriptional level, are mediated through local effects on UGS mesenchyme cells, and can be modeled in a primary cell culture system. In contrast, down-regulation of androgen receptor protein in response to high doses of estrogens in vivo likely includes systemic and post-transcriptional mechanisms. Esr1 mRNA is also upregulated by [E.sub.2] and BPA in a dose-dependent manner, suggesting the possibility of positive feedback in estrogen effects on the prostate. The induction of Esr1 by [E.sub.2] is not significantly inhibited by antiestrogen treatment, suggesting the involvement of non-estrogen receptor-mediated mechanisms. Taken together, these results are consistent with the hypothesis that prenatal exposure to elevated estrogen or xenoestrogen levels within the physiologic range results in an increase in androgen receptor and estrogen receptor 1 ([alpha]) number in the developing prostate mesenchyme, which increases androgen and estrogen responsiveness and growth. The estrogen receptor-dependent induction of Ar by BPA confirms that this mechanism is not unique to [E.sub.2] and underscores the vulnerability of the developing reproductive system to the additive effects of exogenous estrogenic endocrine disruptors. REFERENCES Adams JY, Leav I, Lau KM, Ho SM, Pflueger SMV SMV abbr. slow-moving vehicle . 2002. Expression of estrogen receptor beta in the fetal, neonatal, and prepubertal prepubertal /pre·pu·ber·tal/ (-pu´ber-tal) before puberty; pertaining to the period of accelerated growth preceding gonadal maturity. human prostate. Prostate 52:69-81. Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, Wheeler DL. 2007. GenBank. Nucleic Acids Res 35:D21-D25. Bustin SA. 2000. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction “RT-PCR” redirects here. For real-time polymerase chain reaction, also called quantitative real time polymerase chain reaction or kinetic polymerase chain reaction, see real-time polymerase chain reaction. assays. J Mol Endocrinol 25:169-193. Colborn T, vom Saal FS, Soto AM. 1993. Developmental effects of endocrine disrupting chemicals in wildlife and humans. Environ Health Perspect 101:378-384. Coser KR, Chesnes J, Hur JY, Ray S, Isselbacher KJ, Shioda T. 2003. Global analysis of ligand sensitivity of estrogen inducible and suppressible genes in MCF7/BUS breast cancer cells by DNA microarray. Proc Natl Acad Sci USA 100:13994-13999. Cunha GR, Donjacour A. 1987. Stromal-epithelial interactions in normal and abnormal prostatic development. In: Current Concepts and Approaches to the Study of Prostate Cancer, Vol 239 (Coffey DS, Gardner WAJ WAJ Western Automotive Journalists WAJ What A Joke , Bruchovsky N, Resnick MI, Karr JP, eds). New York:Alan R. Liss, Inc., 251-272. Dodds EC, Lawson W. 1936. Synthetic oestrogenic oestrogenic (ōˈ·es·tr agents without the phenanthrene phenanthrene /phe·nan·threne/ (fe-nan´thren) a tricyclic aromatic hydrocarbon occurring in coal tar; toxic and carcinogenic. phe·nan·threne n. nucleus. Nature 137:996. Ellem SJ, Risbridger GP. 2006. Aromatase and prostate cancer. Minerva Endocrinol 31:1-12. Grubbs FE. 1969. Procedures for detecting outlying observations in samples. Technometrics 11:1-21. Gupta C. 1999. Modulation of androgen receptor (AR)-mediated transcriptional activity by EGF EGF abbr. epidermal growth factor in the developing mouse reproductive tract primary cells. Mol Cell Endocrinol 152:169-178. Gupta C. 2000. Reproductive malformation malformation /mal·for·ma·tion/ (-for-ma´shun) 1. a type of anomaly. 2. a morphologic defect of an organ or larger region of the body, resulting from an intrinsically abnormal developmental process. of the male offspring following maternal exposure to estrogenic chemicals. Proc Soc Exp Biol Med 224:61-68. Ho SM, Tang WY, Belmonte de Frausto JB, Prins GS. 2006. Developmental exposure to estradiol and bisphenol A increases susceptibility to prostate carcinogenesis car·ci·no·gen·e·sis n. The production of cancer. carcinogenesis production of cancer. biological carcinogenesis viruses and some parasites are capable of initiating neoplasia. and epigenetically regulates phosphodiesterase phosphodiesterase /phos·pho·di·es·ter·ase/ (-di-es´ter-as) any of a group of enzymes that catalyze the hydrolytic cleavage of an ester linkage in a phosphoric acid compound containing two such ester linkages. type 4 variant 4. Cancer Res 66:5624-5632. Institute of Laboratory Animal Resources. 1996. Guide for the Care and Use of Laboratory Animals. Washington, DC:National Academy Press. Kirschenbaum A, Liu XH, Yao S, Narla G, Friedman SL, Martignetti JA, et al. 2006. Sex steroids have differential effects on growth and gene expression in primary human prostatic epithelial cell cultures derived from the peripheral versus transition zones. Carcinogenesis 27:216-224. Kokontis JM, Liao S. 1999. Molecular action of androgen in the normal and neoplastic neoplastic /neo·plas·tic/ (ne?o-plas´tik) 1. pertaining to a neoplasm. 2. pertaining to neoplasia. neoplastic pertaining to neoplasia or a neoplasm. prostate. Vitam Horm 55:219-307. Labarca C, Paigen K. 1980. A simple, rapid, and sensitive DNA assay procedure. Anal Biochem 102:344-352. Latil A, Bieche I, Vidaud D, Lidereau R, Berthon P, Cussenot O, et al. 2001. Evaluation of androgen, estrogen (ER[alpha] and ER[beta]), and progesterone receptor expression in human prostate cancer by real-time quantitative reverse transcription-polymerase chain reaction assays. Cancer Res 61:1919-1926. Marker PC, Donjacour AA, Dahiya R, Cunha GR. 2003. Hormonal, cellular, and molecular control of prostatic development. Dev Biol 253:165-174. Montano MM, Welshons WV, vom Saal FS. 1995. Free estradiol in serum and brain uptake of estradiol during fetal and neonatal sexual differentiation in female rats. Biol Reprod 53:1198-1207. Nagel SC, Hagelbarger JL, McDonnell DP. 2001. Development of an ER action indicator mouse for the study of estrogens, selective ER modulators (SERMs), and xenobiotics. Endocrinology 142:4721-4728. Nagel SC, vom Saal FS, Thayer KA, Dhar MD, Boechler M, Welshons WV. 1997. Relative binding affinity-serum modified access (RBA-SMA) assay predicts the relative in vivo bioactivity bi·o·ac·tiv·i·ty n. The effect of a given agent, such as a vaccine, upon a living organism or on living tissue. of the xenoestrogens bisphenol A and octylphenol. Environ Health Perspect 105:70-76. Prins GS, Birch L. 1995. The developmental pattern of androgen receptor expression in rat prostate lobes is altered after neonatal exposure to estrogen. Endocrinology 136:1303-1314. Prins GS, Birch L, Greene GL. 1991. Androgen receptor localization Customizing software and documentation for a particular country. It includes the translation of menus and messages into the native spoken language as well as changes in the user interface to accommodate different alphabets and culture. See internationalization and l10n. in different cell types of the adult rat prostate. Endocrinology 129:3187-3199. Prins GS, Marmer M, Woodham C, Chang W, Kuiper G, Gustafsson J-A, et al. 1998. Estrogen receptor-[beta] messenger ribonucleic acid ontogeny ontogeny: see biogenetic law. Ontogeny The developmental history of an organism from its origin to maturity. It starts with fertilization and ends with the attainment of an adult state, usually expressed in terms of both maximal body in the prostate of normal and neonatally estrogenized rats. Endocrinology 139:874-883. Rajapakse N, Silva E, Kortenkamp A. 2002. Combining xenoestrogens at levels below individual no-observed-effect concentrations dramatically enhances steroid hormone action. Environ Health Perspect 110:917-921. Rajfer J, Coffey DS. 1978. Sex steroid imprinting imprinting, acquisition of behavior in many animal species, in which, at a critical period early in life, the animals form strong and lasting attachments. Imprinting is important for normal social development. of the immature prostate. Invest Urol 16:186-190. Richter CA, Timms BG, vom Saal FS. 2005. Prostate development: mechanisms for opposite effects of low and high doses of estrogenic chemicals. In: Endocrine Disruptors: Effects on Male and Female Reproductive Systems (Naz RK, ed). New York:CRC (Cyclical Redundancy Checking) An error checking technique used to ensure the accuracy of transmitting digital data. The transmitted messages are divided into predetermined lengths which, used as dividends, are divided by a fixed divisor. Press, 379-410. Risbridger GP, Almahbobi GA, Taylor RA. 2005. Early prostate development and its association with late-life prostate disease. Cell Tissue Res 322:173-181. Risbridger GP, Bianco JJ, Ellem SJ, McPherson SJ. 2003. Oestrogens and prostate cancer. Endocr Relat Cancer 10:187-191. Schonfelder G, Wittfoht W, Hopp H, Talsness CE, Paul M, Chahoud I. 2002. Parent bisphenol A accumulation in human maternal-fetal-placental unit. Environ Health Perspect 110:A703-A707. Shioda T, Chesnes J, Coser KR, Zou L, Hur J, Dean KL, et al. 2006. Importance of dosage standardization for interpreting transcriptomal signature profiles: evidence from studies of xenoestrogens. Proc Natl Acad Sci USA 103:12033-12038. Takao Y, Lee HC, Kohra S, Arizono K. 2002. Release of bisphenol A from food can lining upon heating. J Health Sci 48:331-334. Thayer KA, Ruhlen RL, Howdeshell KL, Buchanan DL, Cooke PS, Preziosi D, et al. 2001. Altered prostate growth and daily sperm production in male mice exposed prenatally to subclinical subclinical /sub·clin·i·cal/ (sub-klin´i-k'l) without clinical manifestations. sub·clin·i·cal adj. Not manifesting characteristic clinical symptoms. Used of a disease or condition. doses of 17[alpha]-ethinyl oestradiol Noun 1. oestradiol - the most powerful female hormone that occurs naturally; synthesized and used to treat estrogen deficiency and breast cancer estradiol Loestrin - trade name for an oral contraceptive containing estradiol and norethindrone . Hum Reprod 16:988-996. Timms BG, Howdeshell KL, Barton L, Bradley S, Richter CA, vom Saal FS. 2005. Estrogenic chemicals in plastic and oral contraceptives disrupt development of the fetal mouse prostate and urethra urethra (y rē`thrə), canal in most mammals that carries urine from the bladder to the outside of the body; in the male it also serves as a genital duct. . Proc Natl
Acad Sci USA 102:7014-7019.
Timms BG, Mohs TJ, Didio LJA LJA Lija (postal locality, Malta) LJA Longmont Jazz Association (Longmont, CO) LJA List of Join Alternatives LJA Launch Justification Assessment . 1994. Ductal budding and branching patterns in the developing prostate. J Urol 151:1427-1432. Timms BG, Petersen SL, vom Saal FS. 1999. Prostate gland growth during development is stimulated in both male and female rat fetuses by intrauterine intrauterine /in·tra·uter·ine/ (-u´ter-in) within the uterus. in·tra·u·ter·ine adj. Within the uterus. Intrauterine Situated or occuring in the uterus. proximity to female fetuses. J Urol 161:1694-1701. vom Saal FS, Hughes C. 2005. An extensive new literature concerning low-dose effects of bisphenol A shows the need for a new risk assessment. Environ Health Perspect 113:926-933. vom Saal FS, Quadagno DM, Even MD, Keisler LW, Keisler DH, Khan S. 1990. Paradoxical effects of maternal stress on fetal steroid and postnatal reproductive traits in female mice from different intrauterine positions. Biol Reprod 43:751-761. vom Saal FS, Timms BG, Montano MM, Palanza P, Thayer KA, Nagel SC, et al. 1997. Prostate enlargement in mice due to fetal exposure to low doses of estradiol or diethylstilbestrol and opposite effects at high doses. Proc Natl Acad Sci USA 94:2056-2061. vom Saal FS, Welshons WV. 2006. Large effects from small exposures. II. The importance of positive controls in low-dose research on bisphenol A. Environ Res 100:50-76. Welshons WV, Nagel SC, Thayer KA, Judy BM, vom Saal FS. 1999. Low-dose bioactivity of xenoestrogens in animals: fetal exposure to low doses of methoxychlor and other xenoestrogens increases adult prostate size in mice. Toxicol Ind Health 15:12-25. Welshons WV, Nagel SC, vom Saal FS. 2006. Large effects from small exposures. III. Endocrine mechanisms mediating effects of bisphenol A at levels of human exposure. Endocrinology 147:S56-S69. Woodham C, Birch L, Prins GS. 2003. Neonatal estrogen down-regulates prostatic androgen receptor through a proteosome-mediated protein degradation pathway. Endocrinology 144:4841-4850. Catherine A. Richter, (1) Julia A. Taylor, (1) Rachel L. Ruhlen, (1) Wade V. Welshons, (2) and Frederick S. vom Saal (1) (1) Division of Biological Sciences, and (2) Veterinary Biomedical Sciences, University of Missouri-Columbia, Columbia, Missouri, USA Address correspondence to F.S. vom Saal, 105 Lefevre Hall, Division of Biological Sciences, University of Missouri-Columbia, Columbia, MO 65211 USA. Telephone: (573) 882-4367. Fax: (573) 884-5020. E-mail: vomsaalf@missouri.edu Support was provided by S. Khan, G.S. Johnson, and D. Lubahn, and by grants ES-11283 (F.S.vS), 1F32ES-11549-01 (C.A.R.), and P01ES10535 (D. Lubahn) from the National Institute of Environmental Sciences (NIEHS NIEHS National Institute of Environmental Health Sciences (NIH, DHHS) ). The contents are solely the responsibility of the authors and do not necessarily represent the official views of the NIEHS, the National Institutes of Health, or the Public Health Service. The authors declare they have no competing financial interests. Received 5 October 2006; accepted 27 February 2007.
Table 1. Sequences of primers and probes for real time RT-PCR assays.
5' position
Gene Sequence (5'[right arrow]3') in CDS Exon boundary
Ar
Forward TGTCAAAAGTGAAATGGGACC 1494
Reverse TGGTACTGTCCAAACGCATGT 1567 1-2 at 1553
Probe TGGATGGAGAACTACTCCGGACCTTATGGG 1516
Arbp
Forward GAGATTCGGGATATGCTGTTGG 289 2-3 at 302
Reverse GGCGATGGCACCAGCC 351
Probe CAATAAGGTGCCAGCTGCTGCTCG 312
Vim
Forward GCACCCTGCAGTCATTCAGA 602
Reverse CCACTTTCCGTTCAAGGTCAA 673 3-4 at 660
Probe AGGATGTTGACAATGCTTCTCTGGCACG 623
CDS, coding sequence.
|
|
||||||||||||||||

rē`thrə)
Printer friendly
Cite/link
Email
Feedback
Reader Opinion