Escherichia coli and community-acquired gastroenteritis, Melbourne, Australia.As part of a study to determine the effects of water filtration on the incidence of community-acquired gastroenteritis gastroenteritis: see enteritis. gastroenteritis Acute infectious syndrome of the stomach lining and intestines. Symptoms include diarrhea, vomiting, and abdominal cramps. in Melbourne, Australia, we examined fecal samples from patients with gastroenteritis and asymptomatic persons for diarrheagenic strains of Escherichia coli Escherichia coli (ĕsh'ərĭk`ēə kō`lī), common bacterium that normally inhabits the intestinal tracts of humans and animals, but can cause infection in other parts of the body, especially the urinary tract. . Atypical strains of enteropathogenic enteropathogenic having pathogenicity for the intestine. enteropathogenic Escherichia coli strains of E. coli which cause enteritis by close association with enteric cells. Includes attaching and effacing E. coli. E. coli E. coli: see Escherichia coli. E. coli in full Escherichia coli Species of bacterium that inhabits the stomach and intestines. E. coli can be transmitted by water, milk, food, or flies and other insects. (EPEC EPEC enteropathogenic Escherichia coli. EPEC Enteropathic Escherichia coli, see there ) were the most frequently identified pathogens of all bacterial, viral, and parasitic agents in patients with gastroenteritis. Moreover, atypical EPEC were more common in patients with gastroenteritis (89 [12.8%] of 696) than in asymptomatic persons (11 [2.3%] of 489, p < 0.0001). Twenty-two random isolates of atypical EPEC that were characterized further showed marked heterogeneity in terms of serotype serotype /se·ro·type/ (ser´o-tip) the type of a microorganism determined by its constituent antigens; a taxonomic subdivision based thereon. se·ro·type n. See serovar. v. , genetic subtype (programming) subtype - If S is a subtype of T then an expression of type S may be used anywhere that one of type T can and an implicit type conversion will be applied to convert it to type T. , and carriage of virulence-associated determinants. Apart from the surface protein, intimin, no virulence determinant or phenotype was uniformly present in atypical EPEC strains. This study shows that atypical EPEC are an important cause of gastroenteritis in Melbourne. ********** Strains of Escherichia coli that cause diarrhea are classified into pathotypes (or virotypes) according to according to prep. 1. As stated or indicated by; on the authority of: according to historians. 2. In keeping with: according to instructions. 3. their specific virulence determinants (1). These virulence determinants give each pathotype the capacity to cause a clinical syndrome with distinctive epidemiologic and pathologic characteristics. For example, enterohemorrhagic E. coli (EHEC EHEC enterohemorrhagic Escherichia coli. EHEC Enterohemorrhagic Escherichia coli, see there ) may cause hemorrhagic colitis hemorrhagic colitis n. Abdominal cramps and bloody diarrhea, without fever, attributed to a self-limited infection by a strain of Escherichia coli. and the hemolytic uremic syndrome hemolytic uremic syndrome n. A syndrome in which hemolytic anemia and thrombocytopenia occur with acute renal failure, marked in children by sudden gastrointestinal bleeding, urine that contains red blood cells and is scanty in volume, and because of their production of Shiga toxins, whereas enteroaggregative E. coli (EAEC EAEC enteroadherent Escherichia coli. EAEC Enteroadherent Escherichia coli, see there ) are associated with persistent diarrhea in children in less-developed countries Less-developed countries (LDCs) Also known as emerging markets. Countries who's per capita GDP is below a World Bank-determined level. (1). Enteropathogenic E. coli (EPEC) share several key virulence determinants with the most common varieties of EHEC, but lack Shiga toxins, and cause nonspecific nonspecific /non·spe·cif·ic/ (non?spi-sif´ik) 1. not due to any single known cause. 2. not directed against a particular agent, but rather having a general effect. nonspecific 1. diarrhea in infants in less-developed countries (2,3). EPEC also differ from EHEC in that they typically carry an EPEC adherence factor plasmid (EAF EAF - Effort Adjustment Factor ). This plasmid encodes both bundle-forming pili pili /pi·li/ (pi´li) [L.] plural of pilus. pili plural of pilus. pili torti (Bfp) that promote bacterial adherence to mammalian cells and are required for virulence (4) and a transcriptional activator, known as Per, that upregulates genes, such as eae, within a pathogenicity island Pathogenicity islands (PAIs) are a distinct class of genomic islands which are acquired by horizontal transfer. They are incorporated in the genome of pathogenic microorganisms but are usually absent from those non-pathogenic organisms of the same or closely related species. termed the locus for enterocyte enterocyte the predominant cells in the small intestinal mucosa. They are tall columnar cells and responsible for the final digestion and absorption of nutrients, electrolytes and water. effacement effacement /ef·face·ment/ (e-fas´ment) the obliteration of features; said of the cervix during labor when it is so changed that only the external os remains. (LEE) (5). LEE is required to produce attaching-effacing lesions, which are characteristic of EPECinduced pathology. A subset of EPEC, known as atypical EPEC, does not carry EAF and hence does not produce Bfp (3). The role of EPEC in disease is uncertain. The principal reservoir of EHEC is food animals, in particular, cattle, which harbor these bacteria in the distal intestinal tract and from which bacteria can spread to humans through fecally contaminated contaminated, v 1. made radioactive by the addition of small quantities of radioactive material. 2. made contaminated by adding infective or radiographic materials. 3. an infective surface or object. food or water (1). Although the other pathotypes of diarrheagenic E. coli generally do not originate in Verb 1. originate in - come from stem - grow out of, have roots in, originate in; "The increase in the national debt stems from the last war" animals, they may also spread to humans through food or water contaminated with excrement excrement /ex·cre·ment/ (eks´kri-mint) 1. feces. 2. excretion (2). ex·cre·ment n. Waste matter or any excretion cast out of the body, especially feces. . Recently, we conducted a study to determine if the water supply of Melbourne, Australia's second largest city with >3 million inhabitants
The game is based loosely on the concepts from SameGame. , is a source of intestinal pathogens that are responsible for community-acquired gastroenteritis. Among the pathogens that were sought were diarrheagenic E. coli, including atypical EPEC, which emerged as the predominant cause of gastroenteritis in this community. Materials and Methods The design of the Water Quality Study (WQS WQS World Qualifying Series (surfing competition) WQS Water Quality Standard ), which was conducted from September 1997 to February 1999, has been reported previously (6). Briefly, 600 Melbourne families, with at least two children 1-15 years of age, were enrolled in the study. Each family was allocated at random to receive a real or sham water treatment unit, which was installed in the kitchen of their home and supplied water through a separate faucet. Family members, comprising 2,811 persons, were followed for 15 months (68 weeks). Each participating household had a nominated member who completed a weekly questionnaire regarding the presence, duration, and severity of gastrointestinal symptoms. The primary endpoint of the study was highly credible gastroenteritis, which was defined as exhibiting any of the following symptoms in a 24-hour period: two or more loose stools, two or more episodes of vomiting, one loose stool together with abdominal pain Abdominal pain can be one of the symptoms associated with transient disorders or serious disease. Making a definitive diagnosis of the cause of abdominal pain can be difficult, because many diseases can result in this symptom. Abdominal pain is a common problem. or nausea or vomiting, or one episode of vomiting with abdominal pain or nausea. Cases of highly credible gastroenteritis were deemed to be distinct if the participant was symptom-free for at least 6 days. Sample Collection and Processing Participants in the study were asked to collect fecal specimens during episodes of gastroenteritis. A total of 795 specimens collected during 2,669 reported episodes of gastroenteritis were examined for rotavirus rotavirus /ro·ta·vi·rus/ (ro´tah-vi?rus) any member of the genus Rotavirus. ro´taviral Rotavirus /Ro·ta·vi·rus/ (ro´tah-vi?rus , adenovirus adenovirus Any of a group of spheroidal viruses, made up of DNA wrapped in a protein coat, that cause sore throat and fever in humans, hepatitis in dogs, and several diseases in fowl, mice, cattle, pigs, and monkeys. , Norwalk-like viruses, Giardia Giardia /Gi·ar·dia/ (je-ahr´de-ah) a genus of flagellate protozoa parasitic in the intestinal tract of humans and other animals, which may cause giardiasis; G. lam´blia (G. intestina´lis) is the species found in humans. spp., and Cryptosporidium cryptosporidium (krĭp'tōspərĭd`ēəm), genus of protozoans having at least four species; they are waterborne parasites that cause the disease cryptosporidiosis. spp. and were cultured for Salmonella spp., Shigella shigella Any of the rod-shaped bacteria that make up the genus Shigella, which are normal inhabitants of the human intestinal tract and can cause dysentery, or shigellosis. Shigellae are gram-negative (see gram stain), non-spore-forming, stationary bacteria. S. spp., Campylobacter Campylobacter Genus of gram-negative spiral-shaped bacteria infecting mammals. Many species, especially C. fetus, cause miscarriage in sheep and cattle. C. jejuni is a common cause of food poisoning. Sources include meats (particularly chicken) and unpasteurized milk. spp., Vibrio vibrio Any of a group of aquatic, comma-shaped bacteria in the family Vibrionaceae. Some species cause serious diseases in humans and other animals. They are gram-negative (see spp., Yersinia Yersinia A genus of bacteria in the Enterobacteriaceae family. The bacteria appear as gram-negative rods and share many physiological properties with related Escherichia coli. Of the 11 species of Yersinia, Y. pestis, Y. enterocolitica, and Y. spp., Aeromonas spp Aeromonas spp Microbiology A genus of gram-negative, facultatively anaerobic, nonspore-forming bacilli, which have been isolated from various foods, including dairy products, meats and vegetable; Aeromonas ., Plesiomonas spp., and Clostridium difficile Clostridium difficile A common cause of bacterial colitis; it is the causative agent in 99% of pseudomembranous colitis, and 20-30% of antibiotic-associated diarrhea , as described previously (6,7). Baseline frequencies of these pathogens in the study population were determined during the 4-month period, May through August 1997, immediately preceding the WQS. Frequencies were examined by investigating 1,091 fecal specimens from a convenience sample of participants. Participants who provided a baseline specimen were similar to those who did not provide a specimen in age, sex, and family background. Examination of Feces for E. coli Sufficient funds were available to investigate 1,250 samples for diarrheagenic E. coli. Of these samples, 500 were randomly selected from 1,091 fecal samples obtained from healthy persons in the baseline study, and 750 samples were randomly selected from the 795 samples obtained from participants with highly credible gastroenteritis in the WQS. Bacteria were isolated from fecal samples by direct plating on MacConkey agar MacConkey (also McConkey) agar is a culture medium designed to grow Gram-negative bacteria and stain them for lactose fermentation. It contains bile salts, crystal violet dye (to inhibit Gram-positive bacteria), neutral red dye (which stains microbes fermenting lactose), (Oxoid Ltd., Basingstoke, UK). After overnight incubation at 37[degrees]C, a sterile cotton swab "Q-Tip" redirects here. For the rapper, see Q-Tip (rapper). For the band, see Q-Tips (band). Cotton swabs (British English: cotton buds) are used in first aid, cosmetics application, and a variety of other uses. was used to transfer the entire growth from each plate into Luria broth containing 30% (vol/vol) glycerol glycerol, glycerin, glycerine, or 1,2,3-propanetriol (prō`pāntrī'ŏl), CH2OHCHOHCH2OH, colorless, odorless, sweet-tasting, syrupy liquid. , which was then frozen at -70[degrees]C until required. Diarrheagenic strains of E. coli were identified by polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is (PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) ) and confirmed by Southern hybridization hybridization /hy·brid·iza·tion/ (hi?brid-i-za´shun) 1. crossbreeding; the act or process of producing hybrids. 2. molecular hybridization 3. . Template DNA DNA: see nucleic acid. DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. for use in PCR was prepared from bacteria grown in 2.5 mL of MacConkey broth that contained a loopful of stored frozen culture and was incubated with shaking at 37[degrees]C overnight. One milliliter milliliter /mil·li·li·ter/ (mL) (-le?ter) one thousandth (10-3) of a liter. mil·li·li·ter n. Abbr. of this culture was centrifuged to pellet the bacteria, the supernatant supernatant /su·per·na·tant/ (-na´tant) the liquid lying above a layer of precipitated insoluble material. supernatant the liquid lying above a layer of precipitated insoluble material. was removed, and then the pellet was washed in 1 mL of phosphate buffer, resuspended in 200 [micro]L sterile distilled water Noun 1. distilled water - water that has been purified by distillation H2O, water - binary compound that occurs at room temperature as a clear colorless odorless tasteless liquid; freezes into ice below 0 degrees centigrade and boils above 100 degrees centigrade; , and heated for 10 min at 100[degrees]C. Samples were then placed on ice for 5 min and recentrifuged at 16,000 x g. Aliquots of the supernatant were pipetted into sterile tubes and stored for <1 week at -20[degrees]C before use. PCR amplifications were performed in a Gene Amp PCR System 9700 thermal cycler The Thermal cycler (also known as a thermocycler, PCR machine or DNA amplifier) is a laboratory apparatus used for PCR. The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted. (Applied Biosystems Applied Biosystems, Inc. (formerly NASDAQ: ABIO) is the original name of a pioneer biotechnology company founded in 1981 in Foster City, California, among the Silicon Valley cities of the southern San Francisco Bay Area. , Foster City, CA) with AmpliTaq Gold polymerase (Applied Biosystems) and the primers listed in Table 1 in a reaction volume of 20 [micro]L (for single reactions) or 50 [micro]L (for multiplex PCR). The genes identified by these primers and their association with each pathotype of diarrheagenic E. coli are listed in Tables 1 and 2. PCR for the lacZ gene, which is found in almost all wild-type strains of E. coli, was included as a control to ensure that negative PCR assays were not a result of the absence of viable bacteria in the sample or the presence of inhibitors in the reaction mixture. Samples that were negative in the PCR for lacZ (3.6% of all those examined) were excluded from further analysis. At the conclusion of the PCR, 10 [micro]L of the reaction mixture underwent electrophoresis on 2.5% 96-well format agarose agarose more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments. gels (Electro-fast, ABgene, Epsom, UK). Gels were stained with ethidium bromide Ethidium bromide (sometimes abbreviated as EtBr) is an intercalating agent commonly used as a nucleic acid stain in molecular biology laboratories for techniques such as agarose gel electrophoresis. , visualized on a UV transilluminator, and photographed. A portion of the PCR product was retained for Southern blotting, which was performed by using capillary transfer of separated DNA fragments onto positively charged Adj. 1. positively charged - having a positive charge; "protons are positive" electropositive, positive charged - of a particle or body or system; having a net amount of positive or negative electric charge; "charged particles"; "a charged battery" nylon membranes (Roche Diagnostics Roche Diagnostics Division is a subsidiary of Hoffmann-La Roche which manufactures equipment and reagents for research and medical diagnostic applications. Internally, it is organized into six major business areas: Roche Applied Science, Roche Centralized Diagnostics, Roche Ltd., Lewes, UK). Digoxigenin-labeled DNA probes were prepared by PCR (Roche Diagnostics) from the control strains (Table 2) by using the PCR primers listed in Table 1. The integrity of the probes was determined by nucleotide sequencing. Probes were hybridized overnight under conditions of high stringency at 65[degrees]C and detected by using chemiluminescence chemiluminescence /chemi·lu·mi·nes·cence/ (kem?i-loo?mi-nes´ens) luminescence produced by direct transformation of chemical energy into light energy. as recommended by the manufacturer. Probe-positive bacteria were assigned to a pathotype according the criteria in Table 2. Equivocal EQUIVOCAL. What has a double sense. 2. In the construction of contracts, it is a general rule that when an expression may be taken in two senses, that shall be preferred which gives it effect. Vide Ambiguity; Construction; Interpretation; and Dig. or ambiguous assays were repeated, and if results were still unclear, these specimens were excluded from further analysis. Characterization of Isolates Twenty-two EPEC isolates (11 from healthy persons and 11 from persons with diarrhea) were isolated in pure culture. Representative colonies of each were then serotyped with hyperimmune hyperimmune /hy·per·im·mune/ (hi?per-i-mun´) possessing very large quantities of specific antibodies in the serum. hyperimmune possessing very large quantities of specific antibodies in the serum. rabbit antisera (16). These strains were also subjected to PCR with the primers and conditions listed in Table 3 to determine intimin subtype and to investigate the presence of selected virulence-associated genes. The same 22 strains were also examined for their ability to adhere to adhere to verb 1. follow, keep, maintain, respect, observe, be true, fulfil, obey, heed, keep to, abide by, be loyal, mind, be constant, be faithful 2. and invade HEp-2 epithelial cells Epithelial cells Cells that form a thin surface coating on the outside of a body structure. Mentioned in: Corneal Transplantation . Bacterial Adhesion and Invasion of HEp-2 Cells The Center for Vaccine Development (University of Maryland, Baltimore University of Maryland, Baltimore, (also known as UMB) was founded in 1807. It is one of the oldest universities in the United States and comprises some of the oldest professional schools in the nation and world. , MD) method was used to determine the pattern of bacterial adherence to HEp-2 epithelial cells (12). Bacterial strains were designated nonadherent if <10 of 200 HEp-2 cells had five or more bacteria attached. The fluorescent actin staining (FAS) assay, which correlates with the ability of E. coli to produce attaching-effacing lesions in the intestine, was performed by using a 6-h incubation period incubation period n. 1. See latent period. 2. See incubative stage. Incubation period (22). At the completion of the assay, cells were examined by fluorescence and phase-contrast microscopy to confirm that fluorescent areas corresponded to attached bacteria. Bacterial strains that gave equivocal or negative results in the FAS assay were investigated for DNA corresponding to regions of the LEE, other than eae, by colony blotting using the LEE-A, LEE-B, and LEE-D DNA probes and hybridization conditions described previously (23). Quantitative assessment of the ability of E. coli to invade HEp-2 cells was performed with the gentamicin-protection assay (24). Results were expressed as the number of bacteria recovered from HEp-2 cells after treatment with gentamicin gentamicin /gen·ta·mi·cin/ (jen?tah-mi´sin) an aminoglycoside antibiotic complex isolated from bacteria of the genus Micromonospora, as a percentage of the total number of cell-associated bacteria (24). Statistical analysis was performed with InStat version 3.0 (GraphPad Software Inc., San Diego San Diego (săn dēā`gō), city (1990 pop. 1,110,549), seat of San Diego co., S Calif., on San Diego Bay; inc. 1850. San Diego includes the unincorporated communities of La Jolla and Spring Valley. Coronado is across the bay. , CA). A p value < 0.05 was considered significant. Results Association of E. coil Pathotypes with Gastroenteritis After excluding samples for which patient data were incomplete (12 samples), which were negative by PCR for lacZ (45 samples), or which gave equivocal results in the PCR or DNA hybridization DNA hybridization Molecular medicine A technique for determining the presence of a target DNA in a sample of tissue or cells. See HLA analysis, Paternity testing, RFLP analysis. assays (8 samples), 1,185 (94.8%) samples of the original 1,250 were available for analysis: 696 from patients with gastroenteritis and 489 from healthy persons. The results of the assays are summarized in Table 4. Enterotoxigenic en·ter·o·tox·i·gen·ic adj. Of or being an organism containing or producing an enterotoxin. Enterotoxigenic (ETEC ETEC enterotoxigenic Escherichia coli. ETEC Enterotoxic Escherichia coli, see there ) and enteroinvasive (EIEC EIEC enteroinvasive Escherichia coli. EIEC Enteroinvasive Escherichia coli, see there ) strains of E. coli and Bfp-positive EPEC were identified in <0.5% of healthy persons or patients with gastroenteritis. EHEC were present in 4 (0.6%) of 696 of samples from persons with gastroenteritis and in no healthy persons, but the difference between the two groups was not significant (p = 0.15, Fisher exact test, 2-tailed). In contrast, both EAEC and atypical (Bfp-negative) EPEC were identified in >5% of patients, and the difference between the symptomatic and baseline groups was significant for each of these pathotypes (Table 4). Analysis of the data pertaining to patients in whom EAEC and atypical EPEC were identified showed that atypical EPEC were more frequent in younger persons; patients with atypical EPEC were a median age of 3.4 years, compared with 7.4 years for the symptomatic group overall (p < 0.0001; Mann-Whitney test, 2-tailed). Of all atypical EPEC in study participants with gastroenteritis, 75 (84%) were identified in children <10 years old, compared with 14 (16%) in patients [greater than or equal to] 10 years (relative rate [RR] 3.4, 95% confidence interval confidence interval, n a statistical device used to determine the range within which an acceptable datum would fall. Confidence intervals are usually expressed in percentages, typically 95% or 99%. [CI] 2.0-5.9). In contrast, the median age of patients infected with EAEC was 7.3 years. Examining the seasonal occurrence of gastroenteritis from all causes showed that gastroenteritis was more common in the warmer months; 65.7% of cases occurred in the 6 months from October through March (Figure 1). Infections with EAEC and atypical EPEC reflected this distribution with 80% and 65.5% of infections with these bacteria, respectively, occurring during the same period. The high incidence of EAEC in February and March may have been caused by small family outbreaks; 9 of 25 cases during this period originated in three households. [FIGURE 1 OMITTED] In view of the seasonal variation in the occurrence of EAEC and atypical EPEC, we reanalyzed the data and compared the symptomatic and baseline groups, because the EPEC were examined only during the 4-month period from May through August, 1997. This analysis showed that the occurrence of EAEC in persons with gastroenteritis (6 [3.8%] of 157) and in asymptomatic persons (15 [3.1%] of 489) was essentially the same during May through August of 1998 and 1997, respectively (RR 1.2, 95% CI 0.5-3.0). In contrast, atypical EPEC were more frequent in the gastroenteritis group during the same period; 19 (12.1%) of 157 of symptomatic patients were positive for these bacteria, compared with 11 (2.3%) of 489 for the asymptomatic group (RR 5.7, 95% CI 3.1-10.5, p < 0.0001; Fisher exact test, 2-tailed). The frequency of atypical EPEC in symptomatic patients from households with real and sham water treatment units was similar (42 [12.3%] of 341 and 47 [13.2%] of 355, respectively). Characterization of EPEC Isolates Pure cultures of PCR- and probe-positive atypical EPEC were obtained from 22 randomly selected samples that were positive in the original PCR. These isolates were characterized further to establish their identity as EPEC and to determine if they belonged to a limited number of clones. All strains were identified as atypical EPEC in that they were negative for bfpA, stx1, stx2, aggA, and aggR. Determination of O:H serotype and intimin subtype revealed that although strains from each sample were the same, those obtained from different persons were highly heterogeneous, and no two isolates belonged to the same serotype and intimin subtype (Table 5). Only three isolates were of serotypes (O55:H7 and O126:H6 [two isolates]) that commonly include atypical EPEC. In addition, one isolate, W145, was serotype O55:H6, which includes typical EPEC strains (2). Eight isolates were O-serogroups that were classified as nontypeable because they did not react with any of the available O-typing sera (O1-O181), and one isolate had an H antigen H antigen n. See flagellar antigen. H antigen see H antigen. H antigen Transfusion medicine The trisaccharide stem chain of the ABO blood group, located on RBC membranes; the enzyme, that did not react with any of the available H-typing sera (H1-H56) and was classified as nontypeable. Atypical EPEC strains were also heterogeneous in their carriage of putative accessory virulence determinants (Table 5). Although all bacteria were, by definition, negative for bfpA, nearly all were also negative for efal and lpfD, the genes for factors that have been implicated im·pli·cate tr.v. im·pli·cat·ed, im·pli·cat·ing, im·pli·cates 1. To involve or connect intimately or incriminatingly: evidence that implicates others in the plot. 2. as adhesins of some attaching-effacing strains of E. coli (19,25). Only two strains were positive for astA, which has also been suggested to contribute to the virulence of atypical EPEC (26). Adhesion to HEp-2 Cells. Typical EPEC adhere to HEp-2 cells in a distinctive pattern termed localized adherence, which requires the presence of Bfp (5). The 22 atypical EPEC strains isolated in this study showed variable patterns of adherence to HEp-2 cells, including aggregative adherence (7 strains) and a pattern previously termed localized-like adherence (1 strain) (27). Ten strains showed an indeterminate pattern of adherence, with small numbers of bacteria distributed apparently at random on the cell surface (Figure 2), and 4 strains were classified as nonadherent. The frequency of strains displaying each pattern of adherence was similar among isolates from patients with gastroenteritis and healthy persons. All atypical EPEC strains that adhered to HEp-2 cells, regardless of their pattern of adhesion, were positive in the FAS assay (Figure 3), which indicates that the LEE in these bacteria is functional. All nonadherent strains hybridized with DNA probes were derived from different regions of LEE, which suggests that they carry the entire pathogenicity island. We did not attempt to determine whether LEE was functional in these bacteria. [FIGURES 2-3 OMITTED] Previous reports of atypical EPEC have suggested that invasion of epithelial cells may contribute to the virulence of these bacteria (28). In this study, however, only one strain, W1056 (O55:H7), was able to invade HEp-2 cells to a noticeable extent (Table 5). Discussion The role of EPEC as a cause of diarrhea in children, particularly in developing countries, is now well established (2,3). The proven virulence determinants of EPEC include genes within the LEE, notably intimin (the outer membrane The outer membrane refers to the outside membranes of Gram-negative bacteria, the chloroplast, or the mitochondria. It is used to maintain the shape of the organelle contained within its structure, and it acts as a barrier against certain dangers. protein product of the eae gene), and Bfp, which is encoded by EAF (5). The key role of EAF in promoting the virulence of EPEC was established by Levine et al. (12), who showed that an EAF-negative derivative strain of EPEC, E2348/69, is markedly less virulent for adult volunteers than the wild-type strain. The same study showed that an atypical EPEC strain, E128012, which intrinsically lacks EAF, is also virulent in volunteers. This observation established that certain EPEC strains do not require EAF to cause disease. These intrinsically EAF-negative strains were originally called Class II EPEC (2,3) but are now more generally referred to as atypical EPEC. They are characterized by the presence of LEE and the absence of factors encoded by EAF, in particular, Bfp. In this way, atypical EPEC resemble EHEC, which are able to cause diarrhea despite their lack of Bfp. Indeed, persuasive evidence indicates that the most prevalent EHEC strain, serotype O157:H7, evolved from an atypical EPEC strain of serotype O55:H7 (29). The aims of the WQS were to investigate the effect of household water treatment units on the incidence of gastroenteritis in Melbourne and to identify causative agents of gastroenteritis in the study population. The microbiologic investigations showed that the detection rate of EAEC (6.5%) and atypical EPEC (12.3%) in patients with diarrhea was greater than that of Campylobacter spp. (3%), Salmonella spp. (1.1%), adenovirus (1.1%), rotavirus (1.4%), Cryptosporidium spp. (1.6%), and Giardia spp. (2.5%) and was matched only by that of noroviruses (11.4%) (6,7,30). Together, atypical EPEC and EAEC accounted for 19.3% of all cases; 21% of cases were attributable to all other bacterial, viral, and parasitic causes combined. However, the frequency of EAEC in patients with gastroenteritis and that in the baseline group without diarrhea was the same when matched for the time of year when the sample of feces was collected. In contrast, atypical EPEC was isolated significantly more often from patients with gastroenteritis than from those without symptoms, regardless of when the sample was collected. A subset of 22 randomly selected atypical EPEC strains was examined and found to be highly heterogeneous, which indicates that the high frequency of atypical EPEC in the study population was not the result of one or more outbreaks attributable to a small number of strains. Despite the persuasive evidence of a volunteer study and reports of outbreaks of diarrhea with atypical EPEC (12,26,31), the role of atypical EPEC in disease is controversial. Originally, atypical EPEC were grouped with EPEC but were then segregated because they lack EAF. Justification for this division stemmed from the observation that EAF-bearing EPEC far outnumber atypical EPEC as the cause of infantile infantile /in·fan·tile/ (in´fin-til) pertaining to an infant or to infancy. in·fan·tile adj. 1. Of or relating to infants or infancy. 2. diarrhea in less-developed countries and of diarrhea outbreaks in general (3). In recent reports, however, from countries as diverse as Iran, Poland, South Africa South Africa, Afrikaans Suid-Afrika, officially Republic of South Africa, republic (2005 est. pop. 44,344,000), 471,442 sq mi (1,221,037 sq km), S Africa. , and the United Kingdom, atypical EPEC strains have outnumbered typical strains as a cause of gastroenteritis (32-35). Atypical EPEC were also more frequent than typical strains in aboriginal children hospitalized for diarrhea in the Northern Territory of Australia (36). These findings were reflected in the present study: 89 (94%) of eae-bearing strains identified in patients with gastroenteritis were atypical EPEC. As for EPEC in general, atypical EPEC were originally incriminated as intestinal pathogens by virtue of their epidemiologic association with cases of diarrhea (2). Subsequently, these strains, which had been identified by serotype alone, were shown to be EPEC sensu stricto (37). Although atypical EPEC generally are serotypes which differ from EAF-positive EPEC (and other pathotypes of diarrheagenic E. coli), the 12 O-serogroups recognized by the World Health Organization as EPEC (i.e., serogroups O26, O55, O86, O111, O114, O119, O125, O126, O127, O128, O142, and O158) include both typical and atypical varieties (3). Some of the atypical EPEC strains within these serogroups carry accessory virulence-associated determinants such as the EHEC hemolysin hemolysin /he·mol·y·sin/ (he-mol´i-sin) a substance that liberates hemoglobin from erythrocytes by interrupting their structural integrity. he·mol·y·sin n. (commonly found in serotypes O26:H11 and O111ac:H8). Some strains also carry astA, the gene for enteroaggregative heat-stable enterotoxin enterotoxin /en·tero·tox·in/ (en´ter-o-tok?sin) 1. a toxin specific for the cells of the intestinal mucosa. 2. a toxin arising in the intestine. 3. , EAST1, which is frequently found in serotypes O55:H7, O119:H2, and O128:H2 (3). Atypical EPEC strains of non-EPEC serogroups generally do not express these factors. In the present study, none of the 89 atypical strains was positive for ehxA, which is required for the production of EHEC hemolysin, and although two strains (both serogroup O55) tested positive for astA, both carried the previously described mutations in this gene, which would preclude the synthesis of biologically active enterotoxin (38). Unlike EAF-bearing strains of EPEC, which show localized adherence to HEp-2 cells, atypical EPEC show different patterns of adherence. Although some investigators have reported localized-like adherence as a predominant adherence pattern of atypical EPEC (28,39), only 1 of 22 strains investigated here displayed this phenotype. The low frequency of localized-like adherence in this study may reflect differences in serotype distribution, as localized-like adherence seems to be most prevalent in atypical EPEC strains in EPEC serogroups, such as 026, O111, and O119 (28), which were infrequently found in this study. Ten of the 22 strains examined exhibited an adherence pattern that was distinct from localized, aggregative, or diffuse adherence (3) and was termed indeterminate adherence (Figure 1). This pattern may have been termed diffuse adherence by other investigators, which would account for the relatively high frequency of diffusely adherent adherent /ad·her·ent/ (-ent) sticking or holding fast, or having such qualities. atypical EPEC in some reports and their absence from this study. Seven of 22 strains displayed aggregative adherence despite their lack of known sequences associated with the production of fimbriae of EAEC. The virulence of atypical EPEC despite their lack of Bfp, which typical EPEC require to cause severe disease, suggests that these bacteria carry an adhesin analogous to Bfp that augments their ability to colonize col·o·nize v. col·o·nized, col·o·niz·ing, col·o·niz·es v.tr. 1. To form or establish a colony or colonies in. 2. To migrate to and settle in; occupy as a colony. 3. the intestine. Previous studies, however, have shown only a low frequency of known E. coli adhesins, including aggregative adherence fimbriae, P fimbriae, S fimbriae, PAP pili, and afimbrial adhesins in atypical EPEC strains (40). We extended these findings to show that atypical EPEC are also mostly negative for Efal and long polar fimbriae (encoded by lpfD), which contribute to the adhesive capacities of some attaching-effacing strains of E. coli (19,25). Although atypical EPEC may carry an adhesin equivalent to Bfp, which remains to be discovered, these bacteria may use any known E. coli adhesins to bind to to contract; as, to bind one's self to a wife s>. See also: Bind the intestine. This suggestion is supported by the marked heterogeneity of atypical EPEC in terms of adhesion pattern and the observation that adhesins other than Bfp can restore cell-binding capacity to EAF-cured strains of typical EPEC (41). In conclusion, atypical EPEC were the most commonly identified pathogens in a study of community-acquired diarrhea in Melbourne. Infections with atypical EPEC occurred throughout the year and were significantly more common in children. Characterization of a sample of atypical EPEC isolates revealed that these bacteria were antigenically heterogeneous and generally did not belong to O-serogroups associated with EPEC. Further studies are needed to determine the frequency of these bacteria in other communities, their reservoir, mode of spread, and mechanisms of virulence. Acknowledgments We are grateful to M.M. Levine and J.B. Kaper for providing the control strains and LEE probes used in the study and Alexander Kuzevski for skillful skill·ful adj. 1. Possessing or exercising skill; expert. See Synonyms at proficient. 2. Characterized by, exhibiting, or requiring skill. technical assistance. This study was supported by grants from the Australian National Health and Medical Research Council The National Health and Medical Research Council (NHMRC) is Australia's peak funding body for medical research, with a budget of nearly A$500M a year . The Council was established to develop and maintain health standards and is responsible for implementing the , the Murdoch Children's Research Institute, the Cooperative Research Centre Cooperative Research Centres (CRCs) are key bodies for Australian scientific research. The Cooperative Research Centres Programme was established in 1990 to enhance Australia's industrial, commercial and economic growth through the development of sustained, user-driven, cooperative for Water Quality and Treatment, the Water Services Association of Australia, the Victorian Department of Human Services, Melbourne Water Melbourne Water is the organisation that controls much of the water system in Melbourne, Victoria, Australia including the city's reservoirs, sewerage and drainage system. Melbourne Water is wholly owned by the Victorian state Government. Corporation, South East Water Limited, Yarra Valley The Yarra Valley is the name given to the region surrounding the Yarra River in Melbourne, Australia. The river originates in the Yarra Ranges approximately 60 kilometres east of Melbourne and flows towards and into the city of Melbourne and out into Port Phillip Bay. Water Ltd, and City West Water Ltd. Dr. Robins-Browne is professor and head of the Department of Microbiology and Immunology at the University of Melbourne
In 2006, Times Higher Education Supplement ranked the University of Melbourne 22nd in the world. Because of the drop in ranking, University of Melbourne is currently behind four Asian universities - Beijing University, and head of microbiological research at the Royal Children's Hospital The Royal Children's Hospital in Melbourne, Australia is the major specialist paediatric hospital for Victoria offering a full range of clinical services, tertiary care and health promotion and prevention programs for children and adolescents. and the Murdoch Children's Research Institute in Melbourne, Australia. His major research interests are the etiologic agents of bacterial diarrhea and the pathogenesis of bacterial infections, in particular, those caused by Escherichia coli and related bacteria.
Table 1. Characteristics of the polymerase chain reaction (PCR)
primers used to detect pathogenic Escherichia coli in mixed culture
Target gene
or virulence
factor Primer (a) Primer sequence (5' to 3')
[1.sup.1] GACCCGGCACAAGCATAAGC
eae [2.sup.1] CCACCTGCAGCAACAAGAGG
[1.sup.1] GCATCATCAAGCGTACGTTCC
ehxA [2.sup.1] AATGAGCCAAGCTGGTTAAGCT
[1.sup.2] ATAAATCGCCATTCGTTGACTAC
stx1 [2.sup.2] AGAACGCCCACTGAGATCATC
[1.sup.2] GGCACTGTCTGAAACTGCTCC
stx2 [2.sup.2] TCGCCAGTTATCTGACATTCTG
[1.sup.3] GGCGACAGATTATACCGTGC
ltA [2.sup.3] CCGAATTCTGTTATATATGTC
[1.sup.3] TCTGTATTATCTTTCCCCTC
st1A [2.sup.3] ATAACATCCAGCACAGGC
1 CAGCAGATTGCAGCGCATAT
ipaC 2 CAAGAGCAGATGCATAACGC
1 ATTGAATCTGCAATGGTGC
bfpA 2 ATAGCAGTCGATTTAGCAGCC
1 CTGGCGAAAGACTGTATCAT
pCVD432 2 CAATGTATAGAAATCCGCTGTT
1 ATGCATTACTTTGGGTTTAG
aggA 2 TCAACCTTGACACTTGCC
1 TGATTGAAGCAGAAGCCTGC
lacZ 2 CGCCAATCCACATCTGTGAA
Target gene
or virulence
factor Primer (a) PCR program (30 cycles) (b)
[1.sup.1] 95[degrees]C, 30 s;
eae [2.sup.1] 54[degrees]C, 90 s;
72[degrees]C, 90 s
[1.sup.1]
ehxA [2.sup.1]
[1.sup.2] 95[degrees]C, 30 s;
stx1 [2.sup.2] 52[degrees]C, 60 s;
72[degrees]C, 60 s (c)
[1.sup.2]
stx2 [2.sup.2]
[1.sup.3] 94[degrees]C, 60 s;
ltA [2.sup.3] 50[degrees]C, 60 s;
72[degrees]C, 120 s (c)
[1.sup.3]
st1A [2.sup.3]
1 94[degrees]C, 30 s;
ipaC 2 59[degrees]C, 90 s;
72[degrees]C, 90 s
1 95[degrees]C, 40 s;
bfpA 2 55[degrees]C, 40 s;
72[degrees]C, 40 s
1 94[degrees]C, 40 s;
pCVD432 2 53[degrees]C, 60 s;
72[degrees]C, 60 s
1 94[degrees]C, 60 s;
aggA 2 50[degrees]C, 60 s;
72[degrees]C, 120 s (c)
1 94[degrees]C, 30 s;
lacZ 2 59[degrees]C, 90 s;
72[degrees]C, 90 s
Target gene
or virulence Product
factor Primer (a) size (bp) Reference
[1.sup.1] 384 (8)
eae [2.sup.1]
[1.sup.1] 534 (8)
ehxA [2.sup.1]
[1.sup.2] 180 (8)
stx1 [2.sup.2]
[1.sup.2] 255 (8)
stx2 [2.sup.2]
[1.sup.3] 696 (9)
ltA [2.sup.3]
[1.sup.3] 186 (9)
st1A [2.sup.3]
1 811 This study
ipaC 2
1 461 This study
bfpA 2
1 630 (10)
pCVD432 2
1 414 This study
aggA 2
1 1,350 This study
lacZ 2
(a) Primers with the same superscript were used in duplex PCRs.
(b) Before the first cycle, the sample was denatured for 10 min
at 95[degrees]C; after the last cycle, the sample was extended
for 8 min at 72[degrees]C.
(c) 35 cycles.
Table 2. Classification of pathogenic Escherichia coli according
to amplicon(s) generated by polymerase chain reaction for
virulence-associated determinants
Gene or virulence-associated determinant (a)
Interpretation (b) pCVD432 aggA bfpA eae exhA
EAEC (c) + + - - -
Typical EPEC - - + + -
Atypical EPEC - - - + -
EIEC - - - - -
ETEC (c) - - - - -
EHEC (d) - - - + +
STEC, not EHEC (e) - - - - -
Gene or virulence-associated determinant (a)
Interpretation (b) ipaC stlA ltA stx1 stx2
EAEC (c) - - - - -
Typical EPEC - - - - -
Atypical EPEC - - - - -
EIEC + - - - -
ETEC (c) - + + - -
EHEC (d) - - - + +
STEC, not EHEC (e) - - - + +
Control
Interpretation (b) strain Reference
EAEC (c) O42 (11)
Typical EPEC E2348/69 (12)
Atypical EPEC E128012 (12)
EIEC 223/83 (13)
ETEC (c) H10407 (14)
EHEC (d) EDL933 (15)
STEC, not EHEC (e)
(a) Factors specified by virulence genes: aggA, aggregative
fimbria, AAF/I; bfpA, bundle-forming pilus; eae, intimin;
ipaC, invasion plasmid antigen; stlA, heat-stable enterotoxin;
ltA, heat-labile enterotoxin; stx, Shiga toxin.
(b) EAEC, enteroaggregative E. coli; EPEC, enteropathogenic E.
coli, EIEC, enteroinvasive E. coli; ETEC, enterotoxigenic E. coli;
STEC, Shiga toxin-producing E. coli; EHEC, enterohemorrhagic E. coli.
(c) Either stlA or ltA positive.
(d) Either eae or ehxA and stx1 or stx2 positive.
(e) Either stx1 or stx2 positive.
Table 3. Characteristics of the polymerase chain reaction
(PCR) primers used in this study for strain characterization
PCR program
Primer Primer sequence (5' to 3') Target (30 cycles) (a)
P1 (b) CTGAACGGCGATTACGCGAA
P2 CCAGACGATACGATCCAG eae (c) 94[degrees]C, 30 s,
53[degrees]C, 30 s;
72[degrees]C, 60 s
P3 CTGGAGTTGTCGATGTT eae- 94[degrees]C, 30 s;
[alpha] 53[degrees]C, 30 s;
72[degrees]C, 120 s
P4 GTAATTGTGGCACTCC eae- 94[degrees]C, 30 s;
[beta] 53[degrees]C, 30 s;
72[degrees]C, 120 s
P5 GCCTCTGACATTGTTAC eae- 94[degrees]C, 30 s;
[gamma] 53[degrees]C, 30 s;
72[degrees]C, 120 s
ecsD-lower TATTTTCAAAAAGAATGATGTC eae 94[degrees]C, 30 s;
53[degrees]C, 30 s;
72[degrees]C, 150 s
SKl (e) CCCGAATTCGGCACAAGCATAAGC
LP5 AGCTCACTCGTAGATGACGGCAAGCG eae- 94[degrees]C, 30 s,
[epsilon] 53[degrees]C, 60 s;
72[degrees]C, 120 s
LP6B TAGTTGTACTCCCCTTATCC eae- 94[degrees]C, 30 s;
[zeta] 53[degrees]C, 60 s;
72[degrees]C, 150 s
LP7 TTTATCCTGCTCCGTTTGCT eae- 94[degrees]C, 30 s;
[iota] 53[degrees]C, 60 s;
72[degrees]C, 150 s
LP8 TAGATGACGGTAAGCGAC eae-[eta] 94[degrees]C, 30 s;
53[degrees]C, 60 s;
72[degrees]C, 150 s
LP10 GGCATTGTTATCTGTTGTCT eae- 94[degrees]C, 30 s;
[kappa] 53[degrees]C, 60 s;
72[degrees]C, 150 s
LP11B GTTGATAACTCCTGATATTTTA eae- 94[degrees]C, 30 s;
[theta] 53[degrees]C, 60 s;
72[degrees]C, 150 s
LPFDF GAACTGTAGATGGGTAC lpfD 94[degrees]C, 30 s;
LPFDR AGCAGGCATAACGCAAG 53[degrees]C, 50 s;
72[degrees]C, 60 s
Donne-280 CGGAACAGTAGGTTCACCTTC efa1 94[degrees]C, 30 s,
Donne-281 AGTGCCCGTGTTCTTGAACTG 50[degrees]C, 30 s;
72[degrees]C, 120 s
EASTOS1 GCCATCAACACAGTATATCCG astA 94[degrees]C, 30 s,
EASTOS2 CGCGAGTGACGGCTTTGTAG 50[degrees]C, 60 s;
72[degrees]C, 90 s
AggRksl GTATACACAAAAGAAGGAAGC aggR 94[degrees]C, 30 s,
AggRkas2 ACAGAATCGTCAGCATCAGC 50[degrees]C, 60 s;
72[degrees]C, 45 s
(f)
Product
Primer Primer sequence (5' to 3') size (bp) Reference
P1 (b) CTGAACGGCGATTACGCGAA
P2 CCAGACGATACGATCCAG 917 (17)
P3 CTGGAGTTGTCGATGTT 1,648 (17)
P4 GTAATTGTGGCACTCC 1,926 (17)
P5 GCCTCTGACATTGTTAC 1,770 (17)
ecsD-lower TATTTTCAAAAAGAATGATGTC [approximately (18)
equal to] 2,990
(d)
SKl (e) CCCGAATTCGGCACAAGCATAAGC
LP5 AGCTCACTCGTAGATGACGGCAAGCG 2,608 (18)
LP6B TAGTTGTACTCCCCTTATCC 2,430 (18)
LP7 TTTATCCTGCTCCGTTTGCT 2,685 (18)
LP8 TAGATGACGGTAAGCGAC 2,590 (18)
LP10 GGCATTGTTATCTGTTGTCT 2,769 (18)
LP11B GTTGATAACTCCTGATATTTTA 2,686 (18)
LPFDF GAACTGTAGATGGGTAC 798 (19)
LPFDR AGCAGGCATAACGCAAG
Donne-280 CGGAACAGTAGGTTCACCTTC 2,226 (20)
Donne-281 AGTGCCCGTGTTCTTGAACTG
EASTOS1 GCCATCAACACAGTATATCCG 109 (10)
EASTOS2 CGCGAGTGACGGCTTTGTAG
AggRksl GTATACACAAAAGAAGGAAGC 254 (21)
AggRkas2 ACAGAATCGTCAGCATCAGC
(a) Before the first cycle, the sample was denatured for 10 min at
95[degrees]C; after the last cycle, the sample was extended for 7
min at 72[degrees]C.
(b) Primer P1 was used as forward primer in all PCR reactions in
combination with P2, P3, P4, and escD-lower.
(c) Conserved region of eae.
(d) Amplicon sequenced.
(e) Primer SK1 was used as forward primer in all PCR reactions
in combination with LP5, LP68, LP7, LP8, LP10, and LP11 B.
(f) 35 cycles.
Table 4. Frequency of Escherichia coli pathotypes in
study participants with and without gastroenteritis
Source
Symptomatic Symptom-free
E. coli pathotype (a) (n = 696) (%) (n = 489) (%) p (b)
EAEC 45 (6.5) 15 (3.1) 0.02
Typical EPEC 2 (0.3) 1 (0.2) NS
Atypical EPEC 89 (12.8) 11 (2.3) <0.0001
EIEC 0 0 NS
ETEC 2 (0.3) 0 NS
EHEC 4 (0.6) 0 NS
STEC not EHEC 0 1 (0.2) NS
(a) EAEC, enteroaggregative E. coli; EPEC, enteropathogenic E. coli;
EIEC, enteroinvasive E. coli; ETEC, enterotoxigenic E. coli; STEC,
Shiga toxin-producing E. coli, EHEC, enterohemorrhagic E. coli;
NS, not significant (p > 0.1).
(b) Fisher exact test, 2-tailed.
Table 5. Characteristics of 22 isolates of atypical
enteropathogenic Escherichia coli identified during
this study
Intimin
Strain Sources Serotype type
W7 N 0161:H40 [beta]
W85-2 N OR:H- [gamma]
W114 N 0107:H8 [iota]
W143 N Ont:H5 [epsilon]
W145 N 055:H6 [gamma]
W154 N 0139:H14 [beta]
W185 N Ont:H21 [theta]
W208 N Ont:H4 [beta]
W761 N 0124:H40 [lambda]
W902 N 0125:H6 [alpha]2
W914 N 0125:H6 [alpha]
W1040 G 015:Hnt [beta]
W1056 G 055:H7 [gamma]
W1068 G 051:H49 [alpha]
W1082 G Ont:H6 [beta]
W1092 G OR:H- [eta]/[epsilon]
W1108 G 0172:H4 [theta]
W1118 G 0126:H6 [alpha]
W1120 G Ont:H34 [alpha]
W1134 G Ont:H6 [theta]
W1585 G Ont:H40 [theta]
W1706 G Ont:H6 [alpha]
E128012 C 0114:H2 [beta]
Result of PCR (b)
Strain bfpA aggR efa1 astA lpfD
W7 - - - - -
W85-2 - - - - -
W114 - - - - -
W143 - - - - -
W145 - - + + -
W154 - - - - -
W185 - - - - -
W208 - - - - -
W761 - - - - -
W902 - - - - -
W914 - - - - -
W1040 - - + - +
W1056 - - + + -
W1068 - - - - -
W1082 - - - - -
W1092 - - - - +
W1108 - - - - -
W1118 - - - - -
W1120 - - - - -
W1134 - - - - -
W1585 - - - - -
W1706 - - - - -
E128012 - - + - +
Adhesion FAS HEp-2 cell
Strain pattern (a) assay invasion (c)
W7 NA - 0.01
W85-2 AA + 0.02
W114 IA + 0.02
W143 IA + <0.01
W145 AA + 0.03
W154 AA + <0.01
W185 IA + 0.02
W208 IA + 0.08
W761 NA - 0.07
W902 IA + 0.06
W914 AA + 0.07
W1040 LAL + 0.10
W1056 IA + 0.77
W1068 AA + <0.01
W1082 AA + 0.01
W1092 IA + <0.01
W1108 IA + 0.03
W1118 IA + 0.01
W1120 IA + 0.01
W1134 NA - 0.01
W1585 NA - 0.02
W1706 AA + 0.01
E128012 IA + 0.32
(a) N, no symptoms; G, gastroenteritis; C, control strain;
Ont, O nontypable (O1-O181); Hnt, H nontypable (H1-H56);
NA, nonadherent; AA, aggregative adherence pattern; IA,
indeterminate adherence pattern; LAL, localized-like
adherence pattern; FAS, fluorescent actin staining.
(b) PCR, polymerase chain reaction; +, positive; -, negative.
(c) Data are the number of bacteria recovered from HEp-2 cells
after treatment with gentamicin as a percentage of the total
number of cell-associated bacteria and are the mean of two
separate assays.
References (1.) Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142-201. (2.) RM. Traditional enteropathogenic Escherichia coli of infantile diarrhea. Rev Infect Dis. 1987;9:28-53. (3.) Trabulsi LR, Keller R, Gomes TAT. Typical and atypical enteropathogenic Escherichia coli. Emerg Infect Dis. 2002;8:508-13. (4.) Bieber D, Ramer SW, Wu CY, Murray WJ, Tobe T, Fernandez R, et al. Type IV pili, transient bacterial aggregates, and virulence of enteropathogenic Escherichia coli. Science. 1998;280:2114-8. (5.) Nougayrede JP, Fernandes PJ, Donnenberg MS. Adhesion of enteropathogenic Escherichia coli to host cells. Cell Microbiol. 2003;5:359-72. (6.) Hellard ME, Sinclair MI, Forbes AB, Fairley CK. A randomized ran·dom·ize tr.v. ran·dom·ized, ran·dom·iz·ing, ran·dom·iz·es To make random in arrangement, especially in order to control the variables in an experiment. , blinded, controlled trial controlled trial Clinical research A clinical study in which one group of participants receives an experimental drug while the other receives either a placebo or an approved–'gold standard' therapy. See Blinding, Double-blinded. investigating the gastrointestinal health effects of drinking water drinking water supply of water available to animals for drinking supplied via nipples, in troughs, dams, ponds and larger natural water sources; an insufficient supply leads to dehydration; it can be the source of infection, e.g. leptospirosis, salmonellosis, or of poisoning, e.g. quality. Environ Health Perspect. 2001;109:773-8. (7.) Hellard ME, Sinclair MI, Hogg hogg castrated male sheep usually 10 to 14 months old. Also used to describe an uncastrated male pig. GG, Fairley CK. Prevalence of enteric enteric /en·ter·ic/ (en-ter´ik) within or pertaining to the small intestine. en·ter·ic adj. 1. Of, relating to, or within the intestine. 2. pathogens among community based asymptomatic individuals. J Gastroenterol Hepatol. 2000; 15:290-3. (8.) Paton AW, Paton JC. Detection and characterization of Shiga toxigenic toxigenic /tox·i·gen·ic/ (tok?si-jen´ik) 1. producing or elaborating toxins. 2. derived from or containing toxins. tox·i·gen·ic adj. Producing a poison; toxicogenic. Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111 , and rfbO157. J Clin Microbiol. 1998;36:598-602. (9.) Schultsz C, Pool G J, van Ketel R, de Wever B, Speelman P, Dankert J. Detection of enterotoxigenic Escherichia coli Enterotoxigenic Escherichia Coli (ETEC) is a type of Escherichia coli that can cause Traveler's diarrhea. A number of pathogenic isolates are termed ETEC, but the main hallmarks of this type of bacteria are expression of one or more enterotoxins and presence of in stool samples by using nonradioactively labeled oligonucleotide DNA probes and PCR. J Clin Microbiol. 1994;32:2393-7. (10.) Schmidt H, Knop knop n. A small decorative knob or boss. [Middle English knopp, knoppe, from Old English cnop.] C, Franke S, Aleksic S, Heesemann J, Karch H. Development of PCR for screening of enteroaggregative Escherichia coli. J Clin Microbiol. 1995;33:701-5. (11.) Vial PA, Mathewson JJ, Guers L, Levine MM, DuPont HL. Comparison of two assay methods for patterns of adherence to HEp-2 cells of Escherichia coli from patients with diarrhea. J Clin Microbiol. 1990;28:882-5. (12.) Levine MM, Nataro JP, Karch H, Baldini MM, Kaper JB, Black RE, et al. The diarrheal response of humans to some classic serotypes of enteropathogenic Escherichia coli is dependent on a plasmid encoding an enteroadhesiveness factor. J Infect Dis. 1985;152:550-9. (13.) Wood PK, Morris JG Jr, Small PLC, Sethabutr O, Toledo MRF MRF Markov Random Field MRF Material Recovery Facility MRF Materials Recycling Facility MRF Motorcycle Riders Foundation MRF Medium Range Forecast (weather forecasting model) MRF Movement for Rights and Freedoms , Trabulsi L, et al. Comparison of DNA probes and the Sereny test Sereny test a test of the invasiveness of bacterium. The organism is inoculated into the conjunctival sac of a guinea pig; invasiveness is measured by the occurrence of a keratoconjunctivitis within 24 hours. for identification of invasive Shigella and Escherichia coli strains. J Clin Microbiol. 1986;24:498-500. (14.) Satterwhite TK, Evans DG, DuPont HL, Evans DJ Jr. Role of Escherichia coli colonisation factor antigen in acute diarrhoea. Lancet. 1978;2:181-4. (15.) Perna NT, Plunkett G, Burland V, Mau B, Glasner JD, Rose DJ, et al. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature. 2001;409:529-33. (16.) Bettelheim KA, Thompson CJ. New method of serotyping Escherichia coli: implementation and verification. J Clin Microbiol. 1987;25:781-6. (17.) Reid SD, Betting DJ, Whittam TS. Molecular detection and identification of intimin alleles in pathogenic Escherichia coli by multiplex PCR. J Clin Microbiol. 1999;37:2719-22. (18.) Zhang WL, Kohler B, Oswald E, Beutin L, Karch H, Morabito S, et al. Genetic diversity of intimin genes of attaching and effacing Escherichia coli strains. J Clin Microbiol. 2002;40:4486-92. (19.) Newton HJ, Sloan J, Bennett-Wood V, Adams LM, Robins-Browne RM, Hartland EL. Contribution of long polar fimbriae to the virulence of rabbit-specific enteropathogenic Escherichia coli. Infect Immun. 2004;72:1230-7. (20.) Klapproth JM, Scaletsky IC, McNamara BP, Lai LC, Malstrom C, James SP, et al. A large toxin from pathogenic Escherichia coli strains that inhibits lymphocyte lymphocyte: see blood; immunity. lymphocyte Type of leukocyte fundamental to the immune system, regulating and participating in acquired immunity. Each has receptor molecules on its surface that bind to a specific antigen. activation. Infect Immun. 2000;68:2148-55. (21.) Yatsuyanagi J, Saito S, Sato H, Miyajima Y, Amano K, Enomoto K. Characterization of enteropathogenic and enteroaggregative Escherichia coli isolated from diarrheal outbreaks. J Clin Microbiol. 2002;40:294-7. (22.) Knutton S, Phillips AD, Smith HR, Gross RJ, Shaw R, Watson P, et al. Screening for enteropathogenic Escherichia coli in infants with diarrhea by the fluorescent-actin staining test. Infect Immun. 1991;59:365-71. (23.) McDaniel TK, Jarvis KG, Donnenberg MS, Kaper JB. A genetic locus of enterocyte effacement The Locus of Enterocyte Effacement (LEE) is a pathogenicity island consisting of 35,000 base pairs in the bacteria Escherichia coli genome. The LEE encodes the Type III secretion system and Type III secreted proteins which are toxins responsible for attaching and effacing conserved among diverse enterobacterial pathogens. Proc Natl Acad Sci U S A. 1995;92:1664-8. (24.) Robins-Browne RM, Bennett-Wood V. Quantitative assessment of the ability of Escherichia coli to invade cultured animal cells. Microb Pathog. 1992; 12:159-64. (25.) Nicholls L, Grant TH, Robins-Browne RM. Identification of a novel locus that is required for in vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment. in vi·tro adj. In an artificial environment outside a living organism. adhesion of a clinical isolate of enterohaemorrhagic Eseherichia coli to epithelial cells. Mol Microbiol. 2000;35:275-88. (26.) Yatsuyanagi J, Saito S, Miyajima Y, Amano K, Enomoto K. Characterization of atypical enteropathogenic Eseherichia coli strains harboring the astA gene that were associated with a waterborne outbreak of diarrhea in Japan. J Clin Microbiol. 2003;41:2033-9. (27.) Scaletsky IC, Pedroso MZ, Oliva CA, Carvalho RL, Morais MB, Fagundes-Neto U. A localized adherence-like pattern as a second pattern of adherence of classic enteropathogenic Escherichia coli to HEp-2 cells that is associated with infantile diarrhea. Infect Immun. 1999;67:3410-5. (28.) Pelayo JS, Scaletsky IC, Pedroso MZ, Sperandio V, Giron JA, Frankel G, et al. Virulence properties of atypical EPEC strains. J Med Microbiol. 1999;48:41-9. (29.) Feng P, Lampel KA, Karch H, Whittam TS. Genotypic genotypic emanating from or pertaining to genotype. genotypic selection selection of breeding stock on the basis of known inherited characteristics. and phenotypic changes in the emergence of Escherichia coli O157:H7. J Infect Dis. 1998;177:1750-3. (30.) Marshall JA, Hellard ME, Sinclair MI, Fairley CK, Cox B J, Catton MG, et al. Incidence and characteristics of endemic Norwalk-like virus-associated gastroenteritis. J Med Virol. 2003;69:568-78. (31.) Viljanen MK, Peltola T, Junnila SY, Olkkonen L, Jarvinen H, Kuistila M, et al. Outbreak of diarrhoea due to Escherichia coli O111 :B4 in schoolchildren schoolchildren school npl → écoliers mpl; (at secondary school) → collégiens mpl; lycéens mpl schoolchildren school and adults: association of Vi antigen-like reactivity. Lancet. 1990;336:831-4. (32.) Bouzari S, Jafari MN, Shokouhi F, Parsi M, Jafari A. Virulence-related DNA sequences and adherence patterns in strains of enteropathogenic Escherichia coli. FEMS FEMS Federation of European Microbiological Societies FEMS Federation of European Materials Societies FEMS Fabrication Engineering Management System FEMS Facility Equipment Maintenance System (PMEL/TMDE) Microbiol Lett. 2000;185:8943. (33.) Galane PM, Le Roux Roux , Pierre Paul Émile 1853-1933. French bacteriologist. His work with the diphtheria bacillus led to the development of antitoxins to neutralize pathogenic toxins. M. Molecular epidemiology molecular epidemiology Molecular medicine An evolving field that combines the tools of standard epidemiology–case studies, questionnaires and monitoring of exposure to external factors with the tools of molecular biology–eg, restriction endonucleases, of Escherichia coli isolated from young South African children with diarrhoeal diseases. J Health Popul Nutr. 2001;19:31-8. (34.) Knutton S, Shaw R, Phillips AD, Smith HR, Willshaw GA, Watson P, et al. Phenotypic and genetic analysis of diarrhea-associated Escherichia coli isolated from children in the United Kingdom. J Pediatr Gastroenterol Nutr. 2001;33:32-40. (35.) Paciorek J. Virulence properties of Escherichia coli faecal fae·cal adj. Chiefly British Variant of fecal. Adj. 1. faecal - of or relating to feces; "fecal matter" fecal strains isolated in Poland from healthy children and strains belonging to serogroups O18, O26, O44, O86, O126 and O127 isolated from children with diarrhoea. J Med Microbiol. 2002;51:548-56. (36.) Kukuruzovic R, Robins-Browne RM, Anstey NM, Brewster DR. Enteric pathogens, intestinal permeability and nitric oxide nitric oxide or nitrogen monoxide, a colorless gas formed by the combustion of nitrogen and oxygen as given by the reaction: energy + N2 + O2 → 2NO; m.p. −163.6°C;; b.p. −151.8°C;. production in acute gastroenteritis. Pediatr Infect Dis J. 2002;21:730-9. (37.) Robins-Browne RM, Yam WC, O'Gorman LE, Bettelheim KA. Examination of archetypal ar·che·type n. 1. An original model or type after which other similar things are patterned; a prototype: "'Frankenstein' . . . 'Dracula' . . . 'Dr. Jekyll and Mr. Hyde' . . . strains of enteropathogenic Escherichia coli for properties associated with bacterial virulence. J Med Microbiol. 1993;38:222-6. (38.) Yamamoto T, Taneike I. The sequences of enterohemorrhagic Escherichia coli enterohemorrhagic Escherichia coli EHEC Any of the E coli serotypes–eg O29, O39, O145 that produces shiga-like toxins, causing bloody inflammatory diarrhea, evoking a HUS. See Escherichia coli O157:H7, Hemolytic uremic syndrome. and Yersinia pestis Yersinia pes·tis n. A bacterium that causes plague and is transmitted from rats to humans by the rat flea Xenopsylla cheopis. Also called Pasteurella pestis. that are homologous homologous /ho·mol·o·gous/ (ho-mol´ah-gus) 1. corresponding in structure, position, origin, etc. 2. allogeneic. ho·mol·o·gous adj. 1. to the enteroaggregative E. coli heat-stable enterotoxin gene: cross-species transfer in evolution. FEBS FEBS Federation of European Biochemical Societies Lett. 2000;472:22-6. (39.) Beutin L, Marches O, Bettelheim KA, Gleier K, Zimmermann S, Schmidt H, et al. HEp-2 cell adherence, actin aggregation, and intimin types of attaching and effacing Escherichia eoli strains isolated from healthy infants in Germany and Australia. Infect Immun. 2003;71:3995-4002. (40.) Vieira MA, Andrade JR, Trabulsi LR, Rosa AC, Dias AM, Ramos SR, et al. Phenotypic and genotypic characteristics of Escherichia coli strains of non-enteropathogenic E. coli (EPEC) serogroups that carry EAE and lack the EPEC adherence factor and Shiga toxin DNA probe sequences. J Infect Dis. 2001;183:762-72. (41.) Francis CL, Jerse AE, Kaper JB, Falkow S. Characterization on interactions of enteropathogenic Escherichia coli O127:H6 with mammalian cells in vitro. J Infect Dis. 1991;164:693-703. Address for correspondence: R.M. Robins-Browne, Department of Microbiology and Immunology, University of Melbourne, Melbourne, Victoria 3010, Australia; fax: +61-3-8344-8276; email: r.browne@ unimelb.edu.au Roy M. Robins-Browne, * ([dagger]) Anne-Marie Bordun, * ([dagger]) Marija Tauschek, * Vicki R. Bennett-Wood, * ([dagger]) Jacinta Russell, ([dagger]) Frances Oppedisano, ([dagger]) Nicole A. Lister, * Karl A. Bettelheim, * Christopher K. Fairley, * Martha I. Sinclair, ([double dagger double dagger n. A reference mark ( ) used in printing and writing. Also called diesis.Noun 1. ]) and Margaret E. Hellard ([double dagger]) (1) (1) Current affiliation: Burnet Institute The Burnet Institute is Australia's largest communicable diseases research institute. It was founded in Melbourne in 1986 and named after Australian Nobel laureate Frank Macfarlane Burnet. , Melbourne, Victoria, Australia. * University of Melbourne, Melbourne, Victoria, Australia; ([dagger]) Murdoch Childrens Research Institute, Melbourne, Victoria, Australia; and ([double dagger]) Monash University Facilities in are diverse and vary in services offered. Information on residential sevices at Monash University, including on-campus (MRS managed) and off-campus, can be found at [2] Student organisations , Melbourne, Victoria, Australia |
|
||||||||||||||||||||

) used in printing and writing. Also called diesis.
Printer friendly
Cite/link
Email
Feedback
Reader Opinion