Errata.Vol. 6, No. 5 In the article, "Prevalence of Non-O157:H7 Shiga Shiga (shē`gä), prefecture (1990 pop. 1,222,401), S Honshu, Japan. Otsu (the capital) and Hikone are the chief cities. It is predominantly an agricultural region, with rice the principal crop. Textile manufacturing and cattle raising are important. Shiga includes part of Biwa, Japan's largest lake. Toxin-Producing Escherichia coli in Diarrheal Stool Samples from Nebraska," by Paul D. Fey et al., an error occurred in reporting a primer used for amplifying the shiga-toxin gene. The first complete sentence at the top of column 1, page 531, should read, "The following set of primers, which detects both [stx.sub.1] and [stx.sub.2], was used: 5' TTTACGATAGACTTCTCGAC 3' and 5' CACATATAAATTATTTCGCTC 3'." We regret any confusion this error may have caused. Vol. 7, No. 1 In the International Update "Emerging Infectious Diseases in Russia, 1990-1999," by Sergey V. Netesov and J. Lyle Conrad, the area of Russia is given incorrectly. The area should be approximately 17,075,000 [km.sup.2]. We regret this error. Vol. 7, No. 1 In the article "Quinolone quinolone /quin·o·lone/ (kwin´o-lon) any of a group of synthetic antibacterial agents that includes nalidixic acid and the fluoroquinolones. quin·o·lone (kw  n and Macrolide 1. a compound characterized by a large lactone ring with multiple keto and hydroxyl groups. 2. any of a group of antibiotics containing this ring linked to one or more sugars, produced by certain species of Streptomyces. mac·ro·lide (m Resistance in Campylobacter Campylobacter /Cam·py·lo·bac·ter/ (kam´pi-lo-bak´ter) a genus of bacteria, family Spirillaceae, made up of gram-negative, non–spore-forming, motile, spirally curved rods, which are microaerophilic to anaerobic. C. jeju´ni, C. co´li, and certain subspecies of C. fe´tus can cause gastroenteritis; C. rec´tus is associated with periodontal disease.. jejuni and C. coli: Resistance Mechanisms and Trends in Human Isolates," Figure 1, page 25, the genes should have been referred to as follows: gyrA and parC. In addition, Thr Thr threonine. Thr abbr. -90 should have been Asp-90. To view the correct figure, see URL: http://www.cdc.gov/ncidod/EID/ vol7no3/erratum.htm. We regret any confusion this error may have caused.
threonine |
|
||||||||||||||||||||
Printer friendly
Cite/link
Email
Feedback
Reader Opinion