Printer Friendly
The Free Library
14,693,900 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Eighth major clade for hepatitis delta virus.


Hepatitis delta virus hepatitis delta virus
n.
Causative agent of acute or chronic viral hepatitis type D. Also called delta agent, delta antigen.
 is the only representative of the Deltavirus genus, which consists of 7 differentiated major clades. In this study, an eighth clade clade Cladus, subtype Genetics A branch of biological taxa or species that share features inherited from a common ancestor; a single phylogenetic group or line. See Inheritance, Species.  was identified from 3 distinct strains. Deltavirus genetic variability Introduction
Genetic Variability
The amount by which individuals in a population differ from one another due to their genes, rather than their environment. The study of genetic variability is that of population genetics.
 should be considered for diagnostic purposes. Clinical consequences of the diversity have yet to be evaluated.

**********

Hepatitis delta virus (HDV (High Definition Video) The high-definition, wide screen version of the DV magnetic tape format. Like DV, HDV recording moves at a constant data rate and stores data on the same DV and MiniDV tapes as SD camcorders. ) is a subviral agent that can lead to severe acute and chronic forms of liver disease Liver Disease Definition

Liver disease is a general term for any damage that reduces the functioning of the liver.
Description

The liver is a large, solid organ located in the upper right-hand side of the abdomen.
 in association with hepatitis B Hepatitis B Definition

Hepatitis B is a potentially serious form of liver inflammation due to infection by the hepatitis B virus (HBV). It occurs in both rapidly developing (acute) and long-lasting (chronic) forms, and is one of the most common chronic
 virus. Delta hepatitis delta hepatitis
n.
See hepatitis D.
 is highly endemic to several African countries, the Amazonian region, and the Middle East, while its prevalence is low in industrialized in·dus·tri·al·ize  
v. in·dus·tri·al·ized, in·dus·tri·al·iz·ing, in·dus·tri·al·iz·es

v.tr.
1. To develop industry in (a country or society, for example).

2.
 countries, except in the Mediterranean. The HDV genome is a circular, single-stranded RNA virus RNA virus
n.
Any of a group of viruses whose nucleic acid core is composed of RNA, including the picornaviruses, retroviruses, and paramyxoviruses.
 that ranges from 1,672 (strain dFr45, accession number Accession number may mean:
  • Accession number (bioinformatics), a unique identifier given to a biological polymer sequence (DNA, protein) when it is submitted to a sequence database.
 AX741144) to 1,697 nucleotides (dFr47, AX741149) (1). A unique open reading flame encodes the small and large hepatitis delta Noun 1. hepatitis delta - a severe form of hepatitis
delta hepatitis

hepatitis - inflammation of the liver caused by a virus or a toxin
 (sHD and 1HD, respectively) antigens by way of an editing step in the hepatocyte hepatocyte /hep·a·to·cyte/ (hep´ah-to-sit?) a hepatic cell.

hep·a·to·cyte
n.
A parenchymal liver cell.


Hepatocyte
A liver cell.
 nucleus (2). Recent extensive analyses of HDV sequences from strains isolated from patients of African origin have shown a high genetic diversity of HDVs. To date, 7 major clades have been individualized in·di·vid·u·al·ize  
tr.v. in·di·vid·u·al·ized, in·di·vid·u·al·iz·ing, in·di·vid·u·al·iz·es
1. To give individuality to.

2. To consider or treat individually; particularize.

3.
 with strong phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 support; their proposed labels are HDV-1 to HDV-7 (1).

The genetic diversity of HDV is related to the geographic origin of the isolates. Apart from HDV-1, which is ubiquitous, each virus clade is geographically localized: HDV-2 (previously labeled HDV-IIa) is found in Japan (3), Taiwan (4), and Yakoutia, Russia (5); HDV-4 (previously labeled HDV-IIb) in Taiwan (6) and Japan (7,8); HDV-3 in the Amazonian region (9); and HDV-5, HDV-6, and HDV-7 in Africa. The eventuality of a genetic diversity extended to more than 7 clades has been mentioned by Radjef et al., who characterized a sequence (dFr644) that was not strongly affiliated to any of the 7 HDV clades (1). We describe 2 HDV isolates (dFr2072 and dFr2736) that have robust phylogenetic relation Noun 1. phylogenetic relation - (biology) state of relationship between organisms or groups of organisms resulting in resemblance in structure or structural parts; "in anatomical structure prehistoric man shows close affinity with modern humans"
affinity
 to dFr644 and, therefore, propose an extended classification of the Deltavirus genus to 8 clades.

The Study

Strains dFr2072 and dFr2736 were isolated from 2 patients originating from Senegal and Cote d'Ivoire, respectively. The patients were living in France when chronic delta hepatitis was diagnosed; however, because no risk factors were identified, each patient was suspected to have been infected during childhood in Africa.

Full-length HDV genome sequences from isolates dFr2072 and dFr2736 were characterized to determine their genetic affiliation. HDV RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 extraction and cDNA synthesis were performed as previously described (5), and 4 overlapping regions of the genome were amplified (Table 1). Amplicons were sequenced bidirectionally with the BigDye Terminator v3.1 Sequencing Kit (Applied Biosystems Applied Biosystems, Inc. (formerly NASDAQ: ABIO) is the original name of a pioneer biotechnology company founded in 1981 in Foster City, California, among the Silicon Valley cities of the southern San Francisco Bay Area. , Courtaboeuf, France).

In a first approach, the complete dFr2072 and dFr2736 sequences were aligned with 41 complete genome sequences gathering all of the 7 HDV clades, plus sequence dFr644. The sequence alignment was generated in 2 ways: 1 with ClustalX using a gap-opening penalty (GOP) of 15 and a gap-extension penalty (GEP GEP

gastroenteropancreatic.
) of 6.66 and 1 with the SOAP program (http://evollinuxl.ulb.ac.be/ueg/SOAP/) (GOP from 12 to 17 in steps of 0.5; GEP from 6 to 8 in steps of 1). Phylogenetic analyses were performed with PAUP PAUP Phylogenetic Analysis Using Parsimony *4.0[beta]10 (Sinauer Associates, Inc., Sunderland, MA, USA) from a SOAP sequence alignment that excluded 833 unstable characters. Neighbor-joining (NJ) distance and maximum parsimony Maximum parsimony, often simply referred to as "parsimony," is a non-parametric statistical method commonly used in computational phylogenetics for estimating phylogenies. Under maximum parsimony, the preferred phylogenetic tree is the tree that requires the least number of  (MP) analyses were performed. The robustness of the topologic features was determined by bootstrap See boot.

(operating system, compiler) bootstrap - To load and initialise the operating system on a computer. Normally abbreviated to "boot". From the curious expression "to pull oneself up by one's bootstraps", one of the legendary feats of Baron von Munchhausen.
 methods ([10.sup.3] replicates for NJ and MP). A Bayesian approach (11) was also used on the data matrix: 5,000 trees were initially built by using the MrBayes program, version 3.0 [beta]4, from 2x[10.sup.6] generations, and the first 250 trees were burned. A majority rule consensus tree was obtained by using PAUP*4.0 [beta]10. Parameters specified during MrBayes analysis (Table 2) were also imported into PAUP*4.0 [beta]10 for a maximum likelihood (ML) analysis using the general time reversible model with a gamma distribution.

An 89.4% similarity score was observed between dFr644, dFr2072, and dFr2736, which allowed these 3 sequences to be grouped inside the same genotype. By contrast, the similarity obtained among dFr644, dFr2072, and dFr2736 and the sequences representative of HDV-1 to HDV-7 was <76.4% (Figure 1). On the phylogenetic tree built from the ML data (Figure 2), isolates dFr644, dFr2072, and dFr2736 appeared as a monophyletic monophyletic /mono·phy·let·ic/ (mon?o-fi-let´ik) descended from a common ancestor or stem cell.

mon·o·phy·let·ic
adj.
1. Descended or derived from one original stock or source.
 group, with bootstrap values of 100 (NJ and MP) and a posterior probability value of 100 (MrBayes).

Because of claims that the slid protein trans-complements the corresponding HDV type more efficiently (12), we compared the sHD coding nucleotide sequences of dFr644, dFr2072, and dFr2736 with 46 sequences, by using the same phylogenetic approaches (Table 2). Analysis of the sHD genes confirmed the results obtained with the full-length sequences, showing 93.8% similarity between dFr644, dFr2072, and dFr2736 versus only 70.8%-82.9% when compared with sequences of the other genotypes (Figure 1). Bootstrap values of 100 (NJ and MP) and posterior probability values of 100 (MrBayes) were obtained and are represented on the phylogenetic tree built from the ML parameters (Figure 2). Taken together, these results fulfill the recommendations for the designation of a major clade (i.e., [greater than or equal to] 3 distinct isolates repeatedly showing high scores of similarity and high bootstrap values [13]). Thus, we define an eighth major clade among the Deltavirus genus.

[FIGURE 2 OMITTED]

Conclusions

In this study, an eighth HDV clade (HDV-8) was identified from 3 complete sequences obtained from strains isolated from patients of African origin. Isolate dFr644, originating from Congo-Brazzaville, was initially described by Radjef et al. and tentatively affiliated with HDV-7 (bootstrap value 84, posterior probability value 97), despite a similarity of only 77.8% with the other HDV-7 sequences (1). Isolates dFr2072 and dFr2736 presented similarity of 89.4% with dFr644 and only 76.4% with HDV-7 sequences. Thus, an additional lineage was individualized, bringing the number of HDV clades with a probable African origin to 4.

Since 1999, a total of 468 HDV isolates collected in France were analyzed in our laboratory for phylogenetic characterization of the R0 region (defined in Table 1). Of these, 98 isolates (21%) were affiliated with HDV-5 (15.2%), HDV-6 (1.7%), HDV-7 (3.0%), or HDV-8 (1.1%) (Paul Deny, unpub data). The 98 corresponding patients were all of African origin. By contrast, all patients of European origin were specifically infected by HDV-1 isolates. To date, no evidence exists that HDV-5, -6, -7 or -8 circulates among native populations in France. These results strongly suggest the African origin of these viruses. Nevertheless, epidemiologic studies in Africa should be carried out to specify the prevalence and geographic distribution of all HDV clades. If the African origin of HDV-5, -6, -7 and -8 viruses is confirmed, detection of these clades in France among local populations would reveal an emerging process that should be anticipated in epidemiologic surveys. Thus, the molecular assays used for diagnostic purposes should rely on primers and probes defined in the most conserved regions of the HDV genome to avoid false-negative results (5,14,15).

In conclusion, the Deltavirus genus includes at least 8 major clades, with specific geographic distribution. Future development of molecular assays for diagnosis of delta hepatitis should take into account this high genetic variability. The relationship between HDV diversity and pathogenesis has previously been suggested (7,9) but remains to be clarified by taking into account the extension of the diversity. Treatment of chronic delta hepatitis, which relies on long-term administration of high doses of interferon-alpha, is not very effective (16). It is not known whether some HDV genotypes might be more susceptible to therapy than others, as has been described for chronic hepatitis Chronic hepatitis
Long lasting inflammation of the liver due to viruses or other causes.

Mentioned in: Tube Compression of the Esophagus and Stomach

chronic hepatitis 
 C (17). Thus, the clinical effect of HDV diversity, in terms of severity of disease and response to therapy, remains to be determined.

Acknowledgments

We are grateful to Nadjia Radjef and Patricia Anais for their initial description of strain dFr644. We are indebted to John Casey for providing the sHD genetic sequence of 3 HDV-3 strains (Peru4291, Peru233, and Peru8441).

F.L. was supported by the Assistance Publique--Hopitaux de Paris. This work is part of the program of the Laboratoire Associe au Centre de Reference des Hepatites B, C, et Delta, supported by the French Ministry of Health and the Institut de Veille Sanitaire The French Institut de veille sanitaire (Sanitary Surveillance Institute) is a Health minister public establishment. Its mission is to survey the health of the population and, if required (for example in the case of an epidemics), to alert the administration, health .

References

(1.) Radjef N, Gordien E, Ivaniushina V, Gault n. 1. (Geol.) A series of beds of clay and marl in the South of England, between the upper and lower greensand of the Cretaceous period.  E, Anais P, Drugan T, et al. Molecular phylogenetic analyses indicate a wide and ancient radiation of African hepatitis delta virus, suggesting a deltavirus genus of at least seven major clades. J Virol. 2004;78:2537-44.

(2.) Casey JL. RNA editing in hepatitis delta virus genotype III requires a branched double-hairpin RNA structure. J Virol. 2002;76:7385-97.

(3.) Imazeki F, Omata M, Ohto M. Heterogeneity and evolution rates of delta virus delta virus

hepatitis D virus.
 RNA sequences. J Virol. 1990;64:5594-9.

(4.) Wu JC, Chen CM, Sheen I J, Lee SD, Tzeng HM, Choo KB. Evidence of transmission of hepatitis D Hepatitis D Definition

Hepatitis D (or delta, the Greek letter "D"), is a form of liver inflammation that occurs only in patients who also are infected by the hepatitis B virus.
 virus to spouses from sequence analysis of the viral genome. Hepatology. 1995;22:1656-60.

(5.) Ivaniushina V, Radjef N, Alexeeva M, Gault E, Semenov S, Salhi M, et al. Hepatitis delta virus genotypes I and II cocirculate in an endemic area Endemic area
A geographical region where a particular disease is prevalent.

Mentioned in: Leprosy, Scrub Typhus
 of Yakutia, Russia. J Gen Virol. 2001;82:2709-18.

(6.) Wu JC, Chiang TY, Sheen IJ. Characterization and phylogenetic analysis of a novel hepatitis D virus strain discovered by restriction fragment length polymorphism restriction fragment length polymorphism
n. Abbr. RFLP
Intraspecies variations in the length of DNA fragments generated by the action of restriction enzymes and caused by mutations that alter the sites at which these enzymes act, changing
 analysis. J Gen Virol. 1998;79:1105-13.

(7.) Sakugawa H, Nakasone H, Nakayoshi T, Kawakami Y, Miyazato S, Kinjo F, et al. Hepatitis delta virus genotype IIb predominates in an endemic area, Okinawa, Japan. J Med Virol. 1999;58:366-72.

(8.) Watanabe H, Nagayama K, Enomoto N, Chinzei R, Yamashiro T, Izumi N, et al. Chronic hepatitis delta virus infection with genotype lib variant is correlated with progressive liver disease. J Gen Virol. 2003;84:3275-89.

(9.) Casey JL, Brown TL, Colan EJ, Wignall FS, Gerin JL. A genotype of hepatitis D virus that occurs in northern South America Northern South America is a region in the continent South America. This region has a rich range of natural resources exploited to European explorers over the past couple of centuries. Most of the most populous cities, such as Bogotá, are located temperate conditions of the Andes. . Proc Natl Acad Sci U S A. 1993;90:9016-20.

(10.) Wang KS, Choo QL, Weiner AJ, Ou JH, Najarian RC, Thayer RM, et al. Structure, sequence and expression of the hepatitis delta (delta) viral genome. Nature. 1986;323:508-14.

(11.) Huelsenbeck JR Ronquist FR. MRBAYES: Bayesian inference of phylogeny. Biochemistry. 2006. In press.

(12.) Casey JL, Gerin JL. Genotype-specific complementation Complementation (genetics)

The complementary action of different genetic factors. The term usually implies two homologous chromosomes or chromosome sets, each defective because of mutation and unable by itself to promote the normal development or metabolism of
 of hepatitis delta virus RNA replication by hepatitis delta antigen. J Virol. 1998;72:2806-14.

(13.) Simmonds P, Bukh J, Comber comb·er  
n.
1. One, such as a machine or a worker, that combs something, such as wool.

2. A long wave that has reached its peak or broken into foam; a breaker.
 C, Deleage G, Enomoto N, Feinstone S, et al. Consensus proposals for a unified system of nomenclature of hepatitis C virus
This page is for the virus. For the disease, see Hepatitis C.
The Hepatitis C virus (HCV) is a small (50 nm in size), enveloped, single-stranded, positive sense RNA virus in the family Flaviviridae.
 genotypes. Hepatology. 2005;42:962-73.

(14.) Le Gal F, Gordien E, Affolabi D, Hanslik T, Alloui C, Deny P, et al. Quantification of hepatitis delta virus RNA in serum by consensus real-time PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 indicates different patterns of virological virological

pertaining to viruses.
 response to interferon therapy in chronically infected patients. J Clin Microbiol. 2005;43:2363-9.

(15.) Modahl LE, Lai MM. Hepatitis delta virus: the molecular basis of laboratory diagnosis. Crit Rev Clin Lab Sci. 2000;37:45-92.

(16.) Niro GA, Rosina F, Rizzetto M. Treatment of hepatitis D. J Viral Hepat. 2005;12:2-9.

(17.) Martinot-Peignoux M, Marcellin P, Pouteau M, Castelnau C, Boyer N, Poliquin M, et al. Pretreatment pretreatment,
n the protocols required before beginning therapy, usually of a diagnostic nature; before treatment.

pretreatment estimate,
n See predetermination.
 serum hepatitis serum hepatitis
n.
Abbr. SH See hepatitis B.
 C virus RNA levels and hepatitis C virus genotype are the main and independent prognostic factors of sustained response to interferon alfa therapy in chronic hepatitis C. Hepatology. 1995;22:1050-6.

Frederic Le Gal, * (1) Elyanne Gault, * (1) Marie-Pierre Ripault, ([dagger]) Jeanne Serpaggi, ([double dagger]) Jean-Claude Trinchet, ([section]) Emmanuel Gordien, * and Paul Deny *

* Hopital Avicenne and EA3406, Universite Paris 13, Bobigny, France; ([dagger]) Hopital Saint-Louis, Assistance Publique--Hopitaux de Paris, Paris, France; ([double dagger]) Hopital Necker, Assistance Publique--Hopitaux de Paris, Paris, France; and ([section]) Hopital Jean Verdier, Assistance Publique--Hopitaux de Paris, Bondy, France

(1) These authors contributed equally to this work.

Mr Le Gal is a PhD student in the Laboratoire Associe an Centre de Reference des Hepatites B, C, et Delta. His primary research interest is the genetic diversity of HDV and its consequences on the epidemiology of delta virus and on diagnostic applications.

Address for correspondence: Paul Deny, Laboratoire de Bacteriologie, Virologie, Hygiene, Hopital Avicenne, Universite Paris 13, 93009 Bobigny CEDEX, France; email: paul.deny@avc.aphp.fr
Table 1. Four overlapping regions amplified by reverse
transcription--PCR for full-length genome sequence determination

Region*          Primer         Primer      Nucleotide sequence of
             name ([dagger])   position       the primers (5'-3')

R0                889s          889-911     CATGCCGACCCGAAGAGGAAAG
(889-1289)       1289as        1289-1265   GAAGGAAAGGCCCTCGAGAACAAGA
R'1               305s          305-328    CTCCAGAGGACCCCTTCAGCGAAC
(305-1161)       1161 as       1161-1138   CCCGCGGGTTGGGGATGTGAACCC
R'2               962s          962-984     GTACACTCGAGGAGTGGAAGGCG
(962-331)        331 as         331-311      TCTGTTCGCTGAAGGGGTCCT
R'3               120s          120-140      GTCCCAAGAGGGCGAGGGGAG
(120-619)         620as         619-600      TCCTGGAGCCGGCAGTCCGG

* Name of the amplified region and position on the genome (according
to Wang et al. [101).

([dagger]) s, forward primer, as, reverse primer.

Table 2. Parameters specified by MrBayes (version 3.0[beta]4)
application

                                   Substitution rate matrix *

Sequences                G/T     C/T     C/G     A/T     A/G     A/C

Full length             1.000   2.733   0.681   1.344   3.011   0.847
sHD ([double dagger])   1.000   6.687   0.926   2.221   3.550   1.519

                                 Nucleotide frequencies

Sequences               pi(A)   pi (C)  pi (G)  pi(T)    [alpha]
                                                        ([dagger])

Full length             0.200   0.304   0.288   0.208     0.526
sHD ([double dagger])   0.322   0.216   0.361   0.101     0.434

* Each substitution rate is expressed as compared with the G/T
substitution rate.

([dagger]) Parameter [alpha] is the shape parameter of they
distribution.

([double dagger]) Small hepatitis delta nucleotide sequence.

Figure 1. Percent similarity between hepatitis delta virus (HDV)
genotypes calculated from complete and small hepatitis delta
(sHD) nucleotide sequences. Above the oblique line are represented
scores of similarity obtained from alignment and comparison of
49 sHD nucleotide sequences including 13 HDV-1 sequences, 7
HDV-2, 7 HDV-3, 6 HDV-4, 6 HDV-5, 4 HDV-6, 3 HDV-7, and 3
HDV-8. Below the oblique line are represented scores of similarity
obtained from alignment and comparison of 44 complete
nucleotide sequences including 13 HDV-1 sequences, 7 HDV-2, 4
HDV-3, 6 HDV-4, 6 HDV-5, 3 HDV-6, 2 HDV-7, and 3 HDV-8. Gray
cells show the similarities within each genotype.

Genotype   HDV-1   HDV-2   HDV-3   HDV-4

HDV-1      89.1    81.2    73.2    80.1
           81.9
HDV-2              91.8    73.3    81.9
           74.4    83.4
HDV-3                      92.3    73.5
           65.0    65.6    83.3
HDV-4                              93.7
           73.5    75.9    66.3    85.5
HDV-5
           72.1    75.9    64.1    75.0
HDV-6
           72.0    73.9    65.8    73.4
HDV-7
           71.4    73.1    64.4    73.8
HDV-8
           72.6    74.7    64.4    75.1

Genotype   HDV-5   HDV-6   HDV-7   HDV-8

HDV-1      78.3    78.0    77.6    78.6

HDV-2      83.6    79.5    79.0    82.0

HDV-3      72.5    72.9    72.4    70.8

HDV-4      80.4    78.1    78.0    80.3

HDV-5      90.9    80.7    81.3    82.9
           83.4
HDV-6              91.7    77.6    80.5
           74.5    81.7
HDV-7                      89.9    81.1
           74.6    71.5    85.1
HDV-8                              93.8
           74.9    73.5    76.4    89.4
COPYRIGHT 2006 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2006, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:DISPATCHES
Author:Deny, Paul
Publication:Emerging Infectious Diseases
Article Type:Disease/Disorder overview
Geographic Code:4EUFR
Date:Sep 1, 2006
Words:2533
Previous Article:Shift in Staphylococcus aureus clone linked to an infected tattoo.(DISPATCHES)
Next Article:West Nile virus infection in commercial waterfowl operation, Wisconsin.(DISPATCHES)
Topics:



Related Articles
Hepatitis agents defined, cultured.
Changing hepatitis C evades immune systems. (new vaccines needed) (Brief Article)
NEW STRAIN OF HEPATITIS IDENTIFIED.(NEWS)
Vaccine-Preventable Hepatitis (VPH) and high-risk patients with HIV.(Advertisement)
AETHLON MEDICAL LAUNCHES HEPATITIS-C CLINICAL TRIAL.
Extrahepatic manifestations of hepatitis C.(Editorial)
Epstein Barr virus hepatitis: case series and review.(Case Report)
Influenza A virus PB1-F2 gene.(Letter to the editor)
New strain of influenza A virus (H5N1), Thailand.(LETTERS)(Letter to the editor)
Small Anellovirus infections in Korean children.(LETTERS)(Letter to the editor)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles