Printer Friendly
The Free Library
14,759,108 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Effects of hexamethylene diisocyanate exposure on human airway epithelial cells: in vitro cellular and molecular studies. (Articles).


In this study we developed an in vitro exposure model to investigate the effects of hexamethylene diisocyanate (HDI HDI Human Development Index (UNDP yardstick of human welfare)
HDI Help Desk Institute
HDI Humpty Dumpty Institute (New York, New York)
HDI High Density Interconnect
) on human airway epithelial cells at the cellular and molecular level. We used immunofluorescence Immunofluorescence

A technique that uses a fluorochrome to indicate the occurrence of a specific antigen-antibody reaction. The fluorochrome labels either an antigen or an antibody.
 analysis (IFA Immunofluorescent assay (IFA)
A blood test sometimes used to confirm ELISA results instead of using the Western blotting. In an IFA test, HIV antigen is mixed with a fluorescent compound and then with a sample of the patient's blood.
) to visualize the binding and uptake of HDI by airway epithelial cell lines (A549 and NCI-NCI-H292) and microarray technology to identify HDI sensitive genes. By IFA, we observed that subcytotoxic concentrations of HDI form microscopic micelles that appear to be taken up by cells over a 3-hr period postexposure. Microarray analysis (4.6K genes) of parallel cultures identified four genes (thioredoxin reductase, dihydrodiol dehydrogenase dehydrogenase /de·hy·dro·gen·ase/ (de-hi´dro-jen-as?) an enzyme that catalyzes the transfer of hydrogen or electrons from a donor, oxidizing it, to an acceptor, reducing it.

de·hy·dro·gen·ase
n.
, TG interacting factor, and stanniocalcin) whose mRNA levels were up-regulated after HDI exposure. Northern analysis was used to confirm that HDI increased message levels of these four genes and to further explore the dose dependence and kinetics of the response. The finding that HDI exposure increases thioredoxin reductase expression supports previous studies suggesting that HDI alters thiol-redox homeostasis homeostasis

Any self-regulating process by which a biological or mechanical system maintains stability while adjusting to changing conditions. Systems in dynamic equilibrium reach a balance in which internal change continuously compensates for external change in a feedback
, an important sensor of cellular stress. Another of the HDI-increased genes, a dihydrodiol dehydrogenase, encodes a protein previously shown to be specifically susceptible to HDI conjugation conjugation, in genetics
conjugation, in genetics: see recombination.
conjugation, in grammar
conjugation: see inflection.
, and known to detoxify de·tox·i·fy
v.
1. To counteract or destroy the toxic properties of a substance.

2. To remove the effects of poison from something, such as the blood.

3.
 other hydrocarbons. Together, the data describe a novel approach for investigating the effects of HDI binding and uptake by human airway epithelial cells and begin to identify genes that may be involved in the acute response to exposure. Key words: exposure, hexamethylene diisocyanate, human airway epithelial cell, redox redox (rē`dŏks): see oxidation and reduction. , thiol thiol: see mercaptan. , thioredoxin reductase. Environ Health Perspect 110:901-907 (2002). [Online 25 July 2002] http://ehpnet1.niehs.nih.gov/docs/2002/110p901-907wisnewski/abstract.html

**********

Diisocyanates are commercially important, toxic, human-made chemicals used in the manufacture of polyurethane (1,2). Although strict standards have been mandated by the U.S. Occupational Safety and Health Administration Occupational Safety and Health Administration (OSHA), U.S. agency established (1970) in the Dept. of Labor (see Labor, United States Department of) to develop and enforce regulations for the safety and health of workers in businesses that are engaged in interstate  to limit respiratory tract exposure to these chemicals, diisocyanates remain a leading cause of occupational asthma worldwide (1,2). Environmental exposures to diisocyanates have been documented in individuals living near production facilities and may also occur in proximity to end-use settings in residential neighborhoods (3). Hexamethylene diisocyanate (HDI), the focus of this study, is one of the most commonly used diisocyanates and is employed in autobody spray paints, the manufacture of spinnable fibers, and the preservation of animal hides (4).

The effects of HDI on airway epithelial cells remain poorly described despite the documented susceptibility of airway epithelial cell proteins to diisocyanate conjugation (5,6) and their anatomical location at the air-liquid interface in the lung, a primary site of exposure. Our laboratory has recently identified specific epithelial cell proteins that selectively become conjugated conjugated
adj.
Conjugate.


estrogens, conjugated Warning - Hazardous drug!

C.E.S.
 with HDI after exposure, including keratin keratin (kĕr`ətĭn), any one of a class of fibrous protein molecules that serve as structural units for various living tissues. The keratins are the major protein components of hair, wool, nails, horn, hoofs, and the quills of feathers.  18, dihydrodiol dehydrogenase, actin, and the 78-kDa glucose-regulated stress response protein (6). In addition, Lange et al. (7) have shown that toluene diisocyanate (TDI TDI - Transport Driver Interface ) colocalizes with tubulin tubulin /tu·bu·lin/ (too´bu-lin) the constituent protein of microtubules.

tu·bu·lin
n.
A globular protein that is the structural constituent of microtubules.
 present in the cilia cilia /cil·ia/ (sil´e-ah) sing. cil´ium   [L.]
1. the eyelids or their outer edges.

2. the eyelashes.

3.
 of differentiated human airway epithelial cells. Thus, airway epithelial cell proteins may serve as biologically relevant carriers that present HDI to the human immune system after inhalation, thereby mediating diisocyanate-induced airway inflammation (5,8).

The functional consequences of HDI exposure on airway epithelial cells, including protein conjugation and potential effects on cellular homeostasis, remain unclear. Limited studies to date have suggested that cellular thiols may be especially sensitive to diisocyanate exposure under physiologic conditions. Occupationally relevant doses of TDI have been shown to cause a rapid reduction of glutathione glutathione: see coenzyme.  levels in normal human bronchial bronchial /bron·chi·al/ (brong´ke-al) pertaining to or affecting one or more bronchi.

bron·chi·al
adj.
Relating to the bronchi, the bronchial tubes, or the bronchioles.
 epithelial cells in vitro (9-11). It remains unclear whether TDI-induced changes in glutathione levels are a direct effect of exposure or secondary to protective mechanisms such as oxidant oxidant /ox·i·dant/ (ok´si-dant) the electron acceptor in an oxidation-reduction (redox) reaction.

ox·i·dant
n.
See oxidizer.
 injury-induced protein glutathionylation (12). However, these data clearly demonstrate the potential for diisocyanates to alter airway epithelial cell thiol-redox homeostasis, an important modulator Modulator

Any device or circuit by means of which a desired signal is impressed upon a higher-frequency periodic wave known as a carrier. The process is called modulation. The modulator may vary the amplitude, frequency, or phase of the carrier.
 of numerous genes under the control of redox-sensitive transcription factors such as NF[kappa]B, Ref-1, and AP-1 (13,14).

Thus, studies to date suggest that HDI and other diisocyanates react with specific proteins in human airway epithelial cells and may modulate cellular thiol-redox homeostasis through unknown mechanisms. However, the physical interactions of HDI with airway cells and the potential effects of HDI on gene expression remain poorly characterized. In this study, we developed an in vitro model to further characterize the binding and uptake of HDI as well as the molecular effects of exposure on human airway epithelial cells. The studies were made possible by using recently developed reagents and methodologies, including an HDI-specific polyclonal antiserum generated by our laboratory and microarray technology. The sensitivity of immunocyto-chemical approaches and the broad-scope molecular analysis achievable with microarrays are uniquely applicable to such exploratory investigations. The present studies are the first we are aware of to exploit microarray technology to investigate the effects of HDI and illustrate the potential utility of this novel technique in studying the response of human airway epithelial cells to exposure. The results of the in vitro cellular and molecular studies provide new data on the effects of HDI on human airway epithelial cells and identify specific genes that may be important in the acute response to exposure.

Materials and Methods

Reagents and cell lines. We purchased HDI, Ca[Cl.sub.2], Mg[Cl.sub.2] endotoxin-free water, and streptomycin/penicillin from Sigma Chemical Company (St. Louis, MO). Northern Max-Gly kit, ULTRAhyb Buffer, Brightstar Psoralen-Biotin Nonisotopic Labeling Kit, and CDP-Star/Brightstar Biodetect kit were from Ambion (Austin, TX). Fetal bovine serum Fetal bovine serum ( or foetal bovine serum) is serum taken from the fetuses of cows. Fetal Bovine Serum (or FBS) is the most widely used serum in the culturing of cells. In some papers the expression foetal calf serum is used.  (FBS FBS
abbr.
fasting blood sugar


FBS Fasting blood sugar. See Fasting glucose.
), RPMI RPMI Rapid Prototyping & Manufacturing Institute
RPMI Roswell Park Memorial Institute
RPMI Royal Park Memorial Institute (culture medium) 
 1640, gentamicin gentamicin /gen·ta·mi·cin/ (jen?tah-mi´sin) an aminoglycoside antibiotic complex isolated from bacteria of the genus Micromonospora, , L-glutamine, phosphate-buffered saline (PBS PBS
 in full Public Broadcasting Service

Private, nonprofit U.S. corporation of public television stations. PBS provides its member stations, which are supported by public funds and private contributions rather than by commercials, with educational, cultural,
), Trizol, trypan blue, trypsin-EDTA, and nonessential amino acids (NEAA NEAA Non-Essential Amino Acid
NEAA National Environment Appellate Authority (India)
NEAA National Education Assistance Administration
) were from Gibco BRL BRL

In currencies, this is the abbreviation for the Brazilian Real.

Notes:
The currency market, also known as the Foreign Exchange market, is the largest financial market in the world, with a daily average volume of over US $1 trillion.
 Life Technologies (Grand Island, NY). Hybond-N nylon membrane was from Amersham Pharmacia Biotech (Piscataway, NJ); triton X-100, from Calbiochem (La Jolla, CA); rhodamine rhodamine /rho·da·mine/ (ro´dah-men) any of a group of red fluorescent dyes used to label proteins in various immunofluorescence techniques.  anti-rabbit immunoglobulin [gamma], from Santa Cruz (Santa Cruz, CA); acetone acetone (ăs`ĭtōn), dimethyl ketone (dīmĕth`əl kē`tōn), or 2-propanone (prō`pənōn), CH3COCH3 , from JT Baker Company (Phillipsburg, NJ); prolong antifade mounting media, from Molecular Probes (Eugene, OR); RNAeasy Minikit, from Qiagen (Valencia, CA). Human airway epithelial cell lines A549 and NC1-H292 were obtained from the American Type Culture Collection American Type Culture Collection (ATCC) is a private, not-for-profit biological resource center whose mission focuses on the acquisition, authentication, production, preservation, development and distribution of standard reference microorganisms, cell lines and other materials for  (Rockville, MD).

Cell culture. Human airway epithelial cell lines A549 and NCI-H292 were maintained in RPMI 1640 supplemented with 10% FBS, 2 mM L-glutamine, 1 mM NEAA, 10 U/mL streptomycin/penicillin, and 10 [micro]g/mL gentamicin. Cells were grown in a 75-[cm.sup.2] tissue culture flask and passaged as needed by trypsin-EDTA treatment.

Dose toxicity studies. Exposure of human lung epithelial cells to HDI in vitro was performed as described previously (5,6). Briefly, cells were grown to confluence in 75-[cm.sup.2] tissue culture flask, washed three times with PBS, and exposed to HDI in PBS (containing 1 mM Ca[Cl.sub.2] and 1 mM Mg[Cl.sub.2] to prevent detachment). For dose titration titration (tītrā`shən), gradual addition of an acidic solution to a basic solution or vice versa (see acids and bases); titrations are used to determine the concentration of acids or bases in solution. , HDI was serially diluted in acetone before being added to the cells in a volume of 10 mL PBS, with a final acetone concentration of 0.5% (volume/volume) and final HDI concentrations ranging from 300 nM to 30 mM. Samples were shaken vigorously and rocked for 20 min at room temperature. Control flasks received vehicle alone in the same volume. For molecular biology studies, the cells were washed three times with PBS and immediately lysed in 8 mL of Trizol, or cultured for additional periods of time in complete growth media, and then washed again with PBS and lysed in Trizol. For toxicity studies, cells were stained with trypan blue, rather than lysed in Trizol, and counted using a hemocytometer hemocytometer /he·mo·cy·tom·e·ter/ (-si-tom´e-ter) hemacytometer.

he·mo·cy·tom·e·ter
n.
An instrument for counting the blood cells in a measured volume of blood.
. Toxicity was based on the percentage of dead cells in exposed cultures/percentage of dead cells in control cultures. For immunofluorescence analysis (IFA), cells were similarly grown on sterilized ster·il·ize  
tr.v. ster·il·ized, ster·il·iz·ing, ster·il·iz·es
1. To make free from live bacteria or other microorganisms.

2.
 round glass coverslips. Exposure of cells attached to coverslips was scaled down to adapt to 24-well plates with identical HDI and vehicle concentrations.

IFA. HDI-exposed airway epithelial cells on round glass coverslips were fixed for 15 min with 2% paraformaldehyde paraformaldehyde: see formaldehyde.  in PBS, followed by permeabilization with 0.1% triton X-100. Coverslips were washed with PBS and blocked with 50% goat serum in PBS for 30 min at room temperature. Preimmune [alpha]-ovalbumin or [alpha]-HDI rabbit serum (5,6) was then added at a 1:200 dilution in 10% goat serum/PBS for 60 min. Coverslips were washed three times in PBS before secondary antibody (rhodamine-labeled goat anti-rabbit immunoglobulin [gamma], human/mouse absorbed) was added at a 1:400 dilution in 10% goat serum/PBS for 30 min at room temperature. Coverslips were washed three times with PBS and mounted on glass slides with antifade mounting media. Stained cells were visualized on a Nikon Microphot-FXA microscope (Melville, NY) at 600 x magnification under oil.

Microarray. Microarray was performed by the Yale University School of Medicine Microarray Center. RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 from exposed cells was double purified using Trizol reagent and RNAeasy columns. RNA (50 [micro]g) obtained from NCI-H292 cells 2 hr after a 20-rain exposure to HDI or vehicle alone was directly labeled with cy3 and cy5 and hybridized to the "in-house" HU-4.6K glass slide, a broad-spectrum array. The HU-4.6K array contains the first 4,608 cDNAs (48 x 96-well plates) from the Research Genetics 40K list (15). The cDNAs are arrayed in duplicate in a 4 x 4 array with 24 x 24 spots in each of 16 subarrays. Fluorescence hybridization hybridization /hy·brid·iza·tion/ (hi?brid-i-za´shun)
1. crossbreeding; the act or process of producing hybrids.

2. molecular hybridization

3.
 data were acquired on an Axon axon: see nervous system; synapse.  GenePix 4000A scanner using GenePix Pro3 software as detailed at the Yale University School of Medicine Microarray Center web site (15). Quality control studies with the HU-4.6K slide and the image analysis system employed have suggested that a > 2-fold change in fluorescence ratio represents a significant difference (p < 0.005) when compared with the appropriate control. The following IMAGE (Integrated Molecular Analysis of Genomes and their Expression consortium) clones from the microarray were further studied by Northern analysis (Table 1).

Northern blot analyses. To validate microarray results and to further study the kinetics of HDI-induced changes in gene expression patterns, we undertook Northern blot analyses. RNA was double purified from HDI-exposed cells using Trizol followed by RNAeasy columns. Total RNA (15 [micro]g/lane) was electrophoresed on a 1.2% agarose agarose

more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments.
 gel using the Northern Max-Gly kit according to the manufacturer's instructions. RNA was transferred to Hybond-N nylon membrane in 20 x saline sodium citrate (SSC SSC Secondary School Certificate
SSC Standard Systems Center (USAF)
SSC State Services Commission (New Zealand)
SSC Swedish Space Corporation
SSC Salem State College (Massachusetts) 
) overnight and immobilized by ultraviolet cross-linking. Membranes were prehybridized in ULTRAhyb Buffer at 42[degrees]C for 2 hr. Biotin-labeled probes (see below) were denatured de·na·ture  
tr.v. de·na·tured, de·na·tur·ing, de·na·tures
1. To change the nature or natural qualities of.

2.
 by heating at 90[degrees]C for 10 min, added to the 10 mL of ULTRAhyb Buffer, and hybridized over night (~16 hr). After hybridization, the blots were washed twice in 2 x SSC/0.1% SDS 1. (company) SDS - Scientific Data Systems.
2. (tool) SDS - Schema Definition Set.
 for 10 min at room temperature and in 0.1 x SSC/0.1% SDS at 42[degrees]C for 15 min. Hybridized probes were detected with the CDP-Star Brightstar Biodetect system according to the manufacturer's instructions. Briefly, blots were blocked, incubated with a 1:1,000 dilution of alkaline phosphatase-conjugated streptavidin for 30 min, and extensively washed before development with chemiluminescence chemiluminescence /chemi·lu·mi·nes·cence/ (kem?i-loo?mi-nes´ens) luminescence produced by direct transformation of chemical energy into light energy.  CDP-Star substrate and exposure to X-ray film. The blots were stripped once in 0.1 x SSC/0.1% SDS and reanalyzed with a [beta]-actin probe. Quantification of RNA signals by densitometry densitometry /den·si·tom·e·try/ (den?si-tom´i-tre) determination of variations in density by comparison with that of another material or with a certain standard.  scanning of the final X-ray film was achieved using the AlphaImager 2000 documentation and analysis system by Alpha Innotech Corporation (San Leandro, CA). The level of each mRNA was calculated based on the integrated density value of a constant area and standardized to the [beta]-actin signal. Three different experiments were completed with 0, 3, 17, and 30 [micro]M exposure doses. Student's t-test was used to evaluate the statistical significance of the change in mRNA levels of HDI-exposed cells compared with "mock" exposed cells.

Probes. The probes were prepared by biotin biotin: see vitamin; coenzyme.
biotin

Organic compound, part of the vitamin B complex, essential for growth and well-being in animals and some microorganisms.
 labeling polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) products, except for [beta]-actin, which was purchased from Ambion. For PCR amplification of gene fragments, cDNA was prepared from the airway epithelial cells using the SuperScript Any letter, digit or symbol that appears above the line. For example, 10 to the 9th power is written with the 9 in superscript (109). Contrast with subscript.  first-strand synthesis system for reverse transcription-PCR by Gibco BRL Life Technologies, according to the manufacturer's instructions, using oligo(dT) primer and 5 [micro]g of RNA/cDNA reaction. Table 2 lists the primers used.

For PCR reactions, 2 [micro]L cDNA, 15 pmol primers, and 45 [micro]L platinum PCR supermix from Gibco BRL were amplified for 35 cycles at 94[degrees]C, 58[degrees]C, and 72[degrees]C. PCR products were purified from low-melting-point gels and sequence validated. Next, 100 ng of purified PCR products in 10 [micro]L was labeled with the Brightstar Psoralen-Biotin Nonisotopic Labeling Kit from Ambion, according to the manufacturer's instructions. Labeling and specificity were verified by dot blot as the manufacturer suggested and by Southern blot against different PCR products. For Northern analysis, probes were used at 0.1-1 ng/mL.

Results

Development of an in vitro HDI exposure system. To facilitate investigations on the dose dependence and kinetics of HDI's effects on human airway epithelial cells, we developed and characterized an in vitro exposure system. Two different cell lines, A549 and NCI-H292, were chosen for these studies; both are hearty immortalized cell types commonly employed for in vitro studies of human airway epithelial cell types. A549 cells, a type II-like alveolar alveolar /al·ve·o·lar/ (al-ve´o-lar) [L. alveolaris ] pertaining to an alveolus.

al·ve·o·lar
adj.
Relating to an alveolus.
 epithelial cell, are one of the most widely used cell lines for studying human airway epithelial cell biology. NCI-H292 cells are mucoepidermoid type I-like alveolar epithelial cells. Analysis of the effects of HDI encompassed toxicity studies, IFA, microarray, and Northern blot analyses. Toxicity was based on trypan blue dye exclusion as evidence of cell viability after exposure. IFA studies were analyzed microscopically for evidence of HDI binding and uptake, which was detected with an HDI-specific antiserum antiserum /an·ti·se·rum/ (an´ti-se?rum) a serum containing antibody(ies), obtained from an animal immunized either by injection of antigen or by infection with microorganisms containing antigen. . Expression profiling was accomplished based on cDNA hybridization to a broad-spectrum 4.6K human gene chip and further defined based on quantitative measurements of mRNA levels by Northern blot analysis North·ern blot analysis
n.
An electrophoretic procedure used to separate and identify RNA fragments.
.

In vitro toxicity studies. Initially we determined the in vitro toxicity of HDI to A549 and NCI-H292 cells grown as monolayers in flasks, through dose titration studies. Cells were exposed to HDI concentrations ranging from 300 nM to 30 mM and viability was assessed. A 20-min exposure to doses > 3 mM was cytotoxic, whereas cells exposed to doses < 300 [micro]M remained viable when analyzed immediately after exposure (Figure 1). However, when cells were analyzed 24 hr after HDI exposure, substantial cell death (< 10% viability) was noted in cultures exposed to concentrations > 300 [micro]M, whereas cultures exposed to doses < 30 [micro]M remained > 90% viable. The toxicity of HDI to A549 and NCI-H292 cells was comparable over this broad exposure dose range.

[FIGURE 1 OMITTED]

Binding of HDI to human airway epithelial cells. To visualize the binding of HDI to human airway epithelial cells in vitro, we performed IFA using an HDI-specific antiserum developed by our laboratory (5,6). Immediately after a 20-min exposure to 50 [micro]M HDI, airway epithelial cells exhibited foci of HDI-specific staining along the cell surface. Microscopic comparison of fluorescence and phase-contrast images revealed that these concentrated areas of cell-associated HDI corresponded to "droplets," structurally consistent with micelles of HDI (Figure 2). The observed foci of cell-associated HDI appeared to be taken up and distributed within the cell during a 3-hr period after exposure (Figure 3).

[FIGURES 2-3 OMITTED]

Molecular changes induced by HDI exposure. We screened for genes that may be selectively induced by HDI exposure using microarray analysis and assumed a priori that any potential effects of HDI would be time and dose dependent. As a starting point for these studies, we analyzed cells that were exposed to the highest nontoxic dose of HDI and then cultured them for additional periods of time to permit changes in cellular mRNA levels to occur. When this approach was used to compare mRNA profiles from NCI-H292 cells 2 hr after a 20-min exposure to 30 [micro]M HDI (relative to control cultures identically exposed to vehicle), increases (> 2.0-fold) were noted in just 4 of 4,608 transcripts analyzed. Figure 4 shows fluorescent images and corresponding false color overlay for 4 of 16 quadrants of a representative 4.6K gene microarray. The readily apparent differentially expressed cDNA hybridization signals are circled and correspond to thioredoxin reductase, a dihydrodiol dehydrogenase, aldo-keto reductase reductase /re·duc·tase/ (-tas) a term used in the names of some of the oxidoreductases, usually specifically those catalyzing reactions important solely for reduction of a metabolite.  C1 (AKRC1), stanniocalcin, and TG-interacting factor (Figure 4A-D A-D

Advance-Decline, or measurement of the number of issues trading above their previous closing prices less the number trading below their previous closing prices over a particular period.
, respectively). Similar results were obtained with A549 cells, although the relative changes in gene expression were not as great as those observed with NCI-H292 cells because baseline levels of each of these mRNA were higher in A549 cells (data not shown).

[FIGURE 4 OMITTED]

To validate the results of our microarray studies and further analyze the kinetics and dose dependence of HDI-induced gene expression, we performed Northern blot analysis with NCI-H292 cells exposed to titrated ti·trate  
tr. & intr.v. ti·trat·ed, ti·trat·ing, ti·trates
To determine the concentration of (a solution) by titration or perform the operation of titration.
 doses of HDI and cultured for varying amounts of time after exposure. For the selected genes, mRNA levels were quantitated as described, and changes induced by different doses were compared with "mock exposed" cultures. As shown in Figures 5 and 6, thioredoxin reductase, dihydrodiol dehydrogenase, stanniocalcin, and TG-interacting factor mRNA levels were increased in a dose-dependent manner. A statistically significant increase in mRNA levels for all four of these proteins was observed as early as 2 hr after exposure to doses [less than or equal to] 30 [micro]M (Figure 6). The mRNA levels for these different genes remained increased for up to 4 hr after exposure and returned to baseline by 24 hr (data not shown).

[FIGURES 5-6 OMITTED]

Discussion

This report characterizes previously undescribed effects of HDI exposure on human airway epithelial cells. The study also demonstrates the potential advantages of microarray technology as an aid to understanding the effects of chemical exposures on biologic systems. The experiments were based on previous investigations that have demonstrated that specific human airway epithelial cell proteins become conjugated with HDI after exposure (5-7), and the hypothesis that HDI-epithelial cell protein conjugation may induce pathogenic functional changes. In the present studies, we coupled microarray (> 4K genes) technology with an in vitro HDI exposure system using airway epithelial cell lines to screen for genes whose message levels are significantly increased by HDI. The kinetics and HDI dose dependence of increases in mRNA levels for four up-regulated genes, one of which (AKRC1) encodes a protein previously shown to be specifically susceptible to HDI conjugation (6), were verified by Northern blot studies. The in vitro exposure model was also used to visualize the interaction of HDI with living airway epithelial cells by IFA and provides new evidence for the rapid binding and uptake of HDI by exposed cells. Together with previously published reports, the data yield insights into pathways through which HDI may exert its toxic effects on airway epithelial cells.

The initial studies of this report established an in vitro system to permit titrated HDI exposure of human airway epithelial cell lines. First we determined the toxicity of HDI to two different types of human airway epithelial cells A549 and NCI-H292, which had not been previously established. We demonstrated that a 20-min exposure to doses < 30 [micro]M HDI did not cause measurable cytotoxicity over a 24-hr period. These concentrations are at least 2,000-fold less than the concentration of HDI present in aerosol droplets of autobody shop paints, which typically contain 1% HDI (~60 mM). Given that HDI aerosols have been shown to deposit in the airways of exposed workers, the concentrations of HDI used in the present studies are relevant to current common occupational exposures and possibly also to environmental exposures (16,17).

The ability of HDI to bind and be taken up by airway epithelial cells over time was further tested by IFA using an HDI-specific polyclonal antiserum generated in our laboratory (5,6). These IFA studies provide, for the first time, visual evidence of the affinity of HDI for live cells. The fluorescence staining pattern observed suggests that HDI initially interacts with the cell membrane and is taken up within 3 hr after exposure. The cell-associated HDI foci observed in these studies resemble droplet-like structures that are consistent with HDI micelles and the tendency for HDI to form emulsions in aqueous solutions (4), but might also reflect localized HDI-protein aggregates.

On the basis of current IFA studies and previous reports suggesting that diisocyanates can bind and be taken up by airway epithelial cells (5,6,11), we investigated the possibility that HDI exposure may also result in specific changes in gene expression. To screen for HDI-sensitive airway epithelial cell genes, we used microarrays to expression profile in vitro exposed cells. HDI induced differential expression in only a limited number of 4,608 genes tested. We subsequently used Northern blot analyses to confirm the microarray results for the four genes whose message levels were up-regulated > 2-fold by microarray analysis. The limited number of genes ([less than or equal to] 8) whose message levels were decreased or less strongly increased represent other potentially HDI-sensitive genes that may be investigated in future studies.

Two of the up-regulated genes AKRC1 and thioredoxin reductase are relevant to cellular thiol-redox homeostasis. One of these, AKRC1, encodes the same dihydrodiol dehydrogenase protein previously shown to be susceptible to HDI conjugation (6) and belongs to a family of oxidant stress-induced enzymes that detoxify hydrocarbons (18-20). AKRC1 is one of just four HDI-conjugated proteins previously identified in exposed human airway epithelial cells and appears to be especially sensitive to low exposure concentrations (6). The conjugation of AKRC1 protein with HDI and the up-regulation of its mRNA after exposure suggest that this protein may be important in the metabolism of HDI and/or the repair of oxidants resulting from exposure.

Thioredoxin reductase is an essential enzyme important in maintaining cellular thiol-redox homeostasis and defense against oxidant stress and also mediates important cocytokine activities via its substrate thioredoxin, which can act as a potent T-cell growth factor (21-30). Increases in thioredoxin reductase may thus not only signal HDI-induced thiol-redox imbalance but also provide an "antigenreceptor-independent" mechanism by which epithelial cell responses to exposure may promote immunologic sensitization sensitization /sen·si·ti·za·tion/ (sen?si-ti-za´shun)
1. administration of an antigen to induce a primary immune response.

2. exposure to allergen that results in the development of hypersensitivity.
 to HDI via either a) epithelial cell-derived cytokines/ chemokines under redox-dependent transcriptional regulation (13,14) or b) immunologically active thioredoxin (21-25). Interestingly, thioredoxin reductase contains selenium selenium (səlē`nēəm), nonmetallic chemical element; symbol Se; at. no. 34; at. wt. 78.96; m.p. 217°C;; b.p. about 685°C;; sp. gr. 4.81 at 20°C;; valence −2, +4, or +6. , which is thought to be crucial to its role as a cellular sensor of redox potential and which, based on its biochemical properties, should be highly susceptible to nucleophilic addition reactions with diisocyanates (10,28,31).

Of the other two genes we have documented to be up-regulated by HDI exposure, one, TG-interacting factor, possesses important regulatory capacity, through its ability to block retinoic acid signaling (32,33). The other, stanniocalcin, encodes a protein whose function in humans remains uncertain but is highly homologous to a fish hormone highly expressed in the gills (the fish equivalent of lungs), where it plays an important role in [Ca.sup.2+] homeostasis (34). The relevance of these two genes to diisocyanates has not previously been considered and may identify signaling pathways that human airway epithelial cells utilize in their response to exposure.

One limitation of the present studies is that, to permit consistent, well-controlled exposures, we employed in vitro exposure of immortalized human airway epithelial cell lines. Thus, the in vivo relevance of the observed responses in normal cells in situ remains to be tested. Such in vivo studies in humans are extremely challenging because of practical and ethical considerations, and animal models are limited by anatomic and metabolic differences with humans. However, several findings support the relevance of the present studies--specifically, the capacity of diisocyanates to alter airway epithelial cell thiol-redox homeostasis (9-11,35). Previously reported in vitro and in vivo studies have suggested that HDI and TDI can enter bronchial epithelial cells, conjugate conjugate /con·ju·gate/ (kon´jdbobr-gat)
1. paired, or equally coupled; working in unison.

2. a conjugate diameter of the pelvic inlet; used alone usually to denote the true conjugate diameter; see
 with and result in a rapid reversible drop in levels of intracellular glutathione (9-11,35). The present data, especially the finding that HDI exposure increases thioredoxin reductase expression, are consistent with these studies and suggest a mechanism, via thioredoxin, that cells may use to counteract the thiol-depleting effects of exposure. Further studies will be necessary to determine the mechanisms that control gene transcription of the identified HDI-responsive genes, whether these changes result in increased protein levels, and whether the findings extend to other diisocyanates. Additionally, the potential protective effects of naturally occurring compounds in the lung (i.e., surfactants, proteins, and antioxidants Antioxidants
Substances that reduce the damage of the highly reactive free radicals that are the byproducts of the cells.

Mentioned in: Aging, Nutritional Supplements

antioxidants,
n.
) may be investigated using the in vitro exposure system we have defined.

This study also demonstrates the potential utility and feasibility of microarray technology in beginning to understand the complex biologic effects of human exposure to chemicals such as HDI. The results demonstrate the selectivity and validity of microarray analysis under well-controlled experimental conditions. Only a select number of genes were found to be up-regulated by HDI using microarray analysis, and these effects were confirmed using Northern blot analysis. Although there has been rapidly growing interest in microarray technology, this is one of the first reports demonstrating its utility in studying the effects of exposure to occupationally relevant chemicals.

In summary, the present study develops an in vitro exposure model to characterize the effects of HDI on human airway epithelial cell lines and defines specific molecular changes that result from exposure. Importantly, the data support previous studies suggesting that diisocyanates can enter airway epithelial cells and upset cellular thiol-redox homeostasis. Given that many pro-inflammatory cytokines/ chemokines are under the control of redox-sensitive transcription factors, the present results suggest an "antigen-receptor-independent" mechanism through which HDI may promote airway inflammation and asthma. Future studies should determine whether individual differences exist in airway epithelial cell sensitivity to HDI and whether these potential differences help explain the widely disparate responses of exposed workers.
Table 1. IMAGE clones.

                  Gene Bank
IMAGE clone no.   accession no.          Corresponding gene

789376              AA453335            Thioredoxin reductase
196992               R93124       Dihydrodiol dehydrogenase (AKRC1)
547247              AA085318                Stanniocalcin
194214               R83270             TG-interacting factor

Table 2. PCR primers for probe generation.

Gene name        Forward (5' to 3')     Reverse (5' to 3')   PCR (bp)

Thioredoxin      TGAACAACTGTGCCTTGTGG   GCCAAATGAGATGAGGAC     380
  reductase
Dihydrodiol      CAGTGTCTGTAAAGCCAG     GGTTGAAGTAAGGATGAC     240
  dehydrog.
TG-interacting   AGACAGTATGTGGGCATC     AAATGTCATGATTGCCCG     360
  factor
Stanniocalcin    ACATTCTGCAATGGCAGC     TCAGCTAACTCTACTGGG     220


REFERENCES AND NOTES

(1.) Chan-Yeung M, Malo JL. Occupational asthma. N Engl J Med 333:107-112 (1995).

(2.) Wisnewski AV, Redlich CA. Recent advances in diisocyanate asthma. Curr Opin Allergy Clin Immunol 1:169-175 (2001).

(3.) Orloff KG, Batts-Osborne D, Kilgus T, Metcalf S, Cooper M. Antibodies to toluene diisocyanate in an environmentally exposed population. Environ Health Perspect 106:665-666 (1998).

(4.) Urlich, H. Chemistry and Technology of Isocyanates. West Sussex, England:John Wiley & Sons, Ltd., 1996.

(5.) Wisnewski AV, Lemus R, Karol MH, Redlich CA. Isocyanate-conjugated human lung epithelial cell proteins: a link between exposure and asthma? J Allergy Clin Immunol 104:341-347 (1999).

(6.) Wisnewski AV, Srivastava R, Herick C, Xu L, Lemus R, Cain H, Magoski NM, Karol MH, Bottomly K, Redlich CA. Identification of human lung and skin proteins conjugated with hexamethylene diisocyanate in vitro and in vivo. Am J Respir Crit Care Med 162:2330-2336 (2000).

(7.) Lange RW, Lantz RC, Stolz DB, Watkins SC, Sundareshan P, Lemus R, Karol MH. Toluene diisocyanate colocalizes with tubulin on cilia of differentiated human airway epithelial cells. Toxicol Sci 50:64-71 (1999).

(8.) Karol MH. Bonding and transfer: do epithelial conjugates play a role in chemical asthma. Clin Exp Allergy 31:357-360 (2001).

(9.) Lantz RC, Lemus R, Lange RW, Karol MH. Rapid reduction of intracellular glutathione in human bronchial epithelial cells exposed to occupational levels of toluene diisocyanate. Toxicol Sci 60:348-355 (2001).

(10.) Day BW, Jin R, Basalyga DM, Kramarik JA, Karol MH. Formation, solvolysis sol·vol·y·sis  
n.
A chemical reaction in which the solute and solvent react to form a new compound.



[solv(ent) + -lysis.
, and transcarbamoylation reactions of bis(S-glutathionyl) adducts of 2,4- and 2,6-diisocyanatotoluene. Chem Res Toxicol 10:424-431 (1997).

(11.) Lange RW, Day BW, Lemus, R, Tyurin VA, Kagan VE, Karol MH. Intracellular S-glutathionyl adducts in murine murine /mu·rine/ (mur´en) pertaining to, derived from, or characteristic of mice or rats.

mu·rine
adj.
 lung and human bronchoepithelial cells after exposure to diisocyanatotoluene. Chem Res Toxicol 12:931-936 (1999).

(12.) Sullivan DM, Wehr NB, Fergusson MM, Levine RL, Finkel T. Identification of oxidant-sensitive proteins: TNF-alpha induces protein glutathiolation. Biochemistry 39:11121-11128 (2000).

(13.) Rahman I, MacNee W. Regulation of redox glutathione levels and gene transcription in lung inflammation: therapeutic approaches. Free Radic Biol Med 28:1405-1420 (2000).

(14.) Rahman I, MacNee W. Oxidative stress and regulation of glutathione in lung inflammation. Eur Respir J 16:534-554 (2000).

(15.) Yale University School of Medicine Microarray Center. Yale Microarray Database. Available: http:// info.med.yale.edu/microarray/[cited 1 November 2001].

(16.) England E, Key-Schwartz R, Lesage J, Carlton G, Streicher R, Song R. Comparison of sampling methods for monomer and polyisocyanates of 1,6-hexamethylene diisocyanate during spray finishing operations. Appl Occup Environ Hyg 15:472-478 (2000).

(17.) Klaassen CD, Amdur MO, Doull J. Toxicology: The Basic Science of Poisons. New York:Macmillan Publishing Co., 1986.

(18.) Vogel K, Bentley P, Platt KL, Oesch F. Rat liver cytoplasmic cytoplasmic

pertaining to or included in cytoplasm.


cytoplasmic inclusions
include secretory inclusions (enzymes, acids, proteins, mucosubstances), nutritive inclusions (glycogen, lipids), pigment granules (melanin, lipofuscin,
 dihydrodiol dehydrogenase. Purification to apparent homogeneity and properties. J Biol Chem 255:9621-9625 (1980).

(19.) Glatt Glatt may refer to:
  • Glatt (Rhine), a river in Switzerland
  • glatt kosher, a description of kosher food
  • glatt, a German and Yiddish word meaning "smooth"
 HR, Platt KL, Vogel K, Bucker M, Billings R, Oesch F. Metabolic inactivation inactivation /in·ac·ti·va·tion/ (in-ak?ti-va´shun) the destruction of biological activity, as of a virus, by the action of heat or other agent.  of mutagenic mutagenic

inducing genetic mutation.
 benzo(a)pyrene metabolites Metabolites
Substances produced by metabolism or by a metabolic process.

Mentioned in: Interactions
: significance to carcinogenicity carcinogenicity /car·ci·no·ge·nic·i·ty/ (kahr?si-no-je-nis´i-te) the ability or tendency to produce cancer.

carcinogenicity

the ability or tendency to produce cancer.
 and implications for in vitro tests. Dev Toxicol Environ Sci 8:181-186 (1980).

(20.) Ciaccio PJ, Jaiswal AK, Tew KD. Regulation of human dihydrodiol dehydrogenase by Michael acceptor acceptor - Finite State Machine  xenobiotics. J Biol Chem 269:15558-15562 (1994).

(21). Blum H, Rollinghoff M, Gessner A. Expression and cocytokine function of murine thioredoxin/adult T cell leukaemia-derived factor (ADF (1) (Application Development Facility) An IBM programmer-oriented mainframe application generator that runs under IMS.

(2) (Automatic Document Feeder) A paper stacker that feeds one sheet of paper at a time into the unit.
). Cytokine Cytokine

Any of a group of soluble proteins that are released by a cell to send messages which are delivered to the same cell (autocrine), an adjacent cell (paracrine), or a distant cell (endocrine).
 8:6-13 (1996).

(22.) Koyanagi H, Wakasugi N, Yoshimatsu K, Takashima Y, Yodoi J, Momoi M, Suda T, Kasahara T, Yamaguchi Y. Role of ADF/TRX and its inhibitor on the release of major basic protein from human eosinophils Eosinophils
A leukocyte with coarse, round granules present.

Mentioned in: Histiocytosis X

eosinophils
. Biochem Biophys Res Commun 213:1140-1147 (1995).

(23.) Wakasugi N, Tagaya Y, Wakasugi H, Mitsui A, Maeda M, Yodoi J, Tursz T. Adult T-cell leukemia-derived factor/thioredoxin, produced by both human T-lymphotropic virus Human T-lymphotropic virus (HTLV) is a human, single-stranded RNA retrovirus that causes T-cell leukemia and T-cell lymphoma in adults and may also be involved in certain demyelinating diseases, including tropical spastic paraparesis.  type I- and Epstein-Barr virus-transformed lymphocytes, acts as an autocrine autocrine /au·to·crine/ (-krin) denoting a mode of hormone action in which a hormone binds to receptors on and affects the function of the cell type that produced it.

au·to·crine
adj.
 growth factor and synergizes with interleukin 1 and interleukin 2. Proc Natl Acad Sci USA 87:8282-8286 (1990).

(24.) Iwata S, Hori T, Sato N, Hirota K, Sasada T, Mitsui A, Hirakawa T, Yodoi J. Adult T cell leukemia (ATL (Active Template Library) A set of software routines from Microsoft that provide the basic framework for creating ActiveX and COM objects. Stemming from the standard template library (STL) that comes with C++ compilers, ATL includes an object wizard that sets up )-derived factor/human thioredoxin prevents apoptosis of lymphoid lymphoid /lym·phoid/ (lim´foid) resembling or pertaining to lymph or tissue of the lymphoid system.

lym·phoid
adj.
Of or relating to lymph or the lymphatic tissue where lymphocytes are formed.
 cells induced by L-cystine and glutathione depletion: possible involvement of thiol-mediated redox regulation in apoptosis caused by pro-oxidant state. J Immunol 158:3108-3117 (1997).

(25.) Khayat M, Stuge TB, Wilson M, Bengten E, Miller NW, Clem LW. Thioredoxin acts as a B cell growth factor in channel catfish. J Immunol 166:2937-2943 (2001).

(26.) Gasdaska JR, Berggren M, Powis G. Cell growth stimulation by the redox protein thioredoxin occurs by a novel helper mechanism. Cell Growth Differ 6:1643-1650 (1995).

(27.) Gasdaska PY, Oblong JE, Cotgreave IA, Powis G. The predicted amino acid sequence of human thioredoxin is identical to that of the autocrine growth factor human adult T-cell derived factor (ADF): thioredoxin mRNA is elevated in some human tumors. Biochim Biophys Acta 1218:292-296 (1994).

(28.) Sun QA, Wu Y, Zappacosta F, Jeang KT, Lee BJ, Hatfield DL, Gladyshev VN. Redox regulation of cell signaling by selenocysteine in mammalian thioredoxin reductases. J Biol Chem 274:24522-24530 (1999).

(29.) Zhong L, Arner ES, Holmgren A. Structure and mechanism of mammalian thioredoxin reductase: the active site is a redox-active selenolthiol/selenenylsulfide formed from the conserved cysteine-selenocysteine sequence. Proc Natl Acad Sci USA 97:5854-5859 (2000).

(30.) Arner ES, Holmgren A. Physiological functions of thioredoxin and thioredoxin reductase. Eur J Biochem 267:6102-6109 (2000).

(31.) Stadtman TC. Selenocysteine. Annu Rev Biochem 65:83-100 (1996).

(32.) Lo, RS, Wotton D, Massague J. Epidermal growth factor Epidermal growth factor or EGF is a growth factor that plays an important role in the regulation of cell growth, proliferation and differentiation. Human EGF is a 6045 Da protein with 53 amino acid residues and three intramolecular disulfide bonds.  signaling via Ras controls the Smad transcriptional co-repressor TGIF TGIF
abbr.
thank God it's Friday
. EMBO J 20:128-136 (2001).

(33.) Bertolino E, Reimund B, Wildt-Perinic D, Clerc RG. A novel homeobox homeobox  

Any of various DNA sequences containing about 180 nucleotides that encode for corresponding sequences of usually 60 amino acids, called homeodomains, found in proteins that bind DNA and regulate gene transcription.
 protein which recognizes a TGT TGT Target
TGT Ticket Granting Ticket (Windows 2000 Kerberos security)
TGT Target Corp (stock symbol)
TGT Turbine Gas Temperature
TGT TDRSS Ground Terminal
TGT Tank Gunnery Trainer
TGT Target Tracker
 core and functionally interferes with a retinoid-responsive motif. J Biol Chem 270:31178-31188 (1995).

(34.) Chang AC, Janosi J, Hulsbeek M, de Jong D, Jeffrey KJ, Noble JR, Reddel RR. A novel human cDNA highly homologous to the fish hormone stanniocalcin. Mol Cell Endocrinol 112:241-247 (1995).

(35.) Pauluhn J. Inhalation toxicity of 1,6-hexamethylene diisocyanate homopolymer (HDI-IC) aerosol: results of single inhalation exposure studies. Toxicol Sci 58:173-181 (2000).

Department of Internal Medicine, Yale University School of Medicine, New Haven, Connecticut, USA

Address correspondence to A.V. Wisnewski, Yale University School of Medicine, 333 Cedar Street, LCI-105, New Haven, CT 06520 USA. Telephone: (203) 737-2544. Fax: (203) 785-3826. E-mail: adam.wisnewski@yale.edu

We thank K. Bottomly, C. Herrick, and M. Karol for helpful criticisms and thoughtful discussions on these studies, and the Yale Microarray Center for performing the microarray analysis.

The work was supported by grants from the National Institutes of Health (1P01HL56389, 1R01HL62622, and K24-ES00355) and the American Lung Association The American Lung Association (ALA) is a non-profit organization that "fights lung disease in all its forms, with special emphasis on asthma, tobacco control and environmental health". .

Received 7 November 2001; accepted 21 February 2002.
COPYRIGHT 2002 National Institute of Environmental Health Sciences
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2002, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Redlich, Carrie A.
Publication:Environmental Health Perspectives
Date:Sep 1, 2002
Words:5408
Previous Article:Hydroxylated PCB metabolites and PCBs in serum from pregnant Faroese women. (Articles).
Next Article:Disease transmission models for public health decision making: toward an approach for designing intervention strategies for Schistosomiasis japonica....



Related Articles
Position Announcements.
Do Urban Environmental Pollutants Exacerbate Childhood Lung Diseases?
Scientists Zeroing in on a Cellular Pathway to Lung Cancer.(Brief Article)
Increased expression of matrix metalloproteinase in Clara cell-ablated mice inhaling crystalline silica. (Articles).
Mitochondrial membrane potential: a novel biomarker of oxidative environmental stress. (Articles).
Synergism between rhinovirus infection and oxidant pollutant exposure enhances airway epithelial cell cytokine production. (Research Articles).
Transcription factor activation following exposure of an intact lung preparation to metallic particulate matter. (Articles).
Correlation of in vitro cytokine responses with the chemical composition of soil-derived particulate matter.(Research)
The role of inflammatory mediators in the synergistic toxicity of ozone and 1-nitronaphthalene in rat airways.(Research)
Skin exposure to isocyanates: reasons for concern.(Review)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles