Dual and Recombinant Infections: An Integral Part of the HIV-1 Epidemic in Brazil.We systematically evaluated multiple and recombinant infections in an HIV-infected population selected for vaccine trials. Seventy-nine HIV-1 infected persons in a clinical cohort study A cohort study is a form of longitudinal study used in medicine and social science. It is one type of study design. In medicine, it is usually undertaken to obtain evidence to try to refute the existence of a suspected association between cause and disease; failure to refute in Rio de Janeiro Rio de Janeiro, city, Brazil Rio de Janeiro (rē`ō də zhänā`rō, Port. rē` thĭ zhənĕē`r ,
Brazil, were evaluated for 1 year. A combination of molecular screening
assays and DNA sequencing DNA sequencingThe determination of the sequence of nucleotides in a sample of DNA. showed 3 dual infections (3.8%), 6 recombinant infections (7.6%), and 70 (88.6%)infections involving single viral subtypes. In the three dual infections, we identified HIV-1 subtypes F and B, F and D, and B and D; in contrast, the single and recombinant infections involved only HIV-1 subtypes B and F. The recombinants had five distinct B/F mosaic patterns: [B.sup.gag-p17]/[B.sup.gag-p24]/[F.sup.pol]/[B.sup.env] , [F.sup.gag p17]/[B.sup.gag-p24]/[F.sup.pol]/[F.sup.env] , [B.sup.gag-p17]/[B-F.sup.gag- p24]/[F.sup.pol]/[F.sup.env] , [B.sup.gag-p17]/[B-F.sup.gag-p24]/[F.sup.pol]/[B.sup.env] , and [F.sup.gag-p17]/[B-F.sup.gag-p24]/[F.sup.pol]/[F.sup.env] No association was found between dual or recombinant infections and demographic or clinical variables. These findings indicate that dual and recombinant infections are emerging as an integral part of the HIV/AIDS HIV/AIDS Human Immunodeficiency Virus/Acquired Immune Deficiency Syndrome epidemic in Brazil and emphasize the heterogenous (spelling) heterogenous - It's spelled heterogeneous. character of epidemics emerging in countries where multiple viral subtypes coexist. Our understanding of the global molecular epidemiology molecular epidemiology Molecular medicine An evolving field that combines the tools of standard epidemiology–case studies, questionnaires and monitoring of exposure to external factors with the tools of molecular biology–eg, restriction endonucleases, of HIV-1 infections has improved substantially in recent years. Remarkable antigenic diversity, especially in the viral envelope viral envelope n. The outer structure that encloses the nucleocapsids of some viruses. , has emerged among HIV HIV (Human Immunodeficiency Virus), either of two closely related retroviruses that invade T-helper lymphocytes and are responsible for AIDS. There are two types of HIV: HIV-1 and HIV-2. HIV-1 is responsible for the vast majority of AIDS in the United States. isolates worldwide (1). As the HIV/AIDS pandemic pandemic /pan·dem·ic/ (pan-dem´ik) 1. a widespread epidemic of a disease. 2. widely epidemic. pan·dem·ic adj. Epidemic over a wide geographic area. n. grows, viral strains are becoming more geographically dispersed, and the simultaneous presence of multiple subtypes in a given region is now common (2). Mixed infections and recombinants involving sequences of distinct HIV-1 subtypes (mosaics) are being recognized, but their prevalence and effect on the pandemic have not been fully evaluated (3). Consequently, the distribution of dual infections and mosaic viruses Mosaic viruses are plant viruses that cause the leaves to have a speckled appearance. Species include plum pox virus (in the potyvirus genus) and tobacco mosaic virus (in the tobamovirus genus. among different populations and the changes of this distribution over time are still relatively unknown. In addition, scientists are increasingly interested in possible differences in the transmission, epidemiologic patterns, and natural history of HIV-1 infections caused by more than one viral subtype (programming) subtype - If S is a subtype of T then an expression of type S may be used anywhere that one of type T can and an implicit type conversion will be applied to convert it to type T. and recombinant genomes. Finally, the efficacy of HIV-1 vaccines, primarily developed against subtype B viruses, may differ against more divergent recombinant variants and mixed infections of distinct HIV-1 subtypes. Such knowledge is vital to understanding the relevant role of mixed infections as a prerequisite for recombination recombination, process of "shuffling" of genes by which new combinations can be generated. In recombination through sexual reproduction, the offspring's complete set of genes differs from that of either parent, being rather a combination of genes from both parents. and could be applied immediately in molecular epidemiology and immunotherapy. Studies using convenience samples first documented mixed infections caused by viruses of subtypes B and E in Thailand (4). Subsequently, such studies have identified cases of dual infections with subtypes B, F, C, and D in Brazil (5-7), B and F in Puerto Rico Puerto Rico (pwār`tō rē`kō), island (2005 est. pop. 3,917,000), 3,508 sq mi (9,086 sq km), West Indies, c.1,000 mi (1,610 km) SE of Miami, Fla. (8), A and C in Rwanda (15), and triple HIV-1 infection with groups O and M of different clades in a single Cameroonian AIDS patient (10). In addition, potential dual infections have been detected by molecular screening assays among HIV-1 infected populations in Uganda and Kenya, where subtypes A and D coexist (11). The consequences of HIV-1 mixed infections may profoundly influence the dynamic of the pandemic through altered patterns of viral transmission and pathogenesis. Moreover, the resulting genetic variation may lead to the emergence of new HIV variants, including those with altered antigenicity and reduced sensitivity to detection by current diagnostic assays. The global emergence of such variants is exemplified in the impact of two HIV-1 recombinants of subtypes A/E A/E Architect/Engineer A/E Architecture and Engineering Services A/E Air Entry (by auscultation) A/E Activity Elements A/E Ascent and Entry (spacecraft; NASA) A/E Attitude Ephemeris A/E Anarchy and Equality and G/A G/A Gate/Array (NEC) G/A Ground/Air G/A Ground-to-Air on epidemics in Thailand and in certain parts of Central Africa, respectively (1,12-14). Interestingly, the presumptive pre·sump·tive adj. 1. Providing a reasonable basis for belief or acceptance. 2. Founded on probability or presumption. pre·sump parental subtypes E and G have not been identified. Because Brazil has been selected as a World Health Organization field site for HIV-1 vaccine evaluation programs, priority has been given to extensive molecular examination of the prevalence and genetic diversity of HIV-1 strains circulating in the country. By November 1997, 116,277 AIDS cases had been reported to the Brazilian AIDS Control Program of the Ministry of Health (15). The 293 HIV-1 strains that have been molecularly characterized document that, although four HIV-1 subtypes B, F, C, and D are circulating in Brazil, only subtypes B and F are common (16-21). Moreover, five HIV-1 dual infections were identified in 21 HIV-infected patients during testing of molecular techniques that would discriminate between HIV-1 infections caused by single and multiple subtypes (5-7). Also, two cases of B/F recombinants have been found accidentally through sequence analysis of the env region (22). These data only indicate the potential for dual and recombinant infections in Brazil, where multiple subtypes circulate; they cannot, however, be used to assess the frequency of these infections among the HIV-infected population. In this study, we evaluated the proportion of HIV-1 dual and recombinant infections among 79 patients enrolled in a prospective clinical cohort study in Rio de Janeiro (an area where HIV-1 subtypes B and F are common). The Study Population Part of an ongoing prospective clinical cohort study established in 1991 by the AIDS program of the Federal University of Rio de Janeiro, the HIV-1-infected patients have been continuously enrolled in the cohort for consultation, treatment, evaluation of different clinical parameters during the progression of the disease, and assessment of the genetic variation of HIV-1 strains (23). With informed consent, blood samples were obtained from the 79 patients, who consecutively attended the clinic between October and December 1994. For the purposes of this study, samples collected in 1994 were compared as needed as needed prn. See prn order. , and follow-up specimens were collected 1 year later. The clinical profile of patients was based on the medical evaluation at the time of blood collection. Because the patients were randomly selected, the findings presented in this article likely reflect the trends in the HIV/AIDS epidemic in the Rio de Janeiro area. Epi Info Epi Info is a public domain statistical software for epidemiology developed by Centers for Disease Control and Prevention. Developed by the Centers for Disease Control and Prevention (CDC) in Atlanta, Georgia (USA), Epi Info has been in existence for over 20 years and is , Version 6 program (CDC See Control Data, century date change and Back Orifice. CDC - Control Data Corporation , Atlanta, GA, USA) was used to calculate frequencies, means, and analyses of variance of demographic information, clinical stages, and laboratory parameters. Design To investigate the proportion of mixed infections, we must distinguish between those involving two or more distinct HIV-1 strains and infection with a single intersubtype recombinant strain. By definition, the mixed infection occurs when multiple mixed infection occurs when multiple phylogenetically phy·lo·ge·net·ic adj. 1. Of or relating to phylogeny or phylogenetics. 2. Relating to or based on evolutionary development or history: a phylogenetic classification of species. distinct copies of the same gene representing different viral genomes are present within one patient (24). In contrast, in the mosaic strain, different viral regions within the same genome are classified by phylogenetic phy·lo·ge·net·ic adj. 1. Of or relating to phylogeny or phylogenetics. 2. Relating to or based on evolutionary development or history. analysis into different subtypes (3). Potential HIV-1 mixed infections involving distinct HIV-1 variants were segregated from single infections caused by only one subtype by using a restriction fragment length polymorphism restriction fragment length polymorphism n. Abbr. RFLP Intraspecies variations in the length of DNA fragments generated by the action of restriction enzymes and caused by mutations that alter the sites at which these enzymes act, changing (RFLP RFLP abbr. restriction fragment length polymorphism RFLP restriction fragment length polymorphism. RFLP ) screening assay of the prt gene (5,7). The restriction map restriction map for a DNA molecule, is constructed for a particular restriction endonuclease by ordering the fragments left to right in the DNA molecule. By convention, there are six fragments which are labeled in order of decreasing size, ABCDEF, but the order left to right in the profiles of the viral prt allow the segregation of HIV-1 strains to subtypes A, B, C, D, and F (Figure 1A). AluI digestion patterns separate subtypes A, C, and F from subtypes B and D. Sequential restriction analysis of prt using HinfI, BclI, and ScaI restriction enzymes further differentiates among these two subtype groups. The simultaneous occurrence of more than one digestion pattern indicates a potential mixed infection (Figure 1B). We selected recombinants among RFLP-subtyped single infections by additionally subtyping the C2-V3 env region with the heteroduplex mobility assay (25). Subtype discrepancies between prt and env regions were considered potential HIV-1 recombinants. All potential multiple infections and recombinants were analyzed by sequence analysis. The search for recombinants was further expanded by sequence analysis of the entire p17 gag or a 311-bp of the p24 gag fragment or both among preselected prt-env recombinants, all prt-env subtype F, and some prt-env subtype B viruses. [Figure 1 ILLUSTRATION OMITTED] Polymerase Chain Reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is (PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) ) Uncultured or cultured peripheral blood peripheral blood Cardiology Blood circulating in the system/body mononuclear mononuclear /mono·nu·cle·ar/ (-noo´kle-er) 1. having but one nucleus. 2. a cell having a single nucleus, especially a monocyte of the blood or tissues. mon·o·nu·cle·ar adj. cells from patients were used for nested-PCR of the entire HIV-1 protease HIV-1 protease is an aspartyl protease that is essential for the life-cycle of HIV. Inhibition of this protease prevents maturation of HIV particles. As such, many drugs have been developed, so-called protease inhibitors, that target this enzyme. gene (prt, 297-bp), p24 gag fragment (311-bp), and C2-V3 domain of env (565-bp) (6.7). The outer primers for amplification of a 717-bp gag fragment spanning the entire 17 gag region and a 311-bp of p24 gag were LTRF: 5'GGGCTAATTTGGTCAAAAAGAAG; nucleotide position: 6-28, HIV-[1.sub.MN], and P24RA: 5'ATGTCACTTCCCCTTGGTTCT; nucleotide position: 1482-1502. The inner primers were P17F: 5'GCAAGAGGCGAGGGGCAGCAGCCG; nucleotide position: 716-739, and P17R: 5'CCCATTCTGCAGCTTCATTGA; nucleotide position: 1413-1433. The outer primers for amplification of a 1,444-bp fragment from p24 gag to the reverse transcriptase Reverse transcriptase Any of the deoxyribonucleic acid (DNA) polymerases present in particles of retroviruses which are able to carry out DNA synthesis using an RNA template. region were P24F1: 5'ATAGAGGAAGAGCAAAACAAAA; nucleotide position: 1,099 to 1,120, and MOPR MOPR Mission Operations Planning Review (NASA) MoPR Mobility Public Relations MOPR Musicians of the Old Post Road (Waltham, MA period chamber ensemble) 1: 5'AAAATTGGAGTATTGTATGGATT; nucleotide position: 2,724 to 2,746. The inner primers were P24FA: 5'CAAAATTACCCTATAGTGCA; nucleotide position: 1,177 to 1,196, and MOPR2: 5'GGTCCATCCATTCCTGGTTT; nucleotide position: 2,601 to 2,620. PCR conditions were the same for amplification of all viral regions (7). Sensitivity of Detection of Dual Infections To determine the sensitivity of detection of dual infections by the RFLP assay, we mixed 5, 10, 25, 50, and 100 copies of subtypes B and F cloned proviral DNA DNA: see nucleic acid. DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. in equal proportions or in ratios 1:2, 1:4, 1:10, and 1:20 for nested PCR amplification of prt (Table 1). For each combination, one to prt (Table 1). For each combination, one to four independent PCR reactions were run. The simultaneous amplification of the viral prt of subtypes B and F was evaluated by the RFLP assay. PCR controls included DNA templates of single HIV-1 subtypes. Table 1. Sensitivity of detection of HIV-1 dual infections caused by viruses of subtypes B and F
No. of viral AluI digestion
subtype No. of patterns of prt
F B Ratio experi-
F:B ments B F B&F
100 100 1:1 1 - - +
50 50 1:1 4 - - +
25 25 1:1 4 - +(1) +(3)
10 10 1:1 4 - - +
5 5 1:1 4 - +(3) +(1)
100 5 20:1 2 - + (1) + (1)
100 10 10:1 2 - + (1) + (1)
100 25 4:1 2 - + -
100 50 2:1 2 - - +
5 100 1:20 1 - - +
10 100 1:10 1 - - +
25 100 1:4 1 - - +
50 100 1:2 1 - - +
100 0 3 - + -
50 0 3 - + -
25 0 3 - + -
10 0 3 - + -
5 0 2 - + -
0 100 3 + - -
0 50 2 + - -
0 25 3 + - -
0 10 3 + - -
0 5 3 + - -
Absence (-) and presence (+) of AluI digestion pattern of prt characteristic for subtype B, subtype F, and combination of subtypes B and F (Fig. 1). The cloned proviral DNA of HIV-1 subtypes B and F spanning a 1444-bp fragment from p24 gag to rt was used for the nested PCR amplification of prt. Amplified products were digested with AluI restriction enzyme, and the presence of two digestion patterns was analyzed on a 10% polyacrylamide gel pol·y·a·cryl·a·mide gel n. A hydrated polymer consisting of a long chain of amide groups, used as a medium for substances that undergo gel electrophoresis. by ethidium-bromide staining. Cloning, Sequencing, and Phylogenetic Analysis The PCR-amplified proviral prt sequences from potential dual infections were cloned by using the Original TA Cloning Kit (Invitrogen, Carlsbad, CA, USA). DNA from 30 clones of each specimen was screened for distinct HIV-1 sequences by the RFLP assay (7). Double-stranded viral DNA from selected clones or from direct PCR-amplified prt, p17 and p24 gag, and C2-V3 env products was cycle-sequenced in both directions with fluorescent dye Noun 1. fluorescent dye - a yellow dye that is visible even when highly diluted; used as an absorption indicator when silver nitrate solution is added to sodium chloride in order to precipitate silver chloride (turns pink when no chloride ions are left in solution and labeled sequencing terminators (26). Sequencing reactions were run in an automated DNA sequencer A DNA sequencer is an instrument used to automate the DNA sequencing process. DNA sequencers have become more important due to large genomics projects and the need to increase productivity. (Applied Biosystems Applied Biosystems, Inc. (formerly NASDAQ: ABIO) is the original name of a pioneer biotechnology company founded in 1981 in Foster City, California, among the Silicon Valley cities of the southern San Francisco Bay Area. , Foster City, CA, USA). The sequences were aligned by the CLUSTAL multiple sequence alignment A multiple sequence alignment (MSA) is a sequence alignment of three or more biological sequences, generally protein, DNA, or RNA. In general, the input set of query sequences are assumed to have an evolutionary relationship by which they share a lineage and are descended from a program (27). After gaps were eliminated, the aligned sequences were analyzed by the maximum likelihood method, with the fastDNAml program, which uses randomized ran·dom·ize tr.v. ran·dom·ized, ran·dom·iz·ing, ran·dom·iz·es To make random in arrangement, especially in order to control the variables in an experiment. data input and global rearrangement (28). Additionally, the neighbor joining method (PHYLIP PHYLIP Phylogeny Inference Package (genetics software) package version 3.5c [29]) was used, with or without bootstrapping Bootstrapping A procedure used to calculate the zero coupon yield curve from market figures. Notes: Since the T-bills offered by the government are not available for every time period, the bootstrapping method is used to fill in the missing figures in order to derive the . The stability of the tree's topology was tested by pruning (removing one sequence from the alignment and rerunning the phylogenetic analysis). The SIV-cpz sequences (GenBank accession no. X52154) were used as outgroups. HIV-1 sequences generated in this study have been submitted to GenBank. Results Detection of Mixed Infections RFLP analysis of the prt gene showed the simultaneous presence of two different digestion patterns in specimens from 10 of 79 patients. A complex pattern composed of elements of AluI patterns #1 (subtypes A, C, or F) and #2 (subtypes B or D) was identified in nine patients, and a combination of two HinfI digestion patterns (subtypes B and D) was found in one patient (Figure 1B). These data suggest that each of 10 patients could be infected with multiple distinct HIV-1 subtypes. The remaining 69 samples were classified as single infections caused by viruses of prt subtypes B (59) and F (10). The PCR-amplified viral prt products from these 10 patients were cloned and sequenced to confirm the presence of mixed infections. Sequence analysis showed the simultaneous presence of two distinct HIV-1 variants in only three patients: BR45, BR62, and BR83. The nucleotide divergence between the two prt sequences within the patients was 6.8% for BR45, 7.4% for BR62, and 7.1% for BR83, indicating two distinct HIV-1 variants in each of these patients (6). Phylogenetic analysis confirmed these findings and demonstrated that the divergent HIV-1 prt sequences segregated into subtypes B and F (BR45), subtypes D and F (BR62), and subtypes B and D (BR83) (Figure 2a). In the remaining seven specimens, the observed RFLP results were consequences of either point mutations in AluI restriction site restriction site n. A site in a DNA segment in which the bordering bases are vulnerable to restriction enzymes. Also called cleavage site. (five cases) or G A hypermutation (two cases), which occurred across one of the sequences within each specimen and destroyed the defining AluI sites. These changes in AluI restriction sites Restriction sites, or restriction recognition sites, are particular sequences of nucleotides that are recognized by restriction enzymes as sites to cut the DNA molecule. The sites are generally palindromic, (because restriction enzymes usually bind as homodimers) and a particular gave rise to genetically distinct quasispecies within the patients but did not represent distinct subtypes, as further confirmed by phylogenetic analysis (e.g., BR55-1 and BR55-2, and BR99-1 and BR99-2 in Figure 2a). Thus, despite the presence of mixed AluI digestion patterns in these seven specimens, they were classified as single infections of subtype B variants. [Figure 2 ILLUSTRATION OMITTED] To address the issue of potential laboratory contamination, we collected repeat blood samples from dually infected patients approximately 1 year later and processed them on separate occasions. (Blood was unlikely to be contaminated contaminated, v 1. made radioactive by the addition of small quantities of radioactive material. 2. made contaminated by adding infective or radiographic materials. 3. an infective surface or object. during collection because a disposable vacutainer system was used to obtain each blood sample.) The sequence data from the first and second blood samples of each person showed a 98% to 99% similarity. Also, the viral sequences from these patients were distinct from those of laboratory strains (Figure 2a; 855M, 8,986, and 9,001) commonly used as standards. Sensitivity of Detection of Dual Infections To investigate the sensitivity of the RFLP screening method, we performed reconstruction experiments, in which two distinct viral DNA templates of subtypes B and F were analyzed in the same reaction mixture (Table 1). When equal proportions of 10 to 100 HIV-1 DNA template copies were used for prt amplification, two viral subtypes could be simultaneously detected in all but one of 19 experiments. However, when five or fewer copies of each viral subtype were used, two subtypes were identified in only one of four assays; in the remaining three assays either subtype B or subtype F amplicons, but not both, were found. Similarly, in experiments containing varying proportions of subtypes B and F DNA templates, the simultaneous presence of two viral subtypes could be detected in only 8 (66%) of 12 experiments. In comparison, 5 to 100 copies of a single viral subtype (B or F) were routinely amplified and identified in all control reactions. Detection of Intersubtype HIV-1 Recombinants Parallel RFLP/heteroduplex mobility assay screening for HIV-1 subtypes in the prt and env regions identified two potential recombinants among 76 single infections. Subtype F prt and subtype B env were found in both specimens BR43 and BR60 during this initial screening. The remaining specimens were classified into subtypes F (n = 8) and B (n = 66) in both prt and env regions. These prt-env potential recombinants, all subtype F specimens, and eight selected subtype B samples were further evaluated by sequence analysis, which confirmed the results of the screening assays (Figure 2a, 2b). The search for the HIV-1 recombinant genome in these 18 samples was further expanded to the gag region. Mosaic sequences of subtypes B and F were found within the p17 or p24 gag (Table 2, Figure 2. discussion below) in four prt-env subtype F variants (BR46, BR57, BR59, and BR97). Similarly, in one of two prt-env recombinants (BR60), the gag sequences had a mosaic pattern. In contrast, the p24 gag sequences of eight prt-env subtype B specimens were homogeneous and also classified as subtype B (Figure 2). Taken together, the comparative molecular analysis of gag, pol, and env regions allowed the identification of six specimens that carried HIV-1 recombinant genomes, representing five distinct mosaic structures: [B.sup.gag-p17]/[B.sup.gag-p24]/[F.sup.pol]/[B.sup.env] , [F.sup.gag-p17]/[B.sup.gag-p24]/[F.sup.pol]/[F.sup.env] , [B.sup.gag-p17]/[B-F.sup.gag- 24/[F.sup.pol]/[F.sup.env] , [B.sup.gag-p17]/[B-F.sup.gag-p24]/[F.sup.pol]/[B.sup.env] , and [F.sup.gag-p17/[B-F.sup.gag-p24]/[F.sup.pol]/[F.sup.env]. Table 2. p17/p24 gag, prt, and C2-V3 genetic subtyping of HIV-1 DNA sequences(a) from peripheral blood mononuclear cells collected from 18 patients in Rio de Janeiro
Genotypes
Specimen No. gag p17 gag p24 prt C2-V3
Group 1(b) 8 ND B B B
Group 2(d) 4 F F F F
(BR46) (NA(e)) (B) (F) (F)
(BR59) (F) (B) (F) (F)
(BR57) (F) (B/F) (F) (F)
(BR97) (B) (B/F) (F) (F)
(BR60) (B) (B/F) (F) (B)
(BR43) (B) (B) (F) (B)
(a) Recombinant specimens are shown in parentheses See parenthesis. parentheses - See left parenthesis, right parenthesis. ; B/F mosaic structure within a 311-bp of the p24 gag fragment consisting of subtypes B and F sequences. (b) Group 1: BR34, BR52, BR55, BR64, BR65, BR71, BR75, and BR92. ND = not done. (d) Group 2: BR41, BR54, BR58, and BR112. (e) NA = not available due to negative PCR. The potential crossover breakpoints within 717-bp of the p17-p24 gag mosaic sequences were examined by comparison with nucleotide signature patterns characteristic for subtypes B and F viruses (Figure 3). We performed comparative analyses with aligned DNA sequences of recombinants (BR57, BR59, BR60, and BR97), subtype B (MN and BR43), and subtype F variants (BR41, BR54, BR58, and BR112). This analysis confirmed an intragene recombination within p24 gag in specimens BR57, BR60, and BR97--a finding consistent with our failure to phylogenetically assign these gag sequences to any known subtype (Figure 2c). [Figure 3 ILLUSTRATION OMITTED] The putative breakpoints within the intragene recombinant sequences were located between nucleotides 97 and 137 in sample BR57 and between nucleotides 173 and 213 in BR60 and BR97 (Figure 3). The exact breakpoint The location in a program used to temporarily halt the program for testing and debugging. Lines of code in a source program are marked for breakpoints. When those instructions are about to be executed, the program stops, allowing the programmer to examine the status of the program position could not be determined because of extensive sequence homology homology (hōmŏl`əjē), in biology, the correspondence between structures of different species that is attributable to their evolutionary descent from a common ancestor. between subtypes B and F in this viral region. This analysis also revealed putative crossover breakpoints for variants BR57 and BR59 in proximity to the coding region The coding region of a gene is the portion of DNA that is transcribed into mRNA and translated into proteins. This does not include such regions as a recognition site, initiator sequence, or termination sequence, only the region that will directly code for amino acid linkage. for the p17-p24 protein-processing site. The potential breakpoints between the second half of gag and the beginning of pol region in variants BR43, BR46, and BR59 are being investigated. To examine the possibility of in vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment. in vi·tro adj. In an artificial environment outside a living organism. recombination during PCR amplification (30), we performed PCR amplification of the long fragments covering the gag and prt area in the endpoint- diluted lysates (31). To ensure that endpoint PCR products were amplified from single copy templates, we used samples only from dilutions at which 1 of 10 PCR amplifications were productive for further sequence analysis. The comparative analysis of the entire p17 gag, p24 gag, and prt sequences demonstrated 98% homology between the undiluted and diluted lysates--strong evidence that the recombinant sequences were not a result of the PCR amplification process. Epidemiologic and Clinical Characteristics The mean ages of patients infected with HIV-1 of single subtype B or F were not different from those with dual or recombinant infections (p = 0.77) (Table 3). In addition, the patients did not differ significantly by gender, risk group, and clinical stage of disease (p = 0.44 to p = 0.48). The patients infected with HIV-1 subtype B (403) and subtype F (854) did, however, differ (p = 0.04) by mean CD4 counts. Although dates of seroconversion seroconversion /se·ro·con·ver·sion/ (-con-ver´zhun) the change of a seronegative test from negative to positive, indicating the development of antibodies in response to immunization or infection. were not known for all patients, the earliest HIV-positive results were reported among patients infected with subtype B (in agreement with previous observations that the spread of subtype B viruses occurred earlier than other HIV-1 subtypes in Brazil [16.17]), which might explain the difference in CD4 counts. Table 3. Characteristics of the study population
Dual Recombinant
infection infection
Characteristic n=3 n=6
Gender (Female/male) 1/2 3/3
Mean age in years (range) 36 (30-44) 34 (25-45)
Clinical stage(a)
1 3 5
2 - 1
3 - -
4 - -
Mean CD4 cells (range) 527 (404-743) 484 (190-821)
Years of 1st serologic tests
1985-1987 - -
1988-1991 2 2
1992-1994 1 4
Heterosexual 2 5
Homosexual 1 -
Bisexual - -
Blood transfusion recipient - -
Intravenous drag user - -
Multiple factors - 1
Unknown - -
Subtype B Subtype F
Characteristic n=66 n=4
Gender (Female/male) 24/42 3/1
Mean age in years (range) 37 (23-60) 34 (26-43)
Clinical stage(a)
1 29 4
2 17 -
3 14 -
4 6 -
Mean CD4 cells (range) 403 (59-1281)(b) 823 (570-1270)
Years of 1st serologic tests
1985-1987 -
1988-1991 30 2
1992-1994 34 2
Heterosexual 27 4
Homosexual 19 -
Bisexual 8 -
Blood transfusion recipient 3 -
Intravenous drag user 1 -
Multiple factors 2 -
Unknown 6 -
(a) WHO staging system WHO staging system AIDS A simplified AIDS staging system proposed by the WHO Global Programme on AIDS that is flexible enough to be used in different regions, based on 4 groups of clinical conditions that have prognostic significance and therefore [32]. (b) Based on data available for 54 patients. Conclusions HIV-1 infections caused by dual and intersubtype-recombinant genome may be relatively common among HIV-1-infected Brazilians. Using both heteroduplex mobility assay and RFLP screening methods, as well as sequencing, we identified three dual (3.8%) and six recombinant (7.6%) infections involving distinct viral subtypes among 79 HIV-1-infected persons from Rio de Janeiro. We chose viral prt to screen for dual infections because this highly conserved region The term Conserved region may refer to:
se·ro·pos·i·tive adj. samples collected from the Americas, Asia, Africa, and Europe (data not shown). Moreover, the RFLP assay of the prt gene is convenient for screening a large number of samples (5). The detection of B/F, B/D, and F/D F/D Flight Director F/D Focal Length to Diameter Ratio F/D Filter Demineralizer F/D Field of Drawing (engineering drawings) dual infections is in agreement with our 1993 study among patients from the same Rio de Janeiro cohort, which showed five dual HIV-1 infections involving subtypes F and B (one case), F and D (one case), and B and C (three cases of familial clustering) among 21 HIV-infected persons (5-7). Interestingly, dual infections involving HIV-1 subtype D continue to be detected in patients from Rio de Janeiro, an area with a high predominance of HIV-1 subtypes B and F, but rare subtype D, single infections. Because retrospective specimens (peripheral blood mononuclear cells) were not available for these patients, we could not confirm whether the acquisition of mixed strains was sequential (superinfection superinfection /su·per·in·fec·tion/ (-in-fek´shun) a new infection occurring in a patient having a preexisting infection, such as bacterial superinfection in viral respiratory disease or infection of a chronic hepatitis B carrier with ) or simultaneous. However, combination of subtypes F or B with rare subtype D viruses among some dual infections may suggest that in these cases two viral strains might be acquired through cotransmission rather than through superinfection. All naturally occurring HIV-1 dual infections are likely not detected by current methods. First, quantitative differences in two distinct viral DNA templates in the sample can lead to selective PCR amplification of only one subtype. Second, despite targeting conserved genes such as prt, some divergent viral strains may escape PCR amplification because of primer mismatches. Finally, a single nucleotide mutation in the endonuclease endonuclease /en·do·nu·cle·ase/ (-noo´kle-as) any nuclease specifically catalyzing the hydrolysis of interior bonds of ribonucleotide or deoxyribonucleotide chains. restriction site can abrogate abrogate v. to annul or repeal a law or pass legislation that contradicts the prior law. Abrogate also applies to revoking or withdrawing conditions of a contract. (See: repeal) the recognition pattern and distort detection of dual infections in the RFLP analysis. These observations suggest that the rate of HIV-1 mixed infections within this Brazilian cohort might be even higher than 4%. Our previous findings of five dual infections among 21 patients from the same cohort support this assumption. If we take into account these five cases, the percentage of mixed infections caused by viruses of distinct subtypes circulating between 1993 and 1994 among 100 patients analyzed from this Rio de Janeiro cohort would increase to 8%. The potential underestimate of mixed infections is highlighted by the additional detection of 6 (7.6%) distinct recombinants within the cohort. This finding is consistent with the estimated 5% to 10% intersubtype mosaics among HIV-1 genomes in the Los Alamos Los Alamos (lôs ăl`əmōs', lŏs), uninc. town (1990 pop. 11,455), seat of Los Alamos co., N central N.Mex. It is on a long mesa extending from the Jemez Mts. The U.S. database (3). Interestingly, all recombinant or mosaic genomes described in this report involved only subtypes B and F viral regions, although dual infections caused by other subtypes were also circulating in this cohort. Moreover, our results indicate that recombination between gag and pol (pro regions is more frequent than between pol and env and lead to speculation that such stable B/F mosaics have selective advantage. Such observations support the assumption that recombination within the gag gene gag gene a gene which encodes precursors of internal virion proteins found in the retroviral genome. occurs more often than within other viral regions (33) and emphasize the need for rapid subtyping methods specific to the gag region. To investigate the potential impact of dual and recombinant infections on the clinical status of patients, we compared the clinical and demographic characteristics of these patients with those of patients infected with one nonrecombinant non·re·com·bi·nant adj. Not resulting from or involved in genetic recombination: nonrecombinant microbial cells. viral subtype. Epidemiologic information for all 79 patients was available only at the first draw of blood. Although the results did not show significant differences between the two groups, the possibility of differences exists. Our findings provide the first baseline measure of the range of HIV variability in Rio de Janeiro from 1993 to 1994 and the proportion of dual and recombinant infections among the HIV-infected Brazilian population. Future systematic molecular epidemiologic surveys of HIV heterogeneity in Rio de Janeiro may show the potential changes in the molecular profile of the HIV/AIDS epidemic over time; the laboratory tools we used to identify single, dual, and recombinant infections may be useful in such investigations. Nevertheless, our study on genetic variation of HIV-1 subtypes among blood donors from the state of Rio de Janeiro documented the presence of mosaic viruses of subtypes B and F and subtypes B and D in blood units collected in 1996 (34). Moreover, recent genetic analysis of viral strains collected in 1997 from HIV-1-infected patients living in Manaus (a city in Brazil's Amazon region) showed the presence of dual infections and recombinants caused by subtypes B and F viruses (A. Tanuri, pers. comm.). Therefore, these data indicate that the heterogenic het·er·o·gen·ic or het·er·o·ge·ne·ic adj. Relating to different gene constitutions, especially with respect to different species. pattern of HIV-1 infections, first observed in Rio de Janeiro, also exists in other regions of Brazil Brazil is currently divided in five regions, by the Instituto Brasileiro de Geografia e Estatistica (IBGE). These divisions are composed by states with similar cultural, economical, historical and social aspects, and although through the scientific point of view information given by this . Our findings indicate that mixed infections and mosaic viruses may be more common in worldwide epidemics than previously thought and, therefore, may provide a basis for developing AIDS vaccines and predicting the global evolution of HIV. Acknowledgments We thank Priscilla Swanson for her help in sequencing and Renu Lal for critical review of the manuscript. Artur Ramos is a graduate fellow at the Federal University of Rio de Janeiro, Rio de Janeiro, Brazil. His laboratory research focuses on HIV-1 genetic variability Introduction Genetic Variability
Address for correspondence: Danuta Pieniazek, HIV/Retrovirus Diseases Branch, Division of AIDS, STD (Subscriber Trunk Dialing) Long distance dialing outside of the U.S. that does not require operator intervention. STD prefix codes are required and billing is based on call units, which are a fixed amount of money in the currency of that country. , and TB Laboratory Research, CDC, 1600 Clifton Road, MS G 19, Atlanta, GA, 30333, USA; fax: 404-639-1010; e-mail: dxpl@cdc.gov. References (1.) Leitner T. Genetic subtypes of HIV-1. In: Myers G, Foley B, Mellors JW, Korber B, Jeang KT, Wain-Hobson S, editors. Human Retroviruses and AIDS. Theoretical Biology and Biophysics biophysics, application of various methods and principles of physical science to the study of biological problems. In physiological biophysics physical mechanisms have been used to explain such biological processes as the transmission of nerve impulses, the muscle , Los Alamos National Laboratory Los Alamos National Laboratory (LANL) (previously known at various times as Site Y, Los Alamos Laboratory, and Los Alamos Scientific Laboratory) is a United States Department of Energy (DOE) national laboratory, managed and operated by Los Alamos National , Los Alamos, New Mexico Los Alamos (Spanish: Los Álamos, meaning "The Cottonwoods") is an unincorporated townsite in Los Alamos County, New Mexico. The population of the townsite alone was 11,909 at the 2000 census. The townsite or "the hill" is one part of town while White Rock is also part of the town. ; 1996: 11128-40. (2.) Hu DJ, Dondero TJ, Rayfield MA, George JR, Schochetman G, Jaffe HW, et al. The emerging genetic diversity of HIV. The importance of global surveillance for diagnostics, research, and prevention. JAMA JAMA abbr. Journal of the American Medical Association 1996;275:210-6. (3.) Robertson DL, Sharp PM, McCutchan FE, Hahn BH. Recombination in HIV-1. Nature 1995;374:124-6. (4.) Artenstein AW, VanCott TC, Mascola JR, Carr JC, Hegerich PA, Gaywee J, et al. Dual infection with human immunodeficiency virus human immunodeficiency virus n. HIV. Human immunodeficiency virus (HIV) A transmissible retrovirus that causes AIDS in humans. type 1 of distinct envelope subtypes in humans. J Infect Dis 1995;171:805-10. (5.) Pieniazek D, Janini LM, Ramos A, Tanuri A, Schechter M, Peralta JM, et al. HIV-1 patients may harbor viruses of different phylogenetic subtypes: implications for the evolution of the HIV/AIDS pandemic. Emerg Infect Dis 1995; 1:86-8. (6.) Janini LM, Tanuri A, Schechter M, Peralta JM, Vicente AC, Dela Torre N, et al. Horizontal and vertical transmission of human immunodeficiency virus type 1 dual infections caused by viruses of subtypes B and C. J Infect Dis 1998;177:227-31. (7.) Janini LM, Pieniazek D, Peralta JM, Schechter M, Tanuri A, Vicente AC, et al. Identification of single and dual infections with distinct subtypes of human immunodeficiency virus type 1 by using restriction fragment length polymorphism analysis. Virus Genes 1996; 13:69-81. (8.) Moran N, Soler A, Flores Flores, town, Guatemala Flores (flōrəs), town (1990 est. pop. 2,200), capital of Petén department, N Guatemala. Flores was built on an island in the southern part of Lake Petén Itzá and on the site of the I, Alegria M, Vera M, Pieniazek D, et al. Multi-strain HIV-1 infection among female sex workers in Puerto Rico: emerging pattern of HIV-1 epidemic. 4th Conference on Retroviruses and Opportunistic Infections Opportunistic infections Infections that cause a disease only when the host's immune system is impaired. The classic opportunistic infection never leads to disease in the normal host. [abstract 170]. Washington DC, January 1997. (9.) Kampinga G, Simonon A, van de Perre P, Karita E, Maellati P, Goudsmit J. Primary infections with HIV of women and their offspring in Rwanda: Findings of heterogeneity at seroconversion, coinfection and recombinants of HIV-1 subtypes A and C. Virology virology, study of viruses and their role in disease. Many viruses, such as animal RNA viruses and viruses that infect bacteria, or bacteriophages, have become useful laboratory tools in genetic studies and in work on the cellular metabolic control of gene expression 1997;227:63-76. (10.) Takehisa J, Zekeng L, Mlura T, Ido E, Yamashita M, Mboudjeka I, et al. Triple HIV-1 infection with group O and group M of different clades in a single Cameroonian AIDS patient. J Acquired Immune Defic Syndr 1997; 14:81-2. (11.) Pieniazek D, Janini ML, Ramos A, Bandea C, Soriano V, Downing R, et al. Mixed infections with HIV-1 strains of different phylogenetic subtypes: implication for the evolution of the HIV/AIDS pandemic. 3rd Conference on Retroviruses and Opportunistic Infections [abstract]. Washington DC, January 1996. (12.) Carr JK, Salminen MO, Koch D, Gotte A, Artenstein AW, Hegerich PA, at al. Full length sequence and mosaic structure of a human immunodeficiency virus type 1 isolate from Thailand. J Virol 1996;70:5935-43. (13.) Wasi C, Herring B, Raktham S, Vanichseni S, Mastro TD, Young NL, et al. Determination of HIV-1 subtypes in injecting drug users in Bangkok, Thailand, using peptide-binding enzyme immunoassay Immunoassay An assay that quantifies antigen or antibody by immunochemical means. The antigen can be a relatively simple substance such as a drug, or a complex one such as a protein or a virus. and heteroduplex mobility assay: evidence of increasing infection with HIV-1 subtype E. AIDS 1995;9:843-9. (14.) Abimicu AG, Stern TL, Zwandor A. Subgroup G HIV-type 1 isolates from Nigeria. AIDS Res Hum Retroviruses 1994; 10:1581-3. (15.) Brazilian Ministry of Health. Boletim Epidemiologico-AIDS: Semana Epidemiologica-36 a 48-setembro a novembro de 1997. 1997; 10:no 04 [http//www.aids.gov.br]. (16.) Potts KE, Kalish ML, Lott T, Orloff G, Luo CC, Bernard MA, et al. Genetic heterogeneity of the V3 region of the HIV-1 envelope glycoprotein glycoprotein (glī'kōprō`tēn), organic compound composed of both a protein and a carbohydrate joined together in covalent chemical linkage. in Brazil. AIDS 1993;7:1191-7. (17.) Pinto ME, Tanuri A, Schechter M. Molecular and epidemiologic evidence for the discontinuous discontinuous /dis·con·tin·u·ous/ (dis?kon-tin´u-us) 1. interrupted; intermittent; marked by breaks. 2. discrete; separate. 3. lacking logical order or coherence. introduction of subtypes B and F into Rio de Janeiro. Brazil. J Acquired Immune Defic Syndr. In press 1998. (18.) Louwagie J, Delwart EL, Mullins JI, McCutchan FE, Eddy G, Burke DS, et al. Genetic analysis of HIV-1 isolates from Brazil reveals presence of two distinct genetic subtypes. AIDS Res Hum Retroviruses 1994; 10:561-7. (19.) Morgado MG, Sabino EC, Shpaer EG, Bongertz V, Brigido L, Guimaraes MD, et al. V3 region polymorphisms in HIV-1 from Brazil: prevalence of subtype B strains divergent from North American/European prototype and detection of subtype F. AIDS Res Hum Retroviruses 1994;10:569-76. (20.) World Health Organization. HIV type 1 variation in World Health Organization-sponsored vaccine evaluation sites: genetic screening, sequence analysis, and preliminary biological characterization of selected viral strains. AIDS Res Hum Retroviruses 1994; 10:1327-43. 21. Sabino EC, Diaz RS, Brigido LF, Learn GH, Mullins JI, Reingold AL, et al. Distribution of HIV-1 subtypes seen in an AIDS clinic in Sao Paulo City, Brazil. AIDS 1996; 10:1579-84. (22.) Sabino EC, Shpaer EG, Morgado MG, Korber BT, Diaz RS, Bongertz V, et al. Identification of human immunodeficiency virus type 1 envelope genes recombinant between subtypes B and F in two epidemiologically linked individuals from Brazil. J Virol 1994;68:6340-6. (23.) Schechter M, Zajdenverg R, Machado LL, Pinto ME, Lima LA, Perez MA. Predicting CD4 counts in HIV-infected Brazilian individuals: a model based on the World Health Organization staging system Staging system A system based on how far the cancer has spread from its original site, developed to help the physician determine how best to treat the disease. Mentioned in: Neuroblastoma . J Acquired Immune Defic Syndr 1994;7:163-8. (24.) Zhu T, Wang N, Carr A, Wolinsky S, Ho D. Evidence for coinfection by multiple strains of human immunodeficiency virus type 1 subtype B in an acute seroconvertor. J Virol 1995 ;69:1324-7. (25.) Delwart EL, Shpaer EG, Louwagie J, McCutchan FE, Grez M, Rubsamen-Waigmann H, et al. Genetic relationships determined by a DNA heteroduplex mobility assay: analysis of HIV-1 env genes. Science 1993;262:1257-61. (26.) Ou CY, Ciesielski CA, Myers G, Bandea CI, Luo CC, Korber BT, et al. Molecular epidemiology of HIV transmission in a dental practice. Science 1992;256:1165-71. (27.) Higgins DG, Sharp PM. Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl Biosci 1989;5:151-3 (28.) Maidak BL, Larsen N, McCaughey MJ, Overbeek R, Olsen GJ, Fogel K, et al. The Ribosomal Database Project. Nucleic Acids Nucleic acids The cellular molecules DNA and RNA that act as coded instructions for the production of proteins and are copied for transmission of inherited traits. Res 1994;22:3485-7. (29.) Felsenstein J. PHYLIP-phylogeny interference package (version 3.2). Cladistics cladistics (klədĭs`tĭks) or phylogenetic systematics (fī'lōjənĕt`ĭk) 1989;5:164-6. (30.) Meyerhans A, Vartanian JP, Wain-Hobson S. DNA recombination during PCR. Nucleic Acids Res 1990;18:1687-91. (31.) Simmonds P, Balfe P, Peutherer JF, Ludlam CA, Bishop JO, Brown AJ. Human immunodeficiency virus-infected individuals contain provirus provirus /pro·vi·rus/ (pro-vi´rus) the genome of an animal virus integrated (by crossing over) into the chromosome of the host cell, and thus replicated in all of its daughter cells. in small numbers of peripheral mononuclear cells and at low copy numbers. J Virol 1990;64:864-72. (32.) World Health Organization. Acquired immunodeficiency syndrome acquired immunodeficiency syndrome, see AIDS. (AIDS): interim proposal for a WHO staging system for HIV infection and disease. Wkly Epidemiol Rec 1990;65:221-8. (33.) Comelissen M, Kampinga G, Zorgdrager F, Goudsmit J, and the UNAIDS UNAIDS Joint United Nations Programme on HIV/AIDS Network for HIV Isolation and Characterization. Human immunodeficiency virus type 1 subtypes defined by env show high frequency of recombinant gag genes. J Virol 1996;70:8209-12. (34.) Tanuri A, Swanson P, Devare S, Berro OJ, Savedra A, Costa L J, et al. HIV-1 subtypes among blood donors from Rio de Janeiro, Brazil. J Acquired Immune Defic Syndr. In press 1998. Artur Ramos,(*)([dagger]) Amilcar Tanuri,([dagger]) Mauro Schechter,([dagger]) Mark A. Rayfield,(*) Dale J. Hu,(*) Maulori C. Cabral,([dagger]) Claudiu I. Bandea,(*) James Baggs([double dagger]) and Danuta Pieniazek(*) (*) Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center. , Atlanta, Georgia, USA; ([dagger]) Universidade Federal do Rio de Janeiro The Federal University of Rio de Janeiro (Portuguese: Universidade Federal do Rio de Janeiro, UFRJ) is the largest federal university of Brazil, where state-owned universities are the best and most qualified institutions. , Brazil; ([double dagger]) Emory University, Atlanta, Georgia, USA |
|
||||||||||||||||||

thĭ zhənĕē`r
Printer friendly
Cite/link
Email
Feedback
Reader Opinion