Printer Friendly
The Free Library
5,670,445 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Distemper outbreak and its effect on African wild dog conservation. (Dispatches).


In December 2000, an infectious disease spread through a captive breeding group of African wild dogs (Lycaon pictus) in Tanzania, killing 49 of 52 animals within 2 months. The causative agent was identified as Canine distemper virus (CDV (1) (Compressed Digital Video) The compression of full-motion video for high-speed, economical transmission.

(2) (CD Video) A small videodisc (5" diameter) that provides five minutes of video with digital sound plus an additional 20 minutes
) by means of histologic examination, virus isolation; reverse transcriptase-polymerase chain reaction analysis, and nucleotide sequencing. This report emphasizes the importance of adequate protection against infectious diseases for the successful outcome of captive breeding programs of endangered species.

**********

The African wild dog (Lycaon pictus) is a highly endangered carnivore carnivore (kär`nəvôr'), term commonly applied to any animal whose diet consists wholly or largely of animal matter. In animal systematics it refers to members of the mammalian order Carnivora (see Chordata).  found in Africa south of the Sahara. Its population, estimated at <5,500, has declined dramatically in recent decades. Suggested causes for this decline include habitat loss, killing by humans, reduced prey availability, competition with other carnivores, and infectious diseases, including rabies and canine distemper (1).

As part of a conservation plan for the African wild dog, a captive breeding program was established in 1995 at Mkomazi Game Reserve Mkomazi Game Reserve is located in North Eastern Tanzania on the Kenyan Border. It was established in 1951 and is found in Kilimanjaro Region and Tanga Region. Mkomazi game reserve is one of the only places in the whole Tanzania to spot the black rhinoceros. , Tanzania, under the

auspices of the Government of Tanzania. A founder group of 25 animals was divided into four breeding packs, each housed in a separate fenced enclosure. The founder members and captive-born pups were vaccinated against canine distemper with a vaccine successfully used in seals (2), rabies (Rabdomun, Schering-Plough Animal Health, Brussels, Belgium), and parvoviral disease and leptospirosis leptospirosis (lĕp'təspīrō`sĭs), febrile disease caused by bacteria of the genus Leptospirae. The disease occurs in dogs, cattle, pigs, sheep, goats, and horses and is transmissible to humans.  (combination vaccine: Dohyvac I-LP, Solvay Duphar, Weesp, the Netherlands). The vaccination schedule consisted of three consecutive vaccinations at 2- to 4-week intervals and annual revaccination re·vac·ci·na·tion
n.
Vaccination of a person previously vaccinated.
, most recently in November 1999. Blood samples from a proportion of the vaccinated animals were collected at the time of vaccination to monitor immune response.

The Outbreak

On December 20, 2000, two of the African wild dogs in one of the breeding packs became ill from an apparently infectious disease. The disease spread rapidly and was first noted in the other breeding packs on January 16, 18, and 22, 2001, respectively. The first deaths occurred on December 21, 2000; deaths peaked from January 30 to February 6, 2001, when 15 of the wild dogs died. The last death was recorded on February 13, 2001. Forty-nine of the 52 animals died during this outbreak.

Neutralizing antibody levels to Canine distemper virus (CDV), determined by methods similar to those used in a study of large felids felids

cats.
 (3), were measured in serum samples collected from nine African wild dogs on November 8, 2000. One of the three animals that survived the outbreak had a neutralizing antibody titer of 20; the other two were not tested. The sera from the remaining eight animals had a titer of <20, which is considered to be below the level of protection against canine distemper (4).

Tissue samples from nine animals that had died were used for histologic examination (n=6), virus isolation (n=2), and reverse transcriptase-polymerase chain reaction (RT-PCR RT-PCR

reverse transcriptase-polymerase chain reaction. See PCR1.
) with Morbillivirus-specific primers P1: 5'ATGTTTATGATCA-CAGCGGT 3' and P2: 5'ATTGGGTTGCACCACTTGTC 3', which have been used before for phylogenetic analysis of morbilliviruses (5) (n=3). The results of analysis were consistent for all animals tested. The main histologic lesion was bronchointerstitial pneumonia with epithelial necrosis and multinucleated multinucleated

characterized by having more than one nucleus per cell.


multinucleated giant cell
see giant cell.
 syncytial syncytial /syn·cy·tial/ (sin-sish´al) of or pertaining to a syncytium.

syncytial

pertaining to or producing a syncytium.


bovine syncytial virus
see retroviridae.
 cells. Eosinophilic eosinophilic /eo·sin·o·phil·ic/ (-fil´ik)
1. readily stainable with eosin.

2. pertaining to eosinophils.

3. pertaining to or characterized by eosinophilia.
 intracytoplasmic intracytoplasmic /in·tra·cy·to·plas·mic/ (-si?to-plaz´mik) within the cytoplasm of a cell.  inclusion bodies, characteristic of canine distemper, were found in the epithelium of lung, kidney, intestine, and urinary bladder (Figure 1). Lung samples scored positive by RT-PCR for a Morbillivirus Morbillivirus /Mor·bil·li·vi·rus/ (-vi?rus) measles-like viruses; a genus of viruses of the family Paramyxoviridae, including the agents of measles and canine distemper.

Mor·bil·li·vi·rus
n.
 P-gene fragment. Phylogenetic analysis of the nucleotide sequences from the resulting PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 fragments demonstrated that the causative virus was most closely related to CDV (Figure 2A) and clustered with the sequences of CDV strains from domestic dogs (Canis familiaris), lions (Panthera leo), and bat-eared foxes (Otocyon megalotis) from East Africa in the 1990s (Figure 2B). P-gene fragments of the virus isolates from lung samples were identical to the sequences of the PCR products obtained directly from the tissue samples.

[FIGURE 1-2 OMITTED]

Conclusions

These results show that the primary cause of death of these African wild dogs was CDV infection. Canine distemper is highly infectious for many species of carnivores and causes high death rates in immunologically naive populations (7). It is a known cause of death in free-living African wild dogs (8), as well as other wild carnivores, both free-living and captive (9,10). Based on phylogenetic analysis, the causative virus was a CDV strain circulating in the region in the past decade (11,12) (Figure 2B).

Potential routes of transmission of this virus to the captive breeding groups are by direct contact with infected domestic dogs or wild carnivores or indirectly by contact with humans or their equipment. Domestic dog populations in some parts of Tanzania are endemically infected with CDV and were considered to be the source of infection for canine distemper in Serengeti lions in 1994 (13). Domestic dogs were not present at Mkomazi Game Reserve; however, transmission of CDV from domestic dogs in neighboring villages cannot be ruled out.

Because vaccination with live attenuated virus had been suspected of causing past deaths of African wild dogs (14,15) the animals in this breeding program were vaccinated with a CDV-ISCOM vaccine, which does not contain live virus. This vaccine protects harbor seals (Phoca vitulina) and dogs against phocine distemper virus Phocine distemper virus (PDV) is a paramyxovirus of the genus morbillivirus that is pathogenic for pinniped species, particularly seals.[1] Clinical signs include laboured breathing, fever and nervous symptoms.  infection (2), which is closely related to CDV, and resulted in protective antibody levels to CDV in African wild dogs monitored at the beginning of this captive breeding program (data not shown). However, the lack of neutralizing antibody titers to CDV in sera of these African wild dogs from November 2000 and the high death rate from canine distemper despite recent vaccination indicate vaccination failure. We are investigating possible reasons for this failure, including problems with application, maintenance of the cold chain, efficacy of the vaccine, and antiviral immune response of the African wild dogs.

Conservation of endangered species, both free-living and captive, has been jeopardized by infectious disease outbreaks in the past (10). This outbreak of canine distemper illustrates the disastrous effects that such a disease can have on inadequately protected animals. We therefore conclude that any further attempts to breed African wild dogs in captivity will need to ensure a vaccination regime against canine distemper and other infectious diseases that is both effective in this species and practical to implement under field conditions.

Acknowledgment

We thank the Ministry of Natural Resources and Tourism and the Department of Wildlife of Tanzania The Wildlife of Tanzania includes its flora and fauna and their natural habitats. Tanzania has 364 species of mammals and 1108 species of birds. Fauna
Mammals

Main article: List of mammals in Tanzania
Subclass: Theria
 for their help and support.

References

(1.) Woodroffe R, Ginsberg JR, MacDonald DWR DWR Design Within Reach
DWR Department of Water Resources
DWR Direct Web Remoting (Easy Ajax for Java)
DWR Durable Water Repellency
DWR Delayed Word Recall (medical testing)
DWR Driving While Revoked
, and The IUCN/SSC Canid Specialist Group. The African wild dog: Status survey and conservation action plan. Gland, Switzerland: IUCN IUCN

International Union for the Conservation of Nature and Natural Resources.
 Publications; 1997.

(2.) Osterhaus ADME ADME Absorption, Distribution, Metabolism, and Excretion
ADME Association of Destination Management Executives
ADME Active Duty Medical Extension
, UytdeHaag FGCM, Visser IKG IKG I Kiss Girls (website) , Vedder EJ, Reijnders P J, Kuiper J, et al. Seal vaccination success. Nature 1989;337:21.

(3.) Harder TC, Kenter M, Vos H, Siebelink K, Huisman W, van Amerongen G, et al. Canine distemper virus from diseased large felids: biological properties and phylogenetic relationships. J Gen Virol 1996;77:397-405.

(4.) Appel MJG MJG Miller Japanese Garden (California State University, Long Beach) , Gillespie JH. Canine distemper virus. In: Gard S, Hallauer C, Meyer KF, editors. Virology virology, study of viruses and their role in disease. Many viruses, such as animal RNA viruses and viruses that infect bacteria, or bacteriophages, have become useful laboratory tools in genetic studies and in work on the cellular metabolic control of gene expression  monographs, Vol. 11. Vienna-New York: Springer-Verlag; 1972. p. 3-96.

(5.) Barrett T, Visser IKG, Mamaev L, Goatley L, Van Bressem MF, Osterhaus ADME. Dolphin and porpoise porpoise, small whale of the family Phocaenidae, allied to the dolphin. Porpoises, like other whales, are mammals; they are warm-blooded, breathe air, and give birth to live young, which they suckle with milk.  morbilliviruses are genetically distinct from Phocine distemper virus. Virology 1993; 193:1010-2.

(6.) Felsenstein J. Phylogeny Inference Package. Version 3.75c. Seattle: University of Washington Department of Genetics; 1993.

(7.) Appel MJ. Canine distemper virus. In: Appel M, editor. Virus infections of carnivores. Amsterdam; Elsevier Science Publishers BV: 1987. p. 133-59.

(8.) Alexander KA, Kat PW, Munson LA, Kalake A, Appel MJG. Canine distemper related mortality among wild dog (Lycaon pictus) in Chobe National Park Chobe National Park

National preserve, northern Botswana. The preserve, which acquired national park status in 1968, borders Namibia and touches Zimbabwe and Zambia, covering 4,500 sq mi (11,700 sq km). It is noted for its wildlife, particularly its large elephant population.
 Botswana. J Zoo Wildl Med 1996;27:426-7.

(9.) Harvell CD, Kim K, Burkholder JM, Colwell RR, Epstein PR, Grimes DJ, et al. Emerging marine diseases---climate links and anthropogenic an·thro·po·gen·ic  
adj.
1. Of or relating to anthropogenesis.

2. Caused by humans: anthropogenic degradation of the environment.
 factors. Science 1999;285:1505-10.

(10.) Daszak P, Cunningham AA, Hyatt AD. Emerging infectious diseases of wildlife--threats to biodiversity and human health. Science 2000;287:443-9.

(11.) Harder TC, Kenter M, Appel MJ, Roelke-Parker ME, Barrett T, Osterhaus ADME. Phylogenetic evidence of canine distemper virus in Serengeti's lions. Vaccine 1995;13:521-3.

(12.) Roelke-Parker ME, Munson L, Packer C, Kock R, Cleaveland S, Carpenter M, et al. A canine distemper virus epidemic in Serengeti lions (Panthera leo). Nature 1996;379:441-5.

(13.) Cleaveland S, Appel MG, Chalmers WS, Chillingworth C, Kaare M, Dye C. Serological serological

pertaining to or emanating from serology.


serological test
one involving examination of blood serum usually for antibody.
 and demographic evidence for domestic dogs as a source of canine distemper virus infection for Serengeti wildlife. Vet Microbiol 2000;72:217-27.

(14.) Van Heerden J, Bainbridge N, Burroughs RE, Kriek NP. Distemper-like disease and encephalitozoonosis in wild dogs (Lycaon pictus). J Wildl Dis 1989;25:70-5.

(15.) Durchfeld B, Baumgartner W, Herbst W, Brahm R. Vaccine-associated canine distemper infection in a litter of African hunting dogs (Lycaon pictus). Zentralbl Veterinarmed 1990;37:203-12.

Address for correspondence: A.D.M.E. Osterhaus, Institute of Virology, Erasmus University Rotterdam, P.O. Box 1738, 3000 DR Rotterdam, The Netherlands; fax: +31 10 408 9485; e-mail: osterhaus@viro.fgg.eur.nl

Guidelines for Dispatches, These brief articles are updates on infectious disease trends and research. The articles include descriptions of new methods for detecting, characterizing, or subtyping new or reemerging pathogens. Developments in antimicrobial drugs, vaccines, or infectious disease prevention or elimination programs are appropriate. Case reports are also welcome. Dispatches (1,000 to 1,500 words) need not be divided into sections. Provide a short abstract (50 words); references, not to exceed 10; figures or illustrations, not to exceed two; and a brief biographical sketch.

Marco W.G. van de Bildt, * ([dagger]) Thijs Kuiken, * ([dagger]) Aart M. Visee, ([double dagger]) Sangito Lema, ([section]) Tony R. Fitzjohn, ([section]) and Albert D.M.E. Osterhaus * ([dagger])

* Seal Rehabilitation and Research Centre, Pieterburen, the Netherlands; ([dagger]) Institute of Virology, Erasmus University Rotterdam, Rotterdam, the Netherlands; ([double dagger]) The African Wild Dog Foundation, Schiedam, the Netherlands; and ([section]) Wildlife Preservation Trust Fund, Kilimanjaro Region, Tanzania

Marco van de Bildt is a doctoral student at the Institute of Virology, Erasmus University Rotterdam, the Netherlands. His work is focused on morbilliviruses in wildlife and, more specifically, in marine mammals.
COPYRIGHT 2002 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2002, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Osterhaus, Albert D.M.E.
Publication:Emerging Infectious Diseases
Geographic Code:6TANZ
Date:Feb 1, 2002
Words:1661
Previous Article:Hemorrhagic fever with renal syndrome presenting with hemophagocytic lymphohistiocytosis. (Dispatches).
Next Article:Postexposure treatment and animal rabies, Ontario, 1958-2000. (Dispatches).(Statistical Data Included)
Topics:



Related Articles
Seals under siege: a heated warning. (causes of distemper outbreaks)
Food snitches threaten rare dogs.(energetics research on African wild dogs)(Brief Article)
Wild success. (African wildlife)
Bovine tuberculosis and the endangered Iberian lynx.
The plight of birds: today, more than a thousand species of birds face extinction. Many more are in steady decline. Significantly, the strategies...
All for show? Ringling Brothers' circus claims to promote conservation.(Currents)(asian elephants' plight in the name of conservation)
Phocine distemper in German seals, 2002.(Dispatches)
Rabies in endangered Ethiopian wolves.(Dispatches)
Phocine distemper outbreak, the Netherlands, 2002.(DISPATCHES)
Saving Africa's wild dogs.(Gregory Rasmussen)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles