Printer Friendly
The Free Library
6,673,412 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Coxiella burnetii genotyping.


Coxiella burnetti is a strict intracellular bacterium with potential as a bioterrorism agent. To characterize different isolates of C. burnetii at the molecular level, we performed multispacer sequence typing (MST See micro systems technology. ). MST is based on intergenic region sequencing. These regions are potentially variable since they are subject to lower selection pressure than the adjacent genes. We screened 68 spacers in 14 isolates and selected the 10 that exhibited the most variation. These spacers were then tested in 159 additional isolates obtained from different geographic areas or different hosts or were implicated im·pli·cate  
tr.v. im·pli·cat·ed, im·pli·cat·ing, im·pli·cates
1. To involve or connect intimately or incriminatingly: evidence that implicates others in the plot.

2.
 in different manifestations of human disease caused by C. burnetii. The sequence analysis yielded 30 different allelic al·lele  
n.
One member of a pair or series of genes that occupy a specific position on a specific chromosome.



[German Allel, short for Allelomorph, allelomorph, from English
 combinations. Phylogenic analysis showed 3 major clusters. MST allows easy comparison and exchange of results obtained in different laboratories and could be a useful tool for identifying bacterial strains.

**********

Coxiella burnetii Coxiella burnetii Infectious disease The single species of genus Coxiella, family Rickettsiaceae, a short, rod-shaped bacterium; it is global in distribution, causes Q fever, spreads by aerosol, primarily infects cattle, sheep, goats, multiplies well in the  is a strict intracellular microorganism microorganism /mi·cro·or·gan·ism/ (-or´gah-nizm) a microscopic organism; those of medical interest include bacteria, fungi, and protozoa. , included in the [gamma] subdivision of the Proteobacteria phylum phylum, in taxonomy: see classification.  (1). It is found in close association with arthropod arthropod

Any member of the largest phylum, Arthropoda, in the animal kingdom. Arthropoda consists of more than one million known invertebrate species in four subphyla: Uniramia (five classes, including insects), Chelicerata (three classes, including arachnids and horseshoe
 and vertebrate hosts, and it causes Q fever Q fever: see rickettsia.  in humans and animals. Cattle, goats, and sheep are the primary reservoirs of human infection. In humans, the disease may appear in 2 forms, acute and chronic (2). Acute Q fever may be asymptomatic or appear as atypical pneumonia atypical pneumonia
n.
See primary atypical pneumonia.


atypical pneumonia Chest medicine A clinically 'atypical' form of pneumonia, which lacks the classic signs and Sx of pneumonia Types Chlamydia pneumonia,
, granulomatous granulomatous /gran·u·lom·a·tous/ (-lom´ah-tus) containing granulomas.
Granulomatous
Resembling a tumor made of granular material.
 hepatitis, or self-limited febrile febrile /feb·rile/ (feb´ril) pertaining to or characterized by fever.

feb·rile
adj.
Of, relating to, or characterized by fever; feverish.
 illness. In some persons, the immune system immune system

Cells, cell products, organs, and structures of the body involved in the detection and destruction of foreign invaders, such as bacteria, viruses, and cancer cells. Immunity is based on the system's ability to launch a defense against such invaders.
 is unable to control the infection and chronic Q fever occurs. The manifestations of chronic Q fever are endocarditis endocarditis (ĕn'dōkärdī`tĭs), bacterial or fungal infection of the endocardium (inner lining of the heart) that can be either acute or subacute. , hepatitis, osteomyelitis osteomyelitis (ŏs'tēōmī'əlī`tĭs), infection of the bone and bone marrow. Direct infection of bone usually occurs through open fractures, penetrating wounds, or surgical operations. , or infected aortic aneurysms. C. burnetii is highly infectious by the aerosol route and can survive for long periods in the environment.

Previous studies have shown that C. burnetii isolates differed respect to their plasmid type (QpH1, QpRS, QpDG, and QpDV) (3-6), lipopolysaccharide lipopolysaccharide /lipo·poly·sac·cha·ride/ (-pol?e-sak´ah-rid)
1. a molecule in which lipids and polysaccharides are linked.

2.
 profiles (7), and analysis of endonuclease-digested DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (8) or pulsed-field gel electrophoresis (PFGE PFGE Pulsed-Field Gel Electrophoresis ) (9-11). Differentiation was also obtained by sequence determination of the isocitrate dehydrogenase i·so·cit·rate dehydrogenase
n.
Either of two enzymes that catalyze the oxidative decarboxylation of isocitrate during the Krebs cycle.



isocitrate dehydrogenase

see isocitrate dehydrogenase.
 gene (12), corn1 gene, and mucZ gene, which was renamed djlA when the whole genome of C. burnetii was sequenced (13,14).

Several other methods have been used to type different isolates of the same species, in particular, multilocus enzyme electrophoresis (15) and multilocus sequence typing Multilocus sequence typing (MLST) is a technique in molecular biology for the typing of multiple loci. The procedure characterizes isolates of bacterial species using the DNA sequences of internal fragments of multiple (usually seven) housekeeping genes.  (MLST MLST Multi Locus Sequence Typing
MLST Medical Logistics Support Team
MLST Mini Losi Super Truck (1/18th scale radio control vehicle) 
) (16). Many bacterial species have been studied by using these approaches (17-19).

Recently, the whole genome of the C. burnetii Nine Mile strain was sequenced (14). We decided to investigate parts of the genome located between 2 open reading frames (ORFs) because they are considered potentially variable since they are subject to lower selection pressure than the adjacent genes. The 16S/23S ribosomal spacer region has been widely used to genotype bacteria (20-23). We investigated the utility of multispacer sequence typing (MST) with 173 C. burnetii isolates. After screening, we selected 10 variable spacers and showed that the combination of the different sequences allowed us to characterize 30 different genotypes. Phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 analysis inferred from compiled sequences characterized 3 monophyletic monophyletic /mono·phy·let·ic/ (mon?o-fi-let´ik) descended from a common ancestor or stem cell.

mon·o·phy·let·ic
adj.
1. Descended or derived from one original stock or source.
 groups, which could be subdivided into different clusters.

Methods

Bacterial Strains

The C. burnetii strains included in this study are listed in online Appendix Table 1 (available at http://www. cdc.gov/ncidod/EID/vol11no08/04-1354_app.htm# table 1). All the strains were propagated on Veto cell monolayers (ATCC ATCC American Type Culture Collection, see there  CRL CRL - Carnegie Representation Language.

Carnegie Group, Inc. Frame language derived from SRL. Written in Common LISP. Used in the product Knowledge Craft.
 1587). Minimal essential medium (MEM) (Invitrogen, Cergy-Pontoise, France) supplemented with 4% fetal bovine serum Fetal bovine serum ( or foetal bovine serum) is serum taken from the fetuses of cows. Fetal Bovine Serum (or FBS) is the most widely used serum in the culturing of cells. In some papers the expression foetal calf serum is used.  (Invitrogen) and 1% L-glutamine (invitrogen) was used for cultivation. Infected cells were maintained in a 5% CO2 atmosphere at 35[degrees]C. C. burnetii cells were harvested, pelleted, resuspended in 200 [micro]L MEM, and mixed with 500 [micro]L Chelex 100 20% (Bio-Rad, Ivry sur Seine, France). The preparation was boiled for 30 min, centrifuged at 10,000 x g for 30 min (24), and the supernatant supernatant /su·per·na·tant/ (-na´tant) the liquid lying above a layer of precipitated insoluble material.

supernatant

the liquid lying above a layer of precipitated insoluble material.
 containing DNA was transferred to a clean Eppendorf tube and stored at 4[degrees]C or -20[degrees]C.

Multispacer Sequence Typing

The whole genome of C. burnetii was accessible in the NCBI NCBI National Center for Biotechnology Information (NIH)
NCBI National Coalition Building Institute
NCBI National Council for the Blind of Ireland (Dublin, Ireland) 
 server (GenBank NC 002971). We kept spacers that were 300-700 bp in length. Primers were chosen in neighboring genes to allow polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) amplification at 57[degrees]C and are listed in Table 1. Each PCR was carried out in a T3 Thermocycler Biometra (Biolabo, Archamps, France). Two microliters of the DNA preparation was amplified in a 50-[micro]L reaction mixture containing 200 [micro]mol/L of each primer, 200 [micro]mol/L (each) dATP, dCTP, dGTP, and dTTP (Invitrogen), 1.5 U Taq DNA polymerase DNA polymerase /DNA po·lym·er·ase/ (pah-lim´er-as) any of various enzymes catalyzing the template-directed incorporation of deoxyribonucleotides into a DNA chain, particularly one using a DNA template.  (Roche, Meylan, France) in 1x Taq buffer. Amplifications were carried under the following conditions: initial denaturation denaturation, term used to describe the loss of native, higher-order structure of protein molecules in solution. Most globular proteins exhibit complicated three-dimensional folding described as secondary, tertiary, and quarternary structures.  of 10 min at 95[degrees]C, followed by 37 cycles of denaturation for 30 s at 95[degrees]C, annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  for 30 s at 57[degrees]C, and extension for 1 min at 72[degrees]C. PCR products were purified and sequenced as previously described (25).

PCR products were cloned in PGEM-T Easy Vector (Promega, Charbonnieres, France) according to the manufacturer's instructions. Ten clones were cultivated in LB medium (USB USB
 in full Universal Serial Bus

Type of serial bus that allows peripheral devices (disks, modems, printers, digitizers, data gloves, etc.) to be easily connected to a computer.
, Cleveland, OH, USA) overnight, and PCR and sequencing were performed as described previously.

Plasmid Sequence Type, com1 Type, and djlA Type Determination

PCR for QpH 1 and QpRS sequence plasmids were performed with the primers previously described QpH11/12 and QpRS01/02 (5). PCR was carried out as described for MST, except that annealing temperature was 55[degrees]C and cycle number was 35. PCR primers for QpDV and QpRS sequence plasmid amplification were chosen after comparison of the entire sequence of the 2 plasmids. The primers were QpDV1f and QpDV1r. PCR amplification was carried out at 63[degrees]C for 30 cycles. PCR was performed as previously described for com1 and djlA (13) (Appendix Table 2, available at http://www.cdc.gov/ncidod/EID/vol11no08/ 04-1354_app.htm#table2).

Data Analysis

Statistical analyses were performed by using the chi-square test chi-square test: see statistics.  in the program EpiInfo 6 (26). The spacer sequences were compiled and aligned by using the multi-sequence alignment program Clusta1X (1.8). The phylogenetic relationships between the C. burnetii isolates were determined by using Mega version 2.0 (27). A matrix of pairwise differences in allele allele (əlēl`): see genetics.
allele

Any one of two or more alternative forms of a gene that may occur alternatively at a given site on a chromosome.
 profiles was constructed, and the similarities between the allelic profiles of the isolates were assessed by cluster analysis Cluster analysis

A statistical technique that identifies clusters of stocks whose returns are highly correlated within each cluster and relatively uncorrelated across clusters. Cluster analysis has identified groupings such as growth, cyclical, stable, and energy stocks.
 using the unweighted pair-group method with arithmetic mean (mathematics) arithmetic mean - The mean of a list of N numbers calculated by dividing their sum by N. The arithmetic mean is appropriate for sets of numbers that are added together or that form an arithmetic series.  (UPGMA UPGMA Unweighted Pair Group Method, Arithmetic Mean ). Another analysis of the results was performed by using the BURST algorithm (http://www.mlst.net), which defines clonal complexes in which every isolate shares at least 5 identical alleles with at least 1 other isolate (Cox2, Cox5, Cox18, Cox20, Cox37, Cox56, and Cox57 were kept for the analysis) and characterizes ancestral genotypes. C. burnetii MST database was entered at the following website: http://ifr48.timone.univ-mrs.fr, and ST determination by sequence comparison is possible at this site.

Results

Choice of Spacers for Typing and Analysis by MST

Initially 14 isolates were chosen to test the genetic diversity of the spacers: Nine Mile, Priscilla, Q212, Heizberg, Brasov, Dog ut Ad, CB15, CB20, CB26, CB28, CB33, CB35, CB114, and CB115. We chose 68 spacers, but we retained only 51 spacers for which PCR amplification was obtained for all the isolates. We kept 10 spacers (Cox2, Cox5, Cox18, Cox20, Cox22, Cox37, Cox51, Cox56, Cox57, and Cox61) (Table 1) because they were representative of the results found when we analyzed the entire test set of 51 spacers. For each spacer, the number of variable sites in the sequences was determined, and the percentage of variability was calculated. They were, respectively, 1.1, 1.4, 1.9, 0.7, 2.3, 1.2, 1.4, 2.5, 1.7, and 2.1. We kept Cox18, Cox22, Cox51, Cox56, Cox57, and Cox61 because the percentage of variability in these spacers was high compared with the other spacers. We kept Cox2, Cox5, Cox20, and Cox37 because they allowed the characterization of CB35, CB15, CB26 and CB28, and Nine Mile respectively. To test the reliability of the spacers we kept, chi-square value was determined by using the value of 1% as the threshold value. The Fisher value was found to be statistically significant (9 x [10.sup.-4]). We then added 159 other isolates. Sequences were obtained for all the isolates with spacers Cox2, Cox18, Cox20, Cox22, Cox37, Cox51, and Cox57. Mixed sequences were obtained with the isolate Poker Cat with spacers Cox5, Cox56, and Cox61. We cloned the PCR products and showed that several sequences were present after PCR amplification, including insertions or deletions. Allele distribution of the different gene spacers are described in Table 2. Each of the different sequences in a locus defined a distinct genotype, even if it differed from the others by only a single nucleotide. Thirty different sequence types (STs) were identified by using MST.

The nucleotide sequence accession numbers are noted in online Appendix Table 3 (available at http://www. cdc.gov/ncidod/EID/vol11no08/04-1354.htm#table3). Accession numbers for Poker Cat isolate clones are, respectively, AY619726, AY619728, and AY619729, and AY619721 for Cox5, Cox56, and Cox61.

Computer Analysis of MST Data

The dendrogram A dendrogram is a tree diagram frequently used to illustrate the arrangement of the clusters produced by a clustering algorithm (see cluster analysis). Dendrograms are often used in computational biology to illustrate the clustering of genes.  in the Figure was constructed from a matrix of pairwise allelic differences between the compiled sequences of the 30 STs. We identified 3 monophyletic groups within the tree. The first group, representing 13 different STs, included isolates from France, Spain, Russia, Kyrgyzstan, Namibia, Kazakhstan, Ukraine, Uzbekistan, and the United States. It was divided in 2 subgroups. The first one included 36 isolates representing 8 different STs (ST1 to ST7 and ST30). Nineteen were represented by ST1. The second subgroup included 39 isolates which represented 5 different STs (ST8, ST9, ST10, ST26, and ST28). Twenty-eight were represented by ST8.

The second group included isolates from Europe (France, Germany, Switzerland, Romania, Italy, Greece, Austria, Slovakia), the United States, Russia, Africa (Central Africa and Senegal), and Asia (Kazakhstan, Uzbekistan, Mongolia, and Japan). It was divided into 4 subgroups. The first one included 26 isolates, which represented 7 different STs (ST11, ST12, ST13, ST14, ST15, ST24, and ST27). The second subgroup included 34 isolates that were included in ST18, ST22, ST23, ST25, and ST29 groups. The third subgroup included 18 isolates (ST16 and ST17), and the fourth subgroup included 10 isolates (ST19 and ST20).

The third group consisted of only 1 ST, ST21, and included the 7 Canadian isolates, 2 isolates from France (CB4 and CBT (Computer-Based Training) Using the computer for training and instruction. CBT programs are called "courseware" and provide interactive training sessions for all disciplines. ), and 1 isolate from the United States (Scurry). The clusters determined by the BURST algorithm were consistent with those determined by the phylogenetic analysis. Five groups were defined. The first one included ST1 to ST7; the putative ancestral genotype in this group was ST1. ST8 (putative ancestral genotype), ST9, ST10, ST26, and ST28 were included in the second group; ST11, ST12 (putative ancestral genotype), ST13, ST14, ST15, and ST24 in the third group, ST16 and ST17 in the fourth group; and ST18 (putative ancestral genotype), ST22, ST23, ST25, and ST29 in the fifth group. ST19, ST20, ST21, and ST30 were considered as singletons.

Sequence Type Determination and Correlation with Pathology

In the monophyletic group 1, the sequence of plasmid QpRS was found for isolates included in ST4, ST5, ST6, ST7, ST8, ST9, ST10, ST26, ST28, and ST30. The QpDV plasmid sequence was amplified for isolates included in ST1, ST2, ST3, and ST4. In the monophyletic group 2, the QpH1 plasmid sequence was found in all the isolates. In the monophyletic group 3, the QpH1 plasmid sequence or none of the searched plasmid sequences was detected. Sequence comparison of djlA generated 4 different groups. Group I included all STs included in the monophyletic group 2 defined by MST analysis. Group II included ST1, ST2, ST3, and ST4. Group III included ST5, ST6, ST7, ST30, ST26, ST28, ST8, ST9, and ST10. Group IV corresponded to ST21. Corn1 sequence comparison generated 6 different groups. Group I included all the STs included in the monophyletic group 2 defined by MST analysis except ST14 (group V) and ST20 (groupVI). Group II included ST1, ST2, ST3, and ST4. Group III included ST5, ST6, ST7, ST30, ST26, ST28, ST8, ST9, and STI STI systolic time intervals. 0. Group IV corresponded to ST21. When corn1 typing was used, only 1 strain was not in accordance with MST typing results. This strain, CB95, was included in ST8 but exhibited a group II com1 sequence.

QpDV plasmid presence in human isolates was correlated with the acute form of the disease (p = 2 x [10.sup.-7]), and QpRS plasmid presence was correlated with the chronic form of the disease (p = 2 x [10.sup.-4]). The acute form of the disease was correlated with STI (p = [10.sup.-3]), ST4 (p = 7 x [10.sup.-4]) ST16 (p = 3 x [10.sup.-3]), ST18 (p = [10.sup.-2]), and the chronic form of the disease was correlated with ST8 (p = 2 x [10.sup.-3]).

Modifications in ORFs Surrounding Studied Spacers

As primers were chosen in ORFs surrounding the studied spacers, mutations, deletions, or insertions were noted in the protein sequences. Mutations were noted in the hypothetical protein (gi29653385) for ST11; in the hypothetical protein (gi29653385) for ST9 and ST26; in entericin (gi29653446) for ST20, in ribonuclease Ribonuclease

A group of enzymes, widely distributed in nature, which catalyze hydrolysis of the internucleotide phosphodiester bonds in ribonucleic acid (RNA).
 H (gi29653667) in ST1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 21, 26, 28, and 30; in amino acid amino acid (əmē`nō), any one of a class of simple organic compounds containing carbon, hydrogen, oxygen, nitrogen, and in certain cases sulfur. These compounds are the building blocks of proteins.  permease permease /per·me·ase/ (per´me-as) former name for transport protein.

per·me·ase
n.
An enzyme that promotes the passage of a substance across a cell membrane.
 family protein (gi29653908) in ST28; in hypothetical protein (gi29654047) in ST1, 2, 4, 5, 6, 7, 8, 9, 10, 26, 28, and 30. In CB118 (ST3), a stop codon appeared which shortened the length of the ORF. Mutations were noted in uridine uridine /uri·dine/ (ur´i-den) a pyrimidine nucleoside containing uracil and ribose; it is a component of nucleic acid and its nucleosides are involved in the biosynthesis of polysaccharides. Symbol U.  kinase (gi29654198) in ST18, ST22, ST23, ST25, and ST29; in ompA-like transmembrane domain protein (gi29654257), in ST20; in rhodanese-like domain protein (gi29654263) in ST20 (the protein was longer by 2 amino acids); in dioxygenase (gi29654325) in ST21 and ST22; in hypothetical protein (gi29732244), in ST17.

Insertions or deletions were noted in hypothetical protein (gi29653386) in ST5, 6, and 7; in hypothetical protein (gi29653755) in ST1 and ST3 (insertion of a base G in the DNA sequence DNA sequence Genetics The precise order of bases–A,T,G,C–in a segment of DNA, gene, chromosome, or an entire genome. See Base pair, Base sequence analysis, Chromosome, Gene, Genome.  made the protein sequence longer of 22 amino acids); in the amino acid permease family protein @29653772) in ST8, 9, and 10 (deletion of a base A in the DNA sequence made the protein sequence longer of 24 amino acids); in ompA-like transmembrane domain protein (gi29654257) in ST11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, 25, 27, and 29.

Discussion

Q fever in humans and animals, caused by C. burnetii, is found worldwide. In humans, it causes a variety of diseases such as acute flulike illness, pneumonia, hepatitis, and chronic endocarditis. In animals, C. burnetii is found in the reproductive system reproductive system, in animals, the anatomical organs concerned with production of offspring. In humans and other mammals the female reproductive system produces the female reproductive cells (the eggs, or ova) and contains an organ in which development of the fetus , both uterus and mammary glands and may cause abortion or infertility.

Molecular methods are now almost universally used to characterize strains and to determine the relatedness between isolates causing diseases in different contexts. The most discriminative dis·crim·i·na·tive  
adj.
1. Drawing distinctions.

2. Marked by or showing prejudice: discriminative hiring practices.
 approach used for C. burnetii isolates until this study was PFGE. Twenty different restriction patterns were distinguished after Nod restriction of total C. burnetii DNA and PFGE (11). Comparison of PFGE profiles is sometimes difficult because good separation of the different fragments is required. For example, the isolate Heizberg was classified in group 1 by Thiele et al. (10) and in group 2 by Jager et al. (11). This fact highlights the difficulty of comparing results obtained by this technique. Moreover, in some species, rapid genomic rearrangements occur because of repeats or insertion sequences, so even if isolates descended from a common ancestor that arose several decades ago, they may not readily be seen to be minor variants of the same clone. In these cases, PFGE does not contribute to tracing of isolates. The great advantage of MST over PFGE as a typing method is the lack of ambiguity and the portability of sequence data, which allow results from different laboratories to be con> pared without exchanging strains. This work is the first to include so many isolates in a rigorous examination of molecular epidemiology molecular epidemiology Molecular medicine An evolving field that combines the tools of standard epidemiology–case studies, questionnaires and monitoring of exposure to external factors with the tools of molecular biology–eg, restriction endonucleases, . The study of this bank of sequences will contribute to understanding the propagation mode of the bacteria as variations accumulate relatively slowly, thus making it an ideal tool for global epidemiology. For example, in ST16 we characterized isolates that were obtained from 1935 (Nine Mile) to 1991 (CB25).

Most of the French isolates were included in monophyletic group 1. Nineteen were included in ST1, and 24 were included in ST8. Thus, an isolate has a geographic distribution even if genetic modifications appear (insertions, deletions or mutations) over time, giving rise to a new ST that is related to the ancestor isolate. This fact was highlighted when the analysis of the STs was performed by using the BURST algorithm. ST1 and ST8 were described as the ancestral genotypes and for example, ST9 and ST 10 corresponded to SLVs of ST8 (isolates that differ at only 1 of the 7 loci) and ST26 and ST28 corresponded to DLVs of ST8 (double locus variants). But some types were not delineated on the basis of geographic origin because they were isolated from different parts of the world. This distribution in distant countries is likely related to movements of infected patients, animals, or ticks. This is particularly tree for ST 16 isolates that were encountered on 4 different continents, America, Europe, Asia, and Africa. The homology of the Canadian isolates from Nova Scotia should be noted. Q fever is just as endemic in Nova Scotia as in France. This may indicate rapid and recent spreading of a single strain. The association between ST21 and Canada is significant as tested with the chi-square test with a Fisher value <[10.sup.-8]. Notably, patient CB115, who had Q fever endocarditis, was living in Edmonton, Alberta (=3,000 miles from Nova Scotia) when this illness was diagnosed. He grew up in Nova Scotia, and the molecular epidemiologic findings show that he acquired his disease there. Q fever is uncommon in Alberta. Most of the STs are found in Europe. A sample bias could exist as most of the isolates tested were from this continent, but the results obtained may also indicate that C. burnetii originated from the Old World and spread later in the New World, excluding New Zealand New Zealand (zē`lənd), island country (2005 est. pop. 4,035,000), 104,454 sq mi (270,534 sq km), in the S Pacific Ocean, over 1,000 mi (1,600 km) SE of Australia. The capital is Wellington; the largest city and leading port is Auckland. .

Concordant results were found when MST was compared with com1 and djlA sequences comparison (Figure). However MST was more discriminant dis·crim·i·nant  
n.
An expression used to distinguish or separate other expressions in a quantity or equation.
. Plasmid profile investigation of C. burnetii detected 4 different plasmids QpH1, QpRS, QpDV, and QpDG and 1 group of plasmidless isolates. QpH1 was first found in the Nine Mile tick isolate (28). QpRS was first found in the goat isolate Priscilla (29). QpDG was described from isolates obtained from feral rodents near Dugway, Utah (8). QpDV was found in French and Russian isolates (5,6). Another not-well-characterized plasmid type was described in China (30). The existence of a plasmidless C. burnetii isolate, Scurry Q217 was described (31), but a chromosomally integrated plasmid-homologous DNA fragment was found in this isolate by hybridization hybridization /hy·brid·iza·tion/ (hi?brid-i-za´shun)
1. crossbreeding; the act or process of producing hybrids.

2. molecular hybridization

3.
 (32,33). Plasmid type sequence detection was also correlated with MST. Group 2 included isolates that PCR amplification found to be positive with primers specific for QpH1. Group 3 included 3 isolates, 2 from France (CB4 and CB7) and 1 from Nova Scotia (Poker Cat), in which plasmid sequence type of QpH 1 was detected. No such sequence was detected in the other isolates of Nova Scotia origin included in group 3. Group 1 included isolates that were positive by PCR amplification with primers specific for QpRS (47/77). QpDV plasmid was described in isolates from France, Spain, Ukraine, and Kyrgyzstan. In fact, regions shared by QpH1, QpRS, and QpDV were termed "core plasmid sequences" and encompassed 25 kb. QpH1, QpRS, and QpDV are, respectively, 37 kb, 39 kb, and 33 kb in size. Integrated sequences in American isolate represent 18 kb. Differences in plasmid size and sequence can be explained by notable sequence rearrangements, such as deletions, insertions, or duplications, because several repeat sequences have been identified through which such rearrangements might have occurred. For CB13, we were able to characterize sequences for plasmids QpH1 and QpDV, which can be caused by several situations: this isolate may have 1) 2 different plasmids, 2) a QpH1 plasmid and sequences of QpDV integrated in the chromosome, or 3) a new plasmid that arose from combination of QpH1 and QpDV. All these hypotheses are in agreement with the presence of QpH1 plasmid in the ancestor of C. burnetii isolates. This plasmid was lost by some of them (monophyletic group 3) but genetic information of crucial importance for the organism was integrated in the chromosome. For other isolates, QpH1 plasmid evolved to QpRS plasmid, in some isolates QpRS plasmid evolved to QpDV plasmid.

[FIGURE OMITTED]

This study showed a correlation between QpDV and acute infections, between QpRS and chronic infections, and an association between some genotypes and disease type. A bias in sampling exists since acute disease is 20 times more frequent than chronic disease, but in this study, most of the human isolates were from chronic disease patients, and the isolates from acute infections were mainly obtained from France. These facts reflect the difficulty in isolating the bacteria. A genomic typing method such as MST could be applied directly to samples to obtain a more precise idea of how C. burnetii is spreading in the environment and the pathogenetic implications in acute and chronic forms of Q fever.

Comparison of DNA sequences is the best approach to investigate bacterial evolution. MLST in association with BURST analysis has been used to type isolates of many species. But this method is useful only if housekeeping gene diversity exists in the studied species. For example, in the species Yersinia pestis Yersinia pes·tis
n.
A bacterium that causes plague and is transmitted from rats to humans by the rat flea Xenopsylla cheopis. Also called Pasteurella pestis.
 no diversity was found in the housekeeping genes studied (34). With the MST approach, differentiation of the 3 biovars Antiqua, Medievalis, and Orientalis was possible (25), which shows that the discriminatory power of MST is higher than that of MLST and is comparable to that of tandem repeats analysis (35). Low variability was found in C. burnetii housekeeping genes such as 16S rRNA (36) and rpoB (37). MST is the first method that allows a rapid and reliable typing of C. burnetii isolates during investigations of outbreaks by sequencing the PCR product obtained from the 10 spacers described. We did not test isolates from Australia and only 8 from the United States. Two isolates from Africa (Namibia and CB119) were considered as singletons in the BURST analysis denoting lack of closely related isolates. In the future, isolates that were not available in our laboratory during this study must be tested so the missing links in our phylogenetic analysis can be determined. The constitution of a database in a website will allow isolates from all the countries in the world to be compared and increase understanding of the propagation of the isolates of C. burnetii.
Table 1. Primers used for PCR amplification and sequencing of
Coxiella burnetti gene spacers

Spacer
name                ORF                Nucleotide sequence (5'-3') *

Cox2       Hypothetical protein        Cox20766 CAACCCTGAATACCCAAGGA
           Hypothetical protein        Cox21004 GAAGCTTCTGATAGGCGGGA
Cox5     Sulfatase domain protein      Cox77554 CAGGAGCAAGCTTGAATGCG
           Entericidin, putative       Cox77808 TGGTATGACAACCCGTCATG
Cox18         Ribonuclease H          Cox283060 CGCAGACGAATTAGCCAATC
            DNA polymerase III,       Cox283490 TTCGATGATCCGATGGCCTT
              epsilon subunit
Cox20      Hypothetical protein      Cox365301 GATATTTATCAGCGTCAAAGCAA
           Hypothetical protein      Cox365803 TCTATTATTGCAATGCAAGTGG
Cox22      Hypothetical protein       Cox378718 GGGAATAAGAGAGTTAGCTCA
            Amino acid permease       Cox378965 CGCAAATTTCGGCACAGACC
              family protein
Cox37      Hypothetical protein       Cox657471 GGCTTGTCTGGTGTAACTGT
           Hypothetical protein       Cox657794 ATTCCGGGACCTTCGTTAAC
Cox51    Replicative DNA helicase,    Cox824598 TAACGCCCGAGAGCTCAGAA
             intein-containing
          Conserved hypothetical      Cox825124 GCGAGAACCGAATTGCTATC
         protein -- Uridine kinase
Cox56     OmpA-like transmembrane     Cox886418 CCAAGCTCTCTGTGCCCAAT
              domain protein
          Conserved hypothetical      Cox886784 ATGCGCCAGAAACGCATAGG
                  protein
Cox57      Rhodanese-like domain      Cox892828 TGGAAATGGAAGGCGGATTC
                  protein
           Hypothetical protein       Cox893316 GGTGGAAGGCGTAAGCCTTT
Cox61      Dioxygenase, putative      Cox956825 GAAGATAGAGCGGCAAGGAT
           Hypothetical protein       Cox957249 GGGATTTCAACTTCCGATAGA

                                      Amplified
Spacer                                fragment
name                ORF              length (bp)

Cox2       Hypothetical protein          397
           Hypothetical protein
Cox5     Sulfatase domain protein        395
           Entericidin, putative
Cox18         Ribonuclease H             557
            DNA polymerase III,
              epsilon subunit
Cox20      Hypothetical protein          631
           Hypothetical protein
Cox22      Hypothetical protein          383
            Amino acid permease
              family protein
Cox37      Hypothetical protein          463
           Hypothetical protein
Cox51    Replicative DNA helicase,       674
             intein-containing
          Conserved hypothetical
         protein -- Uridine kinase
Cox56     OmpA-like transmembrane        479
              domain protein
          Conserved hypothetical
                  protein
Cox57      Rhodanese-like domain         617
                  protein
           Hypothetical protein
Cox61      Dioxygenase, putative         611
           Hypothetical protein

* The numbers are beginning or end locations of the genes where the
primers were chosen.

Table 2. Alleles of 10 spacers which allow the definition
of the different Coxiella burnetii sequence types

COX
ST    2   5   18   20   22   37   51   56   57   61

  1   5   6    3    4    6    5    8    1    5    6
  2   5   6    3    5    6    5    8    1    5    6
  3   5   6    3    4    6    7    8    1    5    6
  4   5   6    3    2    6    5    8    1    5    6
  5   4   6    3    5    6    2    8    2    5    6
  6   4   3    3    5    6    5    8    2    5    6
  7   4   6    3    5    6    5    8    2    5    6
  8   5   4    2    5    1    5    3    3    4    4
  9   1   4    2    5    1    5    2    3    4    6
 10   5   4    2    5    1    5    2    3    2    6
 11   6   5    1    6    5    4    5    4    3    2
 12   3   5    1    6    5    4    5    4    3    2
 13   3   5    1    6    5    4    5    5    3    2
 14   7   5    1    6    5    6    9    4    3    2
 15   7   5    1    6    5    6    9    6    3    2
 16   3   7    5    3    4    1    6    7    6    5
 17   3   7    5    7    4    1   10    8    6    7
 18   3   7    1    6    3    4    7    9    6    3
 19   3   2    7    8    5    4   11    9    6    5
 20   3   2    6    1    5    4    4   10    1    5
 21   2   1    4    6    2    3    1   11    1    1
 22   3   7    1    6    3    8    7    9    6    8
 23   3   7    1    6    3    8    7    9    6    3
 24   3   5    1    6    5    4    5   12    3    9
 25   3   7    1    6    3    4    7    9    7    3
 26   9   4    8    5    8    5    2    3    4    6
 27   3   5    1    6    5    4    5   12    3    2
 28   8   4    8    5    7    5    2    3    4    6
 29   3   7    1    9    3    4    7    9    6    3
 30   5   6    9    5    6    5    8   13    8    6


Acknowledgments

We are grateful to Marie-Laure Birg and Jean-Yves Patrice for their technical assistance in culture of C. burnetii isolates.

This work was supported by a grant from the French Ministry of Research (ACI ACI American Concrete Institute
ACI Arch Coal Inc
ACI Airports Council International (formerly Airport Associations Coordinating Council)
ACI Automobile Club d'Italia
ACI American Competitiveness Initiative
 Microbiologie 2003) and a grant of the Pasteur Institute (2003-11). Dr. Glazunova and Dr. Roux Roux , Pierre Paul Émile 1853-1933.

French bacteriologist. His work with the diphtheria bacillus led to the development of antitoxins to neutralize pathogenic toxins.
 contributed equally to this work.

References

(1.) Weisburg WG, Dobson ME, Samuel JE, Dasch GA, Mallavia LP, Baca O, et al. Phylogenetic diversity of the Rickettsiae. J Bacteriol. 1989;171:4202-6.

(2.) Marrie TJ. Principles and practice of infectious diseases, 3rd edition. In: Mandel GL, Douglas RGJ RGJ Reno Gazette-Journal (Nevada, USA)
RGJ Royal Green Jackets (a British Regiment) 
, Bennett JE, editors. Coxiella burnetii (Q fever). New York New York, state, United States
New York, Middle Atlantic state of the United States. It is bordered by Vermont, Massachusetts, Connecticut, and the Atlantic Ocean (E), New Jersey and Pennsylvania (S), Lakes Erie and Ontario and the Canadian province of
: Churchill Livingstone; 1990. p. 1472-6.

(3.) Stein A, Raoult D. Lack of pathotype specific gent in human Coxiella burnetii isolates. Microb Pathog. 1993;15:177-85.

(4.) Willems H, Thiele D, Krauss H. Plasmid differentiation and detection of Coxiella burnetii in clinical samples. Eur J Epidemiol. 1993;9:411-8.

(5.) Thiele D, Willems H. Is plasmid based differentiation of Coxiella burnetii in 'acute' and 'chronic' isolates still valid'? Eur J Epidemiol. 1994;10:427-34.

(6.) Valkova D, Kazar J. A new plasmid (QpDV) common to Coxiella burnetii isolates associated with acute and chronic Q lever. FEMS Microbiol Lett. 1995; 125:275-80.

(7.) Hackstadt T. Antigenic variation in the phase I lipopolysaccharide of Coxiella burnetii isolates, infect Immun. 1986;52:337-40.

(8.) Hendrix LR, Samuel JE, Mallavia LP. Differentiation of Coxiella burnetii isolates by analysis of restriction-endonuclease-digested DNA separated by SDS-PAGE SDS-PAGE

sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
. J Gen Microbiol. 1991:137:2697-6.

(9.) Heinzen R, Stiegler GL, Whiting LL, Schmitt SA. Mallavia LP, Frazier ME. Use of pulsed field gel electrophoresis Historical Background
Standard gel electrophoresis techniques for separation of DNA molecules provided huge advantages for molecular biology research. However, many limitations existed with the standard protocol in that it was unable to separate very large molecules of DNA
 to differentiate Coxiella burnetii strains. In: Hechemy KE, Paretsky D, Walker DH, Mallavia. LP, editors. Rickettsiology: current issues and perspectives. Ann N Y Acad Sci. 1990;590:504-13.

(10.) Thiele D, Willems H, Kopf G, Krauss H. Polymorphism in DNA restriction patterns of Coxiella burnetii isolates investigated by pulsed field gel electrophoresis and image analysis. Eur J Epidemiol. 1993;9:419-25.

(11.) Jager C, Willems H, Thiele D, Baljer G. Molecular characterization of Coxiella burnetii isolates. Epidemiol Infect. 1998:120:157-64.

(12.) Nguyen SV, Hirai K. Differentiation of Coxiella burnetii isolates by sequence determination and PCR-restriction fragment length polymorphism analysis of isocitrate dehydrogenase gent. FEMS Microbiol Lett. 1999:180:249-54.

(13.) Sekeyova Z, Roux V, Raoult D. Intraspecies in·tra·spe·cif·ic   also in·tra·spe·cies
adj.
Arising or occurring within a species: intraspecific competition.

Adj. 1.
 diversity of Coxiella burnetii as revealed by com1 and mueZ sequence comparison. FEMS Microbiol Lett. 1999,180:61-7.

(14.) Seshadri R, Paulsen IT, Eisen JA, Read TD, Nelson KE. Nelson WC, et al. Complete genome sequence of the Q-fever pathogen Coxiella burnetii. Proc Natl Acad Sci U S A. 2003;100:5455-60.

(15.) Selander RK, Caugant DA, Ochman H, Musser JM, Gilmour MN, Whittam TS. Methods of multilocus enzyme electrophoresis for bacterial population genetics Population genetics

The study of both experimental and theoretical consequences of mendelian heredity on the population level, in contradistinction to classical genetics which deals with the offspring of specified parents on the familial level.
 and systematics systematics: see classification. . Appl Environ Microbiol. 1986;51:873-84.

(16.) Maiden MCJ MCJ Malattia Di Creutzfeldt-Jakob (Italian: Creutzfeldt-Jakob Disease)
MCJ Mississippi Center for Justice
MCJ Master Criminal Justice
MCJ Microcrystalline Cellulose, Jet Milled
MCJ Master of Laws in Comparative Jurisprudence Degree
, Bygraves JA, Feil E, Morelli G, Russell JE, Urwin R. et al. Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc Natl Acad Sci USA. 1998:95:3140-5.

(17.) Enright MC, Spratt BG. Multilocus sequence typing. Trends Microbiol. 1999:7:82-7.

(18.) Schloter M, Lebuhn M, Heulin T, Hartmann A. Ecology and evolution of bacterial microdiversity. FEMS Microbiol Rev. 2000:24:647-60.

(19.) Urwin R, Maiden CJ. Multi-locus sequence typing: a tool for global epidemiology. Trends Microbiol. 2003;11:479-87.

(20.) Bes M, Slim LS, Becharnia F. Meugnier H, Vandenesch F, Etienne J, et al. Population diversity of Staphylococcus staphylococcus (stăf'ələkŏk`əs), any of the pathogenic bacteria, parasitic to humans, that belong to the genus Staphylococcus. The spherical bacterial cells (cocci) typically occur in irregular clusters [Gr.  intermedius isolates from various host species: Typing by 16S-23S intergenic ribosomal DNA spacer polymorphism analysis. J Clin Microbiol. 2002:40:2275-7.

(21.) Daffonchio D, Cherif A, Brusetti L, Rizzi A, Mora MORA, In civil law. This term, in mora, is used to denote that a party to a contract, who is obliged to do anything, has neglected to perform it, and is in default. Story on Bailm. Sec. 123, 259; Jones on Bailm. 70; Poth. Pret a Usage, c. 2, Sec. 2, art. 2, n.  D, Boudabous A, et al. Nature of polymorphisms in 16S-23S rRNA gene intergenic transcribed spacer fingerprinting of Bacillus bacillus (bəsĭl`əs), any rod-shaped bacterium or, more particularly, a rod-shaped bacterium of the genus Bacillus. Some bacterium in the genus cause disease, for example B.  and related genera. Appl Environ Microbiol. 2003;69:5128-37.

(22.) Hassan AA, Khan IU, Abdulmawjood A, Lammler C. Inter- and intraspecies variations of the 16S-23S rDNA intergenic spacer region of various streptococcal streptococcal /strep·to·coc·cal/ (-kok´al) pertaining to or caused by a streptococcus.
Streptococcal (Streptococcus)
Pertaining to any of the Streptococcus bacteria.
 species. Syst Appl Microbiol. 2003;26:97-103.

(23.) Roux V, Raoult D. Inter- and intraspecies identification of Bartonella (Roehalimaea) species. J Clin Microbiol. 1995;33:1573-9.

(24.) Walsh PS, Metzger DA, Higuchi R. Chelex 100 as a medium for simple cxtraction of DNA for PCR-based typing from forensic material. Biotechniques. 1991;9:506-13.

(25.) Drancourt M, Roux V, Dang dang  
interj.
Used to express dissatisfaction or annoyance.

adv. & adj.
Damn.

tr.v. danged, dang·ing, dangs
To damn.

n.
 LV, Tran-Hung L, Castex D, Chenal-Francisque V, et al. Genotyping, Orientalis-like Yersinia pestis, and plague pandemics. Emerg infect Dis. 2004;10:1585-92.

(26.) Dean AG, Dean JA, Coulombier D, Brendel KA, Smith DC, Burton AH, et al. Epi Info Version 6: a word processing, database, and statistics program for epidemiology on microcomputers. Atlanta: Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center. ; 1994.

(27.) Kumar S, Tamura K, Jakobsen I B, Nei M. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics. 2001;17: 1244-5.

(28.) Samuel JE, Frazier ME, Kahn ML, Thomashow LS, Mallavia LP. Isolation and characterization of a plasmid front phase 1 Coxiella burnetii. Infect Immun. 1983;41:488-93.

(29.) Samuel JE, Frazier ME, Mallavia LP. Correlation of plasmid type and disease caused by Coxiella burnetii. Infect Immun. 1985;49:775-9.

(30.) Ning Z, Shu-Rong Y, Guo Quan Y, Xue Z. Molecular characterization of cloned variants of Coxiella burnetii isolated in China. Acta Virol. 1991;35:173-83.

(31.) Savinelli EA, Mallavia LP. Comparison of Coxiella burnetii plasmids to homologouschromosomal sequences present in all plasmidless endocarditis-causing isolates. Ann N Y Acad Sci. 1990:590:523-33.

(32.) Willems II, Ritter M, Jager C, Thiele D. Plasmid-homologous sequences in the chromosome of plasmidless Coxiella burnetii Scurry Q217. J Bacteriol. 1992;36:3293-7.

(33.) Lautenschlager S, Willems H, Jager C, Baljer G. Sequencing of the cryptic plasmid QpRS from Coxiella burnetii. Plasmid. 2000;44: 85-8.

(34.) Achtman M, Zurth K, Morelli G, Torrea G, Guiyoule A, Carniel E. Yersinia pestis, the cause of plague, is a recently emerged clone of Yersinia pseudotuberculosis Yersinia pseu·do·tu·ber·cu·lo·sis
n.
A bacterium that causes acute mesenteric lymphadenitis in humans. Also called Pasteurella pseudotuberculosis.
. Proc Natl Acad Sci U S A. 1999;96: 14043-8.

(35.) Pourcel C, Andre-Mazeaud F, Neubauer H, Ramisse F, Vergnaud G. Tandem repeats analysis for the high resolution phylogenetic analysis of Yersinia pestis. BMC (BMC Software, Inc., Houston, TX, www.bmc.com) A leading supplier of software that supports and improves the availability, performance, and recovery of applications in complex computing environments.  Microbiol. 2004;4:22.

(36.) Stein A, Saunders NA, Taylor AG. Raoult D. Phylogenic homogeneity of Coxiella burnetii strains as determinated by 16S ribosomal RNA sequencing. FEMS Microbiol Lett. 1993;113:339-44.

(37.) Mollet C, Drancourt M, Raoult D. Determination of Coxiella burnetii rpoB sequence and its use for phylogenetic analysis. Gene. 1998;207:97 103.

Olga Glazunova, * (1) Veronique Roux, * (1) Olga Freylikman, * ([dagger]) Zuzana Sekeyova, * ([double dagger]) Ghislain Fournous, * Judith Tyczka, ([section]) Nikolai Tokarevich, ([dagger]) Elena Kovacava, ([double dagger]) Thomas J. Marrie, ([paragraph]) and Didier Raoult *

(1) Dr. Glazunova and Dr. Roux contributed equally to this work.

* Unite des Rickettsies, Marseille, France; ([dagger]) Pasteur Institute of Epidemiology and Microbiology, Saint Petersburg, Russia; ([double dagger]) Slovak Academy of Sciences The Slovak Academy of Sciences SAV (in Slovak Slovenská akadémia vied) is the main scientific and research institution in Slovakia fostering basic and strategic basic research. It was founded in 1942, closed after WWII, and then refounded in 1953. , Bratislava, Slovak Republic; ([section]) University of Giessen The University of Gießen (German: Universität Gießen) is officially called Justus Liebig-Universität Gießen after its most famous member, Justus von Liebig, the founder of modern agricultural chemistry and inventor of artificial fertiliser. , Giessen, Germany; and ([paragraph]) University of Alberta Department of Medicine, Edmonton, Alberta, Canada

Dr. Glazunova obtained her doctorate in life science at the Russian Medical State University (Moscow) and Irkutsk State University Irkutsk State University (Russian: Иркутский государственный . She is currently a postdoctoral researcher at the Medical Faculty of Marseille. Her specialty is the molecular identification of bacteria.

Address for correspondence: Didier Raoult, Unite des Rickettsies, Faculte de Medecine, CNRS CNRS Centre National de la Recherche Scientifique (National Center for Scientific Research, France)
CNRS Centro Nacional de Referencia Para El Sida (Argentinean National Reference Center for Aids) 
 UMR UMR Unite Mixte de Recherche (French: Mixed Unit of Research )
UMR University of Missouri - Rolla
UMR Upper Mississippi River
UMR Uniform Methods and Rules (US Department of Agriculture)
UMR Unit Manning Report
 6020, IFR IFR
abbr.
instrument flight rules
48, 27 Boulevard Jean Moulin, 13385 Marseille, Cedex 05, France; tax: 33-491-32-03 90. email: didier.raoult@medecine.univ-mrs.fr
COPYRIGHT 2005 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2005, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:RESEARCH
Author:Raoult, Didier
Publication:Emerging Infectious Diseases
Geographic Code:1CANA
Date:Aug 1, 2005
Words:5580
Previous Article:Methicillin-resistant Staphylococcus aureus, Hawaii, 2000-2002.(RESEARCH)
Next Article:Multidrug-resistant Acinetobacter extremity infections in soldiers.(RESEARCH)
Topics:



Related Articles
Rationale and methods for the National Tuberculosis Genotyping and Surveillance Network. (Tubercolosis Genotyping Network).
Impact of genotyping of Mycobacterium tuberculosis on Public Health Practice in Massachusetts. (Tuberculosis Genotyping Network).
Has Coxiella burnetii (Q fever) been introduced into New Zealand? (Letters).
Wind in November, Q fever in December.(Research)
Q fever outbreak in industrial setting.(Research)
Q fever outbreak in homeless shelter.(Dispatches)
Coxiella burnetii in bulk tank milk samples, United States.(Dispatches)
Q fever wildlife reservoir.(LETTERS)(Letter to the Editor)
New method rapidly detects potential bioterror agent.(EH Update)
Universal genotyping in tuberculosis control program, New York City, 2001-2003.

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles