Printer Friendly
The Free Library
5,676,108 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Coronavirus HKU1 infection in the United States.


In 2005, a new human coronavirus coronavirus /co·ro·na·vi·rus/ (ko-ro´nah-vi?rus) any virus belonging to the family Coronaviridae.
Coronavirus /Co·ro·na·vi·rus/ (ko-ro´nah-vi?rus 
, HCoV-HKU1, was identified in Hong Kong. We screened respiratory specimens collected from December 16, 2001, to December 15, 2002, from children <5 years of age who tested negative for respiratory syncytial virus respiratory syncytial virus (sĭnsĭsh`əl): see cold, common. , parainfluenza viruses, influenza virus influenza virus
n.
Any of three viruses of the genus Influenzavirus designated type A, type B, and type C, that cause influenza and influenzalike infections.
, and adenovirus adenovirus

Any of a group of spheroidal viruses, made up of DNA wrapped in a protein coat, that cause sore throat and fever in humans, hepatitis in dogs, and several diseases in fowl, mice, cattle, pigs, and monkeys.
 for HCoV-HKU1 by reverse transcription-polymerase chain reaction. Overall, 1,048 respiratory specimens from 851 children were tested, and 9 HCoVHKUl-positive children (1%)were identified, 2 of whom had 2 positive specimens. Children who had HCoV-HKU1 infection had evidence of either upper or lower respiratory tract infection While often used as a synonym for pneumonia, the rubric of lower respiratory tract infection can also be applied to other types of infection including lung abscess, acute bronchitis, and emphysema.  or both. Two patients had disease beyond the respiratory tract respiratory tract
n.
The air passages from the nose to the pulmonary alveoli, including the pharynx, larynx, trachea, and bronchi.


Respiratory tract 
. HCoV-HKU1 was identified from December 2001 to February 2002. Sequence analyses suggest that a single strain was circulating. HCoV-HKU1 is therefore likely circulating in the United States and is associated with upper and lower respiratory tract Noun 1. lower respiratory tract - the bronchi and lungs
lung - either of two saclike respiratory organs in the chest of vertebrates; serves to remove carbon dioxide and provide oxygen to the blood
 disease.

**********

Lower respiratory tract disease accounts for [approximately equal to] 4 million deaths annually worldwide (1). Viruses such as influenza virus, respiratory syncytial virus (RSV RSV respiratory syncytial virus; Rous sarcoma virus.

RSV
abbr.
respiratory syncytial virus


RSV 1 Respiratory syncytial virus, see there 2 Rous sarcoma virus, see there
), and parainfluenza viruses are responsible for much of this respiratory tract infection Noun 1. respiratory tract infection - any infection of the respiratory tract
respiratory infection

infection - the pathological state resulting from the invasion of the body by pathogenic microorganisms
. However, in a substantial proportion of respiratory tract disease, no pathogen is identified (2).

Coronaviruses (CoV) infect a wide variety of mammals and birds, causing disease of the respiratory tract, gastrointestinal tract gastrointestinal tract
n.
The part of the digestive system consisting of the stomach, small intestine, and large intestine.


Gastrointestinal tract 
, and central nervous system. These viruses may be transmitted from species to species (3). In humans, CoV have been associated with community-acquired upper respiratory tract infections (4). Human CoV (HCoV) have also been implicated im·pli·cate  
tr.v. im·pli·cat·ed, im·pli·cat·ing, im·pli·cates
1. To involve or connect intimately or incriminatingly: evidence that implicates others in the plot.

2.
 in outbreaks of diarrhea as well as in demyelinating disorders Demyelinating disorders
A group of diseases characterized by the breakdown of myelin, the fatty sheath surrounding and insulating nerve fibers. This breakdown interferes with nerve function, and can result in paralysis.
 of the central nervous system, though these data are controversial (5,6). The study and identification of HCoV have been hampered by the difficulty in propagating these viruses in vitro.

The identification of the severe acute respiratory syndrome-associated CoV in 2003 sparked renewed interest in the study of HCoV (7), and 4 previously unidentified HCoV have subsequently been discovered. HCoV-NL63, HCoV-NL, and the New Haven coronavirus (HCoV-NH) are closely related group I CoV and likely represent strains of the same species of virus (8-10). HCoV-NL63 and HCoV-NL were originally identified by cell culture techniques, while HCoV-NH was discovered by using broadly reactive CoV molecular probes. These related viruses were identified in both children and adults with respiratory tract disease. HCoV-NH was found in 8.8% of children <5 years of age whose specimens originally tested negative for RSV, influenza virus, parainfluenza viruses, and adenoviruses (10). Furthermore, these newly discovered viruses may be the cause of disease beyond the respiratory tract. In a case-control study, HCoV-NH was found to be associated with Kawasaki disease (11), although these data are controversial (12,13).

In 2005, Woo et al. reported a novel group II CoV, designated HCoV-HKU1, from a 71-year-old man with pneumonia (14) who had recently returned to Hong Kong from the Shenzhen, China. As in the discovery of HCoV-NH (10), this virus was detected with molecular probes. Although growth of HCoV-HKU1 in multiple cell lines was unsuccessful, the complete genomic sequence was obtained. Phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 analysis showed that this new group II CoV is most closely related to the mouse hepatitis virus Mouse hepatitis virus is a virus of the family Coronaviridae, genus coronavirus. References
  • University of Illinois entry (PDF)
 and is distinct from HCoV-OC43, the only other known group II HCoV. Screening of 400 nasopharyngeal nasopharyngeal

pertaining to the nasal and pharyngeal cavities.


nasopharyngeal meatus
see nasopharyngeal meatus.

nasopharyngeal spasm
see reverse sneeze.
 aspirates by reverse transcription-polymerase chain reaction (RT-PCR RT-PCR

reverse transcriptase-polymerase chain reaction. See PCR1.
) with HCoV-HKU1-specific primers showed 1 other HCoV-HKU1 isolate from a 35-year-old woman with pneumonia. After the original report, HCoV-HKU1 was identified in 10 patients in northern Australia (15). Respiratory samples were collected between May and August (winter in Australia) and screened by RT-PCR with both nonspecific nonspecific /non·spe·cif·ic/ (non?spi-sif´ik)
1. not due to any single known cause.

2. not directed against a particular agent, but rather having a general effect.


nonspecific

1.
 CoV and specific HKU HKU University of Hong Kong
HKU Hogeschool voor de Kunsten Utrecht (Utrecht School of The Arts, The Netherlands)
HKU Hot Key Users
1 primers. Most HCoV-HKU1-positive samples originated from children in the later winter months. However, the seasonal and geographic distribution of this virus is still unclear. To address these issues, we sought to determine whether HCoV-HKU1 circulated in New Haven, Connecticut, and to define clinical characteristics associated with HCoV-HKU1 infection in infants and children.

Methods

Clinical Specimens

Nasopharyngeal swabs and aspirates submitted to the clinical virology virology, study of viruses and their role in disease. Many viruses, such as animal RNA viruses and viruses that infect bacteria, or bacteriophages, have become useful laboratory tools in genetic studies and in work on the cellular metabolic control of gene expression  laboratory at Yale-New Haven Hospital Yale-New Haven Hospital (abbreviated YNHH) is a world-renowned 944-bed hospital located in downtown New Haven, Connecticut. The hospital is owned and operated by the Yale New Haven Health System, Inc.  from December 16, 2001, to December 15, 2002, for respiratory virus diagnosis were initially tested for RSV, parainfluenza viruses (types 1-3), influenza A and B viruses, and adenovirus by direct immunofluorescence Immunofluorescence

A technique that uses a fluorochrome to indicate the occurrence of a specific antigen-antibody reaction. The fluorochrome labels either an antigen or an antibody.
 assay. Respiratory specimens were screened for human metapneumovirus (16) and HCoV-NH (10) by RT-PCR. Specimens originated from the emergency department, inpatient wards, intensive care units, and the hospital-affiliated primary care outpatient clinic and were submitted at the discretion of the medical teams. Clinical specimens from children <5 years of age that tested negative by direct immunofluorescence assay were tested for HCoV-HKU1 as described below. Collection of specimens and clinical data was approved by the Yale University Human Investigation Committee and compliant with Health Insurance Portability and Accountability Act The Health Insurance Portability and Accountability Act (HIPAA) was enacted by the U.S. Congress in 1996.

According to the Centers for Medicare and Medicaid Services (CMS) website, Title I of HIPAA protects health insurance coverage for workers and their families when
 regulations.

RT-PCR Screening

RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 from each respiratory specimen was extracted with the QIAamp Viral RNA Mini Kit (Qiagen, Valencia, CA, USA), according to the manufacturer's protocol. Random hexamer primers synthesized by the oligonucleotide laboratory, Department of Pathology, Yale University School of Medicine, were used to create a cDNA library for each specimen. Reverse transcription reactions were performed with MuMLV RT (New England Biolabs New England Biolabs (NEB) produces and supplies reagents for the life science industry. NEB offers a large selection of recombinant and native enzymes for genomic research. It also offers products in the areas related to proteomics and drug discovery. , Beverly, MA, USA), according to the manufacturer's specifications. Each cDNA was subsequently screened for the presence of HCoVo-HKU1 by polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  with HotStar Taq polymerase (Qiagen), according to the manufacturer's specification. Primers used to screen respiratory specimens were identical to those described by Woo et al. (14). The forward primer, 5' GGTTGGGATTATCCTAAATGTGA, and reverse primer, 5' CCATCATCACTCAAAATCATCATA, produce an amplicon that corresponds to nucleotides 15409-15848 of the HCoV-HKU1 replicase replicase /rep·li·case/ (rep´li-kas)
1. a polymerase synthesizing RNA from an RNA template.

2. more generically, any enzyme that replicates nucleic acids, i.e., a DNA or RNA polymerase.
 1B gene (GenBank accession no. AY597011) and yields an amplicon of 439 bp. Amplification cycles were as follows: 95[degrees]C for 15 min; followed by 40 cycles of 94[degrees]C for 1 min, 55[degrees]C for 1 min, and 72[degree]C for 1 min; and completed with a final extension cycle of 72[degrees]C for 10 min. Each set of reverse transcription and polymerase chain reactions contained appropriate negative controls. Sequencing was performed on an Applied Biosystems 3730 XL DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 Analyzer (Foster City, CA, USA) at the W.M. Keck Biotechnology Resource Lab, Yale University School of Medicine.

Clinical Data

Medical records of all HCoV-HKU1-positive children were reviewed. Demographic data, history of illness, and results of clinical examination and laboratory studies were recorded on a standard collection form. The Yale University Human Investigation Committee approved collection of specimens and clinical data.

Results

From December 16, 2001, to December 15, 2002, 1,048 respiratory specimens from 851 children were tested by RT-PCR for HCoV-HKU1. Specimens from 9 of these children (1%) tested positive for HCoV-HKU 1. Specimens from these children tested negative for RSV, parainfluenza viruses (types 1-3), influenza A and B viruses, and adenovirus by direct immunofluorescence assay as well as human metapneumovirus and HCoV-NH by RT-PCR. Two children had 2 specimens that tested positive for HCoV-HKU1. For each of these 2 children, the positive specimens were collected <10 days apart. Children whose specimens tested positive for HCoV-HKU1 infection had clinical evidence of either upper or lower respiratory tract infection or both (Table). The most common clinical findings were rhinorrhea (100%), cough (67%), fever (67%), and abnormal breath sounds on auscultation auscultation

Procedure for detecting certain defects or conditions by listening for normal and abnormal heart, breath, bowel, fetal, and other sounds in the body. The invention of the stethoscope in 1819 improved and expanded this practice, still very useful despite the
 (44%). Hypoxia hypoxia

Condition in which tissues are starved of oxygen. The extreme is anoxia (absence of oxygen). There are four types: hypoxemic, from low blood oxygen content (e.g., in altitude sickness); anemic, from low blood oxygen-carrying capacity (e.g.
 (oxygen saturation of <90%) was observed in only 1 patient. Chest radiographs were obtained for 4 patients, all of whom had abnormal findings that included peribronchial cuffing, atelectasis atelectasis
 or lung collapse

Lack of expansion of pulmonary alveoli (see pulmonary alveolus). With a large-enough collapsed area, the victim stops breathing.
, hyperinflation Hyperinflation

Extremely rapid or out of control inflation.

Notes:
There is no precise numerical definition to hyperinflation. This is a situation where price increases are so out of control that the concept of inflation is meaningless.
, or infiltrates. One patient (patient 3) had respiratory decompensation decompensation /de·com·pen·sa·tion/ (de?kom-pen-sa´shun)
1. inability of the heart to maintain adequate circulation, marked by dyspnea, venous engorgement, and edema.

2.
 requiring ventilatory support and was admitted to the pediatric pediatric /pe·di·at·ric/ (pe?de-at´rik) pertaining to the health of children.

pe·di·at·ric
adj.
Of or relating to pediatrics.
 intensive care unit. This patient had no history of underlying illness, had not been premature, and was 1 month of age at the time of specimen collection.

Two patients had evidence of disease beyond the respiratory tract. One patient (patient 1) was hospitalized for new-onset seizures. Workup work·up
n. Abbr. w/u
A thorough medical examination for diagnostic purposes.
 for a central nervous system infection, including a lumbar puncture and head magnetic resonance imaging magnetic resonance imaging (MRI), noninvasive diagnostic technique that uses nuclear magnetic resonance to produce cross-sectional images of organs and other internal body structures. , was unrevealing. Although a febrile seizure remains a possible diagnosis, no evidence of fever was reported by the mother or noted during the hospital stay. A second patient (patient 7) was hospitalized with hepatitis. This patient had undergone liver transplantation 3 months before admission. Immunosuppressive medications included tacrolimus and prednisolone prednisolone /pred·nis·o·lone/ (pred-nis´ah-lon) a synthetic glucocorticoid derived from cortisol, used in the form of the base or the acetate, sodium phosphate, or tebutate ester in replacement therapy for adrenocortical insufficiency, . The patient was also receiving ganciclovir for cytomegalovirus cytomegalovirus (sī'təmĕg'əlōvī`rəs), member of the herpesvirus family that can cause serious complications in persons with weakened immune systems.  prophylaxis. The onset of abnormal liver enzyme levels occurred several days after the onset of respiratory symptoms and after collection of the respiratory specimen that tested positive for HCoV-HKU1. No evidence of abnormal liver function was detected (both prothrombin time and partial thromboplastin time Partial Thromboplastin Time Definition

The partial thromboplastin time (PTT) test is a blood test that is done to investigate bleeding disorders and to monitor patients taking an anticlotting drug (heparin).
 were within normal ranges). Serologic se·rol·o·gy  
n. pl. se·rol·o·gies
1. The science that deals with the properties and reactions of serums, especially blood serum.

2.
 assays for hepatitis viruses A, B, and C were negative. A liver biopsy specimen did not show evidence of rejection. Levels of the serum liver enzymes slowly decreased during hospitalization. No interventions (e.g., changes in immunosuppressive therapy) were performed.

All HCoV-HKU1 infections occurred during a 7-week period from December 2001 to February 2002 (Figure). HCoV-HKU1-positive samples accounted for 5% of samples screened during that period. No HCoV-HKU1-positive isolates were detected in specimens collected in the remainder of the study period.

[FIGURE OMITTED]

The RT-PCR amplicon from each positive specimen was sequenced. Nucleotide and amino acid identity between replicase 1B region of the original HCoV-HKU1 isolate and the New Haven isolates were both >95%. Rare polymorphisms (<1% of sequence) were noted in the HCoV-HKU1 sequences of the New Haven isolates (data not shown), which suggests that a single strain was circulating in the community during the study period.

Discussion

We report the first identification of HCoV-HKU1 in the Western Hemisphere. These findings suggest that HCoV-HKU1 may have a worldwide distribution. We detected this coronavirus in 1% of children screened. All HCoV-HKU1-positive samples tested negative for RSV, influenza virus, parainfluenza viruses, adenoviruses, HCoV-NH, and human metapneumovirus. Our laboratory did not have access to materials from Hong Kong; therefore, the results cannot represent laboratory contamination from material obtained elsewhere. The percentage of positive specimens was similar to that described by Woo et al. (1 [0.25%] of 400) (14) and Sloots et al. (10 [3.1%] of 324) (15), which suggests that infection with HCoV-HKU1 may be uncommon or that the virus has properties that decreases the likelihood of detection, such as a brief period of viral shedding. Our study, the study by Sloots et al., and the original study by Woo et al. screened respiratory specimens submitted to a diagnostic laboratory. Therefore, HKU1 may be a common virus that causes symptomatic disease in only a relatively small percentage of infected persons. All HCoV-HKU1-positive specimens were collected from December 2001 to February 2002, which implies a winter distribution. The study by Sloots et al. also detected HCoV-HKU1 predominantly in the winter, although only respiratory samples submitted during winter months were screened. Whether the seasonal distribution of HCoV-HKU1 varies from year to year is not known.

Similar to the patients described by Woo et al., several HCoV-HKU1-positive patients had evidence of lower respiratory tract involvement (2 patients with pneumonia and 1 patient with bronchiolitis Bronchiolitis Definition

Bronchiolitis is an acute viral infection of the small air passages of the lungs called the bronchioles.
Description

Bronchiolitis is extremely common.
). Two of these patients had underlying illness. However, most patients identified in our study had only mild upper respiratory tract symptoms. Most HCoV-HKU1 infections in children, similar to other common HCoV infections, likely result in mild disease (4). The Australian study did not perform a detailed clinical review of HCoV-HKU1-positive patients, but the authors note that symptoms are consistent with those of acute respiratory tract illness (15).The severity of disease caused by SARS-CoV in children was also relatively mild for reasons that are not yet understood (17). Underlying illness and preexisting pre·ex·ist or pre-ex·ist  
v. pre·ex·ist·ed, pre·ex·ist·ing, pre·ex·ists

v.tr.
To exist before (something); precede: Dinosaurs preexisted humans.

v.intr.
 lung disease may predispose pre·dis·pose
v.
To make susceptible, as to a disease.
 to a more severe clinical course.

Evidence of hepatitis in 1 child who tested positive for HCoV-HKU1 is an intriguing finding. HCoV-HKU1 is most closely related to the murine murine /mu·rine/ (mur´en) pertaining to, derived from, or characteristic of mice or rats.

mu·rine
adj.
 hepatitis virus, a virus that causes hepatitis as well as demyelinating disease in mice (18). Because of this patient's medical history (liver transplantation) and compromised immune status, many potential causes of hepatitis exist, though serologic assays and liver biopsy findings were unrevealing. Several reports have found coronavirus-like particles in stool of persons with gastrointestinal disease (19), which suggests that these viruses, like coronaviruses of animals, can cause disease of the gastrointestinal tract. Future studies will be needed to determine whether HCoV-HKU1, or other common human coronaviruses, play a role in liver disease.

Our study had several shortcomings. We limited our screening to respiratory specimens that were collected at the discretion of the medical team, we did not include a control group of asymptomatic children, and serum samples were not available for serologic assays. Nonetheless, our findings show that HCoV-HKU1 is circulating in New Haven, Connecticut, and is associated with both upper and lower respiratory tract disease and perhaps extrapulmonary disease.

The genetic variability of HCoV-HKU1 is unknown. The study by Sloots et al. suggests 2 genotypes when comparing the Australian isolates to the prototype Hong Kong strain (15). If multiple genotypes exist, they may not all be detected with the primer set used. This limitation would result in an underestimation of this virus in our study. However, the region of the replicase 1B gene targeted by the primers used (14) is highly conserved among other coronaviruses, and our screening was unlikely to have lacked sensitivity for that reason. Also, only rare polymorphisms were detected on the sequence analysis of the 9 individual isolates, which suggests that this region is highly conserved. However, to establish the true prevalence of HKU1, use of primers with known specificity and sensitivity for HCoV-HKU1 will be critical.

In conclusion, we show that HCoV-HKU1 circulates in the United States, and the strain identified in New Haven is similar to the original strain described from Hong Kong. Whether this newly recognized pathogen is responsible for a substantial proportion of respiratory tract disease in children remains to be determined. Future studies are required to determine the epidemiologic features and clinical spectrum of this newly recognized pathogen.

Acknowledgments

We are indebted to George Miller for his support and critical review of this work, Eugene D. Shapiro for his review of the manuscript, and the staff of the clinical virology laboratory at Yale-New Haven Hospital for their assistance in collecting clinical specimens.

This work was supported by the Patrick and Catherine Weldon Donaghue Medical Research Foundation. This work was also supported in part by the Friends of Yale Pediatrics (J.S.K.); Yale Children's Clinical Research Center grant M01-RR06022; General Clinical Research Centers Program, National Center for Research Resources The National Center for Research Resources or NCRR, is a United States government agency. NCRR provides funding to laboratory scientists and researchers for facilities and tools in the goal of curing and treating diseases. , National Institutes of Health; and National Institutes of Health grant T32 AI07210-20 (F.E.).

Dr Esper is assistant professor in the Department of Pediatrics, Division of Infectious Diseases, Case Western Reserve University. His research interests are in the epidemiology and molecular biology of newly recognized and emerging respiratory viruses.

References

(1) Murray CJL CJL Center for Jewish Life
CJL Center for Jewish Living at Cornell (Ithaca, New York) 
, Lopez AD, Mathers CD, Stein C. The Global Burden of Disease 2000 project: aims, methods and data sources. Geneva Geneva, canton and city, Switzerland
Geneva (jənē`və), Fr. Genève, canton (1990 pop. 373,019), 109 sq mi (282 sq km), SW Switzerland, surrounding the southwest tip of the Lake of Geneva.
: World Health Organization. 2001 Nov [cited 2006 Feb 8]. Available from http://www.hsph.harvard.edu/burdenofdisease/publieations/ papers/gbd2000.pdf.

(2.) Davies HD, Matlow A, Petric M, Glazier R, Wang EE. Prospective comparative study of viral, bacterial and atypical organisms identified in pneumonia and bronchiolitis in hospitalized Canadian infants. Pediatr Infect Dis J. 1996;15:371-5.

(3.) Lai MMC See MultiMediaCard and Microsoft Management Console. , Holmes KV. Coronaviridae: the viruses and their replication. In: Fields BN, Knipe DM, Howley PM, editors. Fields virology. 3rd ed. Philadelphia: Lippincott-Raven; 1996. p. 1075-94.

(4.) van Elden L J, van Loon loon, common name for migratory aquatic birds found in fresh- and saltwater in the colder parts of the Northern Hemisphere. Its strange, laughing call carries for great distances. Like the grebes, loons float low in the water and their legs are placed far back.  AM, van Alphen F, Hendriksen KA, Hoepelman AI, van Kraaij MG, et al. Frequent detection of human coronaviruses in clinical specimens from patients with respiratory tract infection by use of a novel real-time reverse-transcriptase polymerase chain reaction. J Infect Dis. 2004;189:652-7.

(5.) Fleming JO, el Zaatari FA, Gilmore W, Berne JD, Burks JS, Stohlman SA, et ah Antigenic assessment of coronaviruses isolated from patients with multiple sclerosis. Arch Neurol. 1988;45:629-33.

(6.) Gonzalez P, Sanches A, Rivera P, Jimenez C, Hernandez F. Rotavirus rotavirus /ro·ta·vi·rus/ (ro´tah-vi?rus) any member of the genus Rotavirus. ro´taviral
Rotavirus /Ro·ta·vi·rus/ (ro´tah-vi?rus 
 and coronavirus outbreak: etiology of annual diarrhea in Costa Rican children. Rev Biol Trop. 1997;45:989-91

(7.) McIntosh K. Coronaviruses in the limelight [comment]. J Infect Dis. 2005;191:489-91.

(8.) an der Hoek L, Pyrc K, Jebbink MF, Vermeulen-Oost W, Berkhout RJ, Wolthers KC, et al. Identification of a new human coronavirus. Nat Med. 2004;10:368-73.

(9.) Fouchier RA, Hartwig NG, Bestebroer TM, Niemeyer B, de Jong JC, Simon JH, et al. A previously undescribed coronavirus associated with respiratory disease in humans. Proc Natl Acad Sci U S A. 2004;101:6212-6.

(10.) Esper F, Weibel C, Ferguson D, Landry ML, Kahn JS. Evidence of a novel human coronavirus that is associated with respiratory tract disease in infants and young children. J Infect Dis. 2005;191:492-8.

(11.) Esper F, Shapiro ED, Weibel C, Ferguson D, Landry ML, Kahn JS. Association between a novel human coronavirus and Kawasaki disease. J Infect Dis. 2005;191:499-502.

(12.) Ebihara T, Endo R, Ma X, Ishiguro N, Kikuta H. Lack of association between New Haven coronavirus and Kawasaki disease [comment]. J Infect Dis. 2005;192:351-2.

(13.) Belay ED, Erdman DD, Anderson L J, Peret TC, Schrag S J, Fields BS, et al. Kawasaki disease and human coronavirus [comment]. J Infect Dis. 2005;192:352-3.

(14.) Woo PC, Lau SK, Chu CM, Chan KH, Tsoi HW, Huang Y, et al. Characterization and complete genome sequence of a novel coronavirus, coronavirus HKU1, from patients with pneumonia. J Virol. 2005;79:884-95.

(15.) Sloots TP, McErlean P, Speicher DJ, Arden KE, Nissen MD, Mackay IM. Evidence of human coronavirus HKU1 and human bocavirus in Australian children. J Clin Virol. 2006;35:99-102.

(16.) Esper F, Martinello RA, Boucher D, Weibel C, Ferguson D, Landry ML, et al. A 1-year experience with human metapneumovirus in children aged <5 years. J Infect Dis. 2004;189:1388-96.

(17.) Hon KL, Leung CW, Cheng WT, Chan PK, Chu WC, Kwan YW, et ah Clinical presentations and outcome of severe acute respiratory syndrome Severe Acute Respiratory Syndrome (SARS) Definition

Severe acute respiratory syndrome (SARS) is the first emergent and highly transmissible viral disease to appear during the twenty-first century.
 in children [see comment]. Lancet. 2003;361:1701-3.

(18.) Hating J, Perlman S. Mouse hepatitis virus. Curr Opin Microbiol. 2001 ;4:462-6.

(19.) Luby JP, Clinton R, Kurtz S. Adaptation of human enteric enteric /en·ter·ic/ (en-ter´ik) within or pertaining to the small intestine.

en·ter·ic
adj.
1. Of, relating to, or within the intestine.

2.
 coronavirus to growth in cell lines. J Clin Virol. 1999;12:43-51.

Frank Esper, * Carla Weibel, ([dagger]) David Ferguson, ([dagger]) Marie L. Landry, ([dagger]) and Jeffrey S. Kahnt

* Case Western Reserve University School of Medicine, Cleveland, Ohio, USA; and ([dagger]) Yale University School of Medicine, New Haven, Connecticut, USA

Address for correspondence: Jeffrey S. Kahn, Department of Pediatrics, Division of Infectious Diseases, Yale University School of Medicine, PO Box 208064, New Haven, CT 06520-8064, USA; email: jeffrey.kahn@ yale.edu
Table. Clinical manifestations associated with human
coronavirus HKU1 infection *

                                      Length
Patient       Age     Specimen          of
no.           (mo)   collection   hospitalization
(sex)                   date            (d)

1 (M)          4       Dec 18            1

2 (M)          12      Dec 20            4

3 (F)          1      Dec 22,            9
([dagger])               31
([double
dagger])

4 (M)          2       Jan 5            NH

5 (F)          20     Jan 14,            2
([dagger])               16

6 (F)          3       Jan 16           NH

7 (M)          13      Jan 19           10

8 (F)          16      Jan 19            1
9 (F)          13      Feb 1            NH

Patient
no.                                 Underlying
(sex)           Diagnosis            illness

1 (M)           New onset              RAID
                seizures

2 (M)           Pneumonia        Cystic fibrosis

3 (F)           Pneumonia              None
([dagger])
([double
dagger])

4 (M)             Fever                None

5 (F)             ALTE                 None
([dagger])

6 (F)         Bronchiolitis        Prematurity
                                    (34 weeks)

7 (M)           Hepatitis     Biliary atresia, liver
                                 transplantation

8 (F)             Fever         Sickle cell anemia

9 (F)             Fever                None

Patient                                            Chest
no.                     Signs/                  radiographic
(sex)                  symptoms                   findings

1 (M)              Rhinorrhea, cough            Not obtained

2 (M)          Fever, rhinorrhea, cough,        Infiltrates
                  wheezing, rhonchi,
                   retractions, rash

3 (F)         Fever, hypoxia, rhinorrhea,     Hyperinflation,
([dagger])     cough, wheezing, rhonchi,        infiltrates,
([double      retractions, nasal flaring,      peribronchial
dagger])                 apnea              cuffing, atelectasis

4 (M)              Fever, rhinorrhea            Not obtained

5 (F)          Fever, rhinorrhea, cough         Infiltrates,
([dagger])                                      atelectasis

6 (F)             Rhinorrhea, cough,           Peribronchial
                   wheezing, rhonchi              cuffing

7 (M)            Rhinorrhea, rhonchi,           Not obtained
                 abnormal LIFT results

8 (F)              Fever, rhinorrhea            Not obtained

9 (F)          Fever, rhinorrhea, cough         Not obtained

* M, male; F, female; RAID, reactive airway disease; NH, not
hospitalized; ALTE, apparent life-threatening event; LIFT,
liver function tests (aspartate aminotransferase 238 U/mL,
alanine aminotransferase 373 U/mL, alkaline phosphatase
406 U/mL, bilirubin [total/dirent] 0.15/0.05 mg/dL).

([dagger]) Two respiratory specimens tested positive for
human coronavirus HKU1.

([double dagger]) Patient required mechanical ventilation
and admission to the pediatric intensive care unit.
COPYRIGHT 2006 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2006, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Kahn, Jeffrey S.
Publication:Emerging Infectious Diseases
Geographic Code:1USA
Date:May 1, 2006
Words:3363
Previous Article:Intact pks 15/1 in non-W-Beijing Mycobacterium tuberculosis isolates.
Next Article:Shiga-toxigenic Escherichia coli O157 in agricultural fair livestock, United States.
Topics:



Related Articles
Human metapneumovirus detection in patients with severe acute respiratory syndrome.(Research)
Severe acute respiratory syndrome: an overview.(Featured CME Topic)
Genetic variation of SARS coronavirus in Beijing hospital.(Research)
Animal-to-human SARS-associated coronavirus transmission?(Letters)
SARS clinical features, United States, 2003.(Dispatches)(severe acute respiratory syndrome )
SARS-associated coronavirus transmitted from human to pig.(Dispatches)
SARS-CoV infection in a restaurant from palm civet.(RESEARCH)(severe acute respiratory syndrome coronavirus infection)
SARS-associated coronavirus replication in cell lines.(RESEARCH)
Canine coronavirus highly pathogenic for dogs.(DISPATCHES)
Human bocavirus in children.(LETTERS)(Disease/Disorder overview)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles