Printer Friendly
The Free Library
14,599,331 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Clonal population of flucytosine-resistant Candida tropicalis from blood cultures, Paris, France.


Candida tropicalis Candida tropicalis is a species of yeast in the genus Candida. See also
  • Candida
References

1. ^ Berkhout, De Schimmelgesl. Monilia, Oidium, Oospora en Torula, Disset.
 is a diploid diploid /dip·loid/ (dip´loid)
1. having two sets of chromosomes, as normally found in the somatic cells; in humans, the diploid number is 46.

2. an individual or cell having two full sets of homologous chromosomes.
 ascomycetes Ascomycetes /As·co·my·ce·tes/ (as?ko-mi-se´tez) in some systems of classification, a class of fungi of the division Eumycota; see Ascomycotina .

As·co·my·ce·tes
n.
 yeast responsible for 4%-24% of candidemia. Resistance to flucytosine is rarely described for this species but was observed for 45 (35%) of 130 C. tropicalis isolates recovered from blood cultures in the Paris area in a 4-year survey. The aims of this study were to test the hypothesis that the flucytosine-resistant isolates could represent a subgroup and to determine the relationship between epidemiologic and genomic data. Epidemiologic data and gene sequences were analyzed, and molecular typing was performed. Our results suggest that a clone of flucytosine-resistant isolates, associated with malignancies and a lower mortality than that for other C. tropicalis isolates, is widespread in the Paris area. We propose the analysis of 2 polymorphic polymorphic - polymorphism  microsatellite See miniaturized satellite.  markers coupled with URA Ura

uracil.
3 sequencing to track the clone.

**********

Candida tropicalis is a diploid ascomycetes yeast commonly found on the skin and in digestive tracts of healthy human hosts worldwide (1). Infections caused by C. tropicalis are reported in 4%-24% of patients with candidemia, depending on the country of study, underlying risk factors, and period of study (2). Primary resistance to flucytosine (5FC) occurs in <5% of all Candida species except for C. krusei, in which it is detected in up to 28% of isolates (3). It was thus unexpected to observe 35% resistance to 5FC among C. tropicalis isolates recovered from blood cultures in the active surveillance program on yeast-related fungemia implemented by the French National Reference Center for Mycoses and Antifungals (NRCMA NRCMA National Railroad Construction and Maintenance Association
NRCMA Nationally Registered Certified Medical Assistant
) in the Paris area. The YEASTS program is designed to analyze the epidemiologic trends of yeast fungemia by collecting isolates and epidemiologic and clinical data. The second objective is to study the clinical isolates in terms of species, antifungal susceptibility profiles, and genetic diversity to look for associations between subtypes of isolates and epidemiologic/clinical parameters. To test the hypothesis that the 5FC resistant ([sub.R]5FC) isolates could represent a different species or a subgroup, the [sub.R]5FC and susceptible ([sub.S]5FC) isolates were compared on the basis of several phenotypic and molecular features.

Materials and Methods

Strains

Clinical isolates of C. tropicalis recovered from blood cultures during the YEASTS program from October 1, 2002, through September 30, 2006, were selected for the study. Epidemiologic and clinical data concerning the patients were collected by using a standardized electronic form. Isolates (1 isolate/patient) were sent to NRCMA for identification and MIC determination (see below). All isolates were stored frozen in 40% glycerol glycerol, glycerin, glycerine, or 1,2,3-propanetriol (prō`pāntrī'ŏl), CH2OHCHOHCH2OH, colorless, odorless, sweet-tasting, syrupy liquid.  at -80[degrees]C.

The type strain of C. tropicalis CBS (Cell Broadcast Service) See cell broadcast.  94 (ATCC ATCC American Type Culture Collection, see there  750, [sub.S]5FC) was included in the study as a reference. In addition, 29 strains of taxonomic synonyms available at the Centraalbureau voor Schimmelcultures The Centraalbureau voor Schimmelcultures, or CBS, is part of the Royal Netherlands Academy of Arts and Sciences. Translated into English, the name means "Central Bureau of Fungal Cultures". The Center is located in the Netherlands.  (CBS, Utrecht, the Netherlands) were studied.

Phenotypic Characterization of All C. tropicalis Isolates

All isolates were identified at the species level by using the assimilation patterns obtained with the commercialized strips ID32C (bioMerieux, Marcy-l'Etoile, France). MICs to 9 systemic antifungal agents antifungal agents,
n.pl agents that inhibit, control, or kill fungi. The most common yeastlike fungus occurring in or near the oral cavity is
C. albicans.
 were determined for all clinical isolates and the type strain by using the EU-CAST microdilution method (4). For nonclinical isolates, only MICs of 5FC and fluconazole fluconazole /flu·con·a·zole/ (floo-kon´ah-zol) a triazoleantifungal used in the systemic treatment of candidiasis and cryptococcal meningitis.

flu·con·a·zole
n.
 were determined.

Additional Studies on Selected Isolates

Growth Characteristics

For the first 16 [sub.S]5FC and 14 [sub.R]5FC consecutive isolates of C. tropicalis and for CBS 94 other studies were performed. Additional carbon sources were tested by using the commercial strips CH50 (bioMerieux). Maximal temperature of growth (42[degrees]C or 45[degrees]C) was determined on Sabouraud dextrose dextrose: see glucose.  agar. Growth in hyperosmolar medium (50% glucose or 10% NaCl) was also evaluated.

Nucleotide Sequence Determination

After 24 hours of incubation at 27[degrees]C on Sabouraud agar plates, single colonies were discharged in 1 mL of distilled water Noun 1. distilled water - water that has been purified by distillation
H2O, water - binary compound that occurs at room temperature as a clear colorless odorless tasteless liquid; freezes into ice below 0 degrees centigrade and boils above 100 degrees centigrade;
 in a microcentrifuge tube, and DNA extraction DNA extraction is a routine procedure to collect DNA for subsequent molecular or forensic analysis. Outline of a DNA extraction
There are three basic steps in a DNA extraction, the details of which may vary depending on the type of sample and any substances that may
 was performed by using the High Pure PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 Template Preparation Kit (Roche Applied Science, Mannheim, Germany) according to according to
prep.
1. As stated or indicated by; on the authority of: according to historians.

2. In keeping with: according to instructions.

3.
 manufacturer's instructions. Universal fungal primers were used for the amplification of the internal transcribed spacer ITS (for internal transcribed spacer) refers to a piece of non-functional RNA situated between structural ribosomal RNAs (rRNA) on a common precursor transcript. Read from 5' to 3', this polycistronic rRNA precursor transcript contains the 5' external transcribed sequence (5' ETS),  1 (ITS1)-5.8S-ITS2 (primers V9D and LS266 [5,6]) and the 26S (primers NL1 and NL4 [7]) rDNA regions. Primers (Table 1) were designed to amplify a partial sequence of the actin gene (GenBank accession nos. AJ389059 and AJ508499) and the 14-[alpha]-demethylase gene (GenBank accession nos. AY942646 and M23673). Reaction volumes of 20 [micro]L contained 1 [micro]L of genomic DNA genomic DNA
n.
The full complement of DNA contained in the genome of a cell or organism.
, 1.25 U of AmpliTaq Gold, 2 [micro]L of PeR buffer 10x, 2 [micro]L of 25 mmol/L Mg[Cl.sub.2] 2 [micro]L of 2.5 mmol/L deoxyribonucleoside triphosphates (dNTPs) (Roche), and 1 [micro]L (10 [micro]M) of primers. The PCR products were amplified by using the ICycler Thermocycler (Bio-Rad, Marnes-LaCoquette, France) set up with a first cycle of denaturation denaturation, term used to describe the loss of native, higher-order structure of protein molecules in solution. Most globular proteins exhibit complicated three-dimensional folding described as secondary, tertiary, and quarternary structures.  for 10 min at 95[degrees]C, followed by 30 cycles of denaturation at 94[degrees]C for 30 s, 30 s at the relevant annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  temperature, elongation at 72[degrees]C for 30 s, and a final extension step of 10 min at 72[degrees]C. Both strands of purified amplified fragments were sequenced at the Genopole of the Pasteur Institute The Pasteur Institute (French: Institut Pasteur) is a French non-profit private foundation dedicated to the study of biology, microorganisms, diseases and vaccines. , on an ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 Prism 3700 DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 Analyzer (Applied Biosystems Applied Biosystems, Inc. (formerly NASDAQ: ABIO) is the original name of a pioneer biotechnology company founded in 1981 in Foster City, California, among the Silicon Valley cities of the southern San Francisco Bay Area. , Courtaboeuf, France), with the same primers that were used in the PCR step. Sequences were edited with Chromas Pro version 1.33 (Yechnelysium Pry Ltd, Helensvale, Queensland Helensvale is a suburb of the Gold Coast, Australia. Helensvale was the first integrated suburb built on the hinterland fringe of the Gold Coast.

In the next five years, Helensvale is expected to develop further as a transport hub, with the current linking of the Gold Coast
, Australia). Multiple sequences alignments were performed with ClustalW version 1.8 (www.ebi.ac.uk/clustalw).

Following preliminary results, primers were then designed to amplify the complete sequence of the orotidine-5'-phosphate decarboxylase decarboxylase /de·car·box·y·lase/ (de?kahr-bok´si-las) any enzyme of the lyase class that catalyzes the removal of a carbon dioxide molecule from carboxylic acids.

de·car·box·yl·ase
n.
 gene (URA3, GenBank accession no. AF040702) (Table 1). Furthermore, the complete sequences of FCY FCY Foreign Currency 1 (coding for the cytosine cytosine (sī`tōsēn'), organic base of the pyrimidine family. It was isolated from the nucleic acid of calf thymus tissue in 1894.  deaminase deaminase /de·am·i·nase/ (de-am´i-nas) an enzyme causing deamination, or removal of the amino group from organic compounds, usually cyclic amidines.

de·am·i·nase
n.
), FCY2 (coding for the purine cytosine permease permease /per·me·ase/ (per´me-as) former name for transport protein.

per·me·ase
n.
An enzyme that promotes the passage of a substance across a cell membrane.
), and FUR1 (coding for the uracil uracil (yr`əsĭl), organic base of the pyrimidine family. It was isolated from herring sperm and also produced in a laboratory in 1900–1901.  phosphoribosyl transferase transferase /trans·fer·ase/ (trans´fer-as) a class of enzymes that transfer a chemical group from one compound to another.

trans·fer·ase
n.
) were determined. Primers were designed by using sequences from the Broad Institute C. tropicalis database genome (locus CTRG CTRG Clinical Trials Research Group
CTRG Collaboration Technology Research Group
_02927.3 for FCY1, locus CTRG_02059.3 for FCY2, and locus CTRG_02689.3 for FUR1) (Table 1). The sequences were amplified as described above (except for the duration of annealing and elongation [1 min] when using the primers set CTCP (networking) CTCP - Client To Client Protocol 1f/CTCP1r). The sequences were translated with the standard genetic code (www.bioinformatics.org/sms/index.html). The resulting protein sequences were aligned with the BioloMICS software (BioloMICS, version 7.2.5, BioAware S.A., Hannut, Belgium).

Microsatellite Selection

C. tropicalis genome sequences available from GenBank databases and from the Broad Institute (www.broad.mit.edu/annotation/fungi/candida_tropicalis) were studied to identify sequences containing microsatellite repeats. Two polymorphic microsatellite markers (PMMs) were selected, 1 upstream of the URA3 gene (URA3 PMM PMM Purchase Money Mortgage
PMM Project Management Methodology
PMM Perpetual Motion Machine
PMM Permanent Magnet Motor
PMM Professional Murder Music (band)
PMM Precision Measuring Machine
PMM Power Management Mode
) and 1 on a nonannotated sequence (CT14 PMM). Oligonucleotide primers were designed from the sequence of the corresponding flanking regions flanking regions

noncoding sequences on either side of the coding region of a gene that contain various regulatory sequences (motifs).
 to obtain PCR products ranging in size from 100 bp to 200 bp. One primer of each set was 5' labeled with different dyes (Table 1). PCR was conducted independently for the 2 loci loci

[L.] plural of locus.

loci Plural of locus, see there
 in a 20-[micro]L reaction volume containing 2 gL of extracted DNA, 1.25 U of AmpliTaq Gold, 2 [micro]L of PCR Buffer 10x, 4 [micro]L of 25 mmol/L Mg[Cl.sub.2], 2 [micro]L of 2 mmol/L dNTPs, and 0.2 [micro]L (10 [micro]M) of primers. PCR amplifications were performed for a total of 27 cycles by using the following conditions: denaturation at 95[degrees]C for 30 s, annealing at 55[degrees]C for 30 s, extension at 72[degrees]C for 1 min, and a final extension step of 5 min at 72[degrees]C. Two microliters of each PCR product mixed with 20 [micro]L of formamide and 0.5 [micro]L of an internal standard labeled with 6-carboxy-X-rhodamine dye (GeneScan-500 Tamra, Applied Biosystems) was run on an ABI Prism 310 Genetic Analyzer (Applied Biosystems). Sizes of the allele allele (əlēl`): see genetics.
allele

Any one of two or more alternative forms of a gene that may occur alternatively at a given site on a chromosome.
 and PCR fragments were determined with GenScan 3.0 (Applied Biosystems, Weiterstadt, Germany). To assign a specific length to a PCR fragment, all electromorphs were aligned with that of the type strain (CBS 94). Each allele was named after the length of PCR fragments. Isolates for which 1 signal was observed for a given locus on the electromorph were considered homozygous ho·mo·zy·gous
adj.
Having the same alleles at one or more gene loci on homologous chromosome segments.


Homozygous
Identical genes controlling a specified inherited trait.
 for this locus by analogy with what is reported for another diploid yeast, C. albicans (8).

Multilocus Sequence Typing Multilocus sequence typing (MLST) is a technique in molecular biology for the typing of multiple loci. The procedure characterizes isolates of bacterial species using the DNA sequences of internal fragments of multiple (usually seven) housekeeping genes.  Analysis

Three of the 6 MLST MLST Multi Locus Sequence Typing
MLST Medical Logistics Support Team
MLST Mini Losi Super Truck (1/18th scale radio control vehicle) 
 loci recently described were analyzed as reported in Tavanti et al. (9). These loci were selected because, according to these authors, they were associated with more polymorphism polymorphism, of minerals, property of crystallizing in two or more distinct forms. Calcium carbonate is dimorphous (two forms), crystallizing as calcite or aragonite. Titanium dioxide is trimorphous; its three forms are brookite, anatase (or octahedrite), and rutile.  (XYR1 and SAPT SAPT Symmetry-Adapted Perturbation Theory
SAPT Security Assistance Program Training
4) and with antifungal resistance (MDR MDR,
n See multidrug resistance.

MDR,
n the abbreviation for minimum daily requirement, specifically the Minimum Daily Requirements for Specific Nutrients compiled by the United States Food and Drug Administration.
1). Both strands of purified amplified fragments were sequenced, and sequences were edited as described above. Heterozygosity heterozygosity /het·ero·zy·gos·i·ty/ (het?er-o-zi-gos´i-te) the state of possessing different alleles at a given locus in regard to a given character.heterozy´gous

het·er·o·zy·gos·i·ty
n.
 was defined by the presence of 2 coincident peaks of similar height in the forward and the reverse sequence chromatograms. The l-letter code for nucleotides from the nomenclature of the International Union of Pure and Applied Chemistry International Union of Pure and Applied Chemistry (IUPAC), an international organization est. 1919 to advance the chemical sciences and contribute to the application of chemistry to the service of humanity.  (IUPAC IUPAC: see International Union of Pure and Applied Chemistry. , www.bioinformatics.org/sms/iupac.html) was used. Sequences were compared with the allele sequences of the C. tropicalis MLST database (www.pubmlst.org/ ctropicalis). For each gene, distinct alleles were identified and numbered by using the Internet-based MLST program (www.mlst.net). New alleles were submitted to the MLST C. tropicalis database.

Statistical Analysis

In accordance with French regulations, the clinical database was approved by the Commission Nationale de l'Informatique et des Libertes. Information concerning demographic data, risk factors for candidiasis candidiasis (kăn'dĭdī`əsĭs), infection of the mucous membranes caused by the fungus Candida albicans. Other terms for candidiasis are yeast infection, moniliasis (after a former name of the fungal genus), and thrush, the , and outcome 30 days after the diagnosis of fungemia were recorded. We considered 3 groups of patients according to the infecting isolate: [sub.S]5FC, [sub.R]5FC that belong to the clone ([sub.R]5FC clone, see below), and [sub.R]5FC that do not belong to the clone (termed "other [sub.R]5FC"). The sociodemographic and clinical characteristics were compared between the 3 groups of isolates by using the Fisher exact test. The [chi square chi square (kī),
n a nonparametric statistic used with discrete data in the form of frequency count (nominal data) or percentages or proportions that can be reduced to frequencies.
] Armitage trend test (10) was used to assess a trend in the evolution of the [sub.R]5FC clone's proportion among resistant strains across years of study. Multinomial mul·ti·no·mi·al  
n.
See polynomial.



[multi- + (bi)nomial.]


mul
 logistic regression In statistics, logistic regression is a regression model for binomially distributed response/dependent variables. It is useful for modeling the probability of an event occurring as a function of other factors.  (11) adjusted on clinical center was used to investigate the factors associated with infection by the [sub.R]5FC clone or other [sub.R]5FC isolates compared to [sub.S]5FC isolates according to sociodemographic and clinical characteristics. A logistic regression model adjusted on clinical center was also performed to identify the factors associated with the acquisition of the [sub.R]5FC clone compared with other [sub.R]5FC isolates. Regression models were constructed by using the backward procedure. First, all covariates with a p value <0.25 in univariate models were simultaneously entered into the regression model. The set of covariates with the largest p value was iteratively removed from the model until all of the covariates (or blocks of covariates) remaining in the reduced model had a p value <0.05. Statistical analyses were performed with Stata software, version 9.0 (StataCorp, College Station, TX, USA).

Results

Phenotypic Characterization of [sub.R]5FC Isolates

We analyzed the episodes of fungemia caused by C. tropicalis and recorded during the first 4 years of the YEASTS study; 130 episodes were recorded in 24 of the 27 participating centers. Distribution of flucytosine MICs showed 2 populations, 1 with MICs <2 [micro]g/mL and 1 with MICs [greater than or equal to] 8 [micro]g/mL (Figure). In light of these results, susceptibility to 5FC ([sub.S]5FC) was defined by an MIC <8 [micro]g/mL and resistance ([sub.R]5FC) by an MIC [greater than or equal to] 8 [micro]g/mL.

The proportion of [sub.R]5FC isolates (45 [35%]) of the 130 isolates) was uneven, ranging from 0% to 67% of the isolates, depending on the center of isolation. However, the proportion of [sub.R]5FC isolates did not differ over the study period (data not shown). We first studied the characteristics of a subset of 16 [sub.S]5FC and 14 [sub.R]5FC C. tropicalis isolates (strain CBS 94 had all the characteristics of [sub.S]5FC clinical isolates described below but is not included in the analysis). There was no difference in terms of growth in hyperosmolar media between [sub.R]5FC and [sub.S]5FC clinical isolates. By contrast, [sub.R]5FC and [sub.S]5FC isolates differed in the proportion of isolates growing at 45[degrees]C (40% vs. 100%, p<0.001) and assimilating starch (12.5% vs. 50%, p = 0.054) and xylitol xylitol /xy·li·tol/ (zi´li-tol) a five-carbon sugar alcohol derived from xylose and as sweet as sucrose; used as a noncariogenic sweetener and also as a sugar substitute in diabetic diets.  (62.5% vs. 12.5%, p = 0.009). No difference in the MIC of azoles or caspofungin was noted. All 29 strains of C. tropicalis synonyms stored at the CBS exhibited 5FC MICs [less than or equal to] 0.5 [micro]g/mL.

Genotypic Characterization of [sub.R]5FC Isolates

This subset of isolates (16 [sub.S]5FC and 14 [sub.R]5FC) was further analyzed. The deletion of 1 nucleotide (A) in position 106 (according to the type strain sequence, GenBank accession no. AY939810) of the ITS2 region was observed in 14 (100%) of the 14 [sub.R]5FC isolates compared to 5 (32%) of the 16 [sub.S]5FC isolates (p<0.001) (GenBank accession no. EU288196). No difference in nucleotide sequences was found for the D1/D2 region of the 26S rDNA or in the portion of the 14-[alpha] demethylase (490 bp) and actin (550 bp) genes analyzed. PMM results are summarized in Table 2. The URA3 and CT14 PMM led to 6 and 7 different allelic al·lele  
n.
One member of a pair or series of genes that occupy a specific position on a specific chromosome.



[German Allel, short for Allelomorph, allelomorph, from English
 associations, respectively. The association of both markers led to 13 PMM profiles. The 14 [sub.R]5FC isolates had the same URA3/CT14 PMM profile; however, among the 16 [sub.S]5FC, 15 had a PMM profile different from that of the [sub.R]5FC, and 1 (ODL ODL Open & Distance Learning
ODL Oklahoma Department of Libraries
ODL Object Description Language
ODL Object Definition Language
ODL Oxford Digital Library (service of Oxford University Libraries Service) 
6-560) had the [sub.R]5FC PMM profile. All but 1 (ODL2-237) of the [sub.R]5FC isolates had the same MLST profile, whereas none of the [sub.S]5FC isolates exhibited the same combination of the 3 MLST studied. The entire URA3 nucleotidic sequence of the translated region was identical except in 1 position (GenBank accession no. EU288194 for the type strain CBS 94 and EU288195 for 1 of the [sub.R]5FC isolates), [sub.S]5FC isolates were either homozygous or heterozygous het·er·o·zy·gous
adj.
1. Having different alleles at one or more corresponding chromosomal loci.

2. Of or relating to a heterozygote.
 at position 529 (A-A A-A Disney's Audio-Animatronics  or A-G A-G Air-to-Ground ), whereas all the [sub.R]5FC isolates were homozygous G-G G-G Ground-Ground . This produced a change of K177E (lysine lysine (lī`sēn), organic compound, one of the 20 amino acids commonly found in animal proteins. Only the l-stereoisomer appears in mammalian protein.  [right arrow] glutamate glutamate /glu·ta·mate/ (gloo´tah-mat) a salt of glutamic acid; in biochemistry, the term is often used interchangeably with glutamic acid.

glu·ta·mate
n.
1. A salt of glutamic acid.
) for the [sub.R]5FC isolates.

[FIGURE OMITTED]

Thus, results obtained with nucleotide changes (deletion of A in position 106 in the ITS2 region, mutation in position 529 of the URA3 gene) and polymorphisms in 3 MLST and 2 PMMs suggested that the 14 [sub.R]5FC studied were clonal. We thus decided to use the 2 PMMs (URA3 PMM, CT14 PMM) to genotype all the C. tropicalis isolates recovered during the study period in the YEASTS program. Of the 130 C. tropicalis isolates (including the 30 isolates studied above), 45 were [sub.R]5FC (Table 3). Thirty-three different profiles were observed when both PMMs were combined for the 130 isolates. Among the 45 [sub.R]5FC, a total of 29 isolates exhibited the profile associated with the [sub.R]5FC clone; 16 were different, with 11 different profiles, 6 of which were shared with [sub.S]5FC isolates. Among the [sub.S]5FC isolates, 4 had the PMM profile associated with the [sub.R]5FC clone. The URA3 gene was sequenced for these 4 isolates, and none had a G in position 529.

We then studied genes potentially involved in the mechanisms of 5FC resistance. For the FUR1 sequences, no missense mutation missense mutation
n.
A mutation in which a base change or substitution results in a codon that causes insertion of a different amino acid into the growing polypeptide chain, giving rise to an altered protein.
 was observed, and the complete coding sequence cod·ing sequence
n.
See exon.
 of the type strain CBS 94 (GenBank accession no. EU327978) was similar to the sequence of the [sub.R]5FC clone; however, a few silent mutations were observed in a few [sub.S]5FC isolates (GenBank accession nos. EU327979, EU327980, and EU327981). Concerning the cytosine deaminase sequences (FCY1), only 1 silent mutation, C21T, occurred for the [sub.R]5FC clone (GenBank accession no. EU327982). Finally, for the purine cytosine permease (FCY2), the sequences of the type strain (GenBank accession no. EU327983) and of the [sub.R]5FC clone were similar. A few heterozygosities were observed for the [sub.S]5FC isolates (GenBank accession nos. EU327984 and EU327985), but all these mutations were silent.

Factors Associated with Fungemia Caused by the C. tropicalis [sub.R]5FC Clone

All 130 isolates corresponded to incident fungemia in different persons. The [sub.R]5FC clone was recovered during the 4 years of study with a trend toward a decreased proportion over time (11/13 [85%], 6/10 [60%], 8/13 [61.5%], and 4/9 [44%]) during the first, second, third, and fourth year of the study, respectively; p = 0.06). The proportion of the clone also varied across clinical centers (data not shown). Factors associated with fungemia caused by the [sub.R]5FC clone of C. tropicalis were analyzed (Table 4). The proportion of patients infected by the [sub.R]5FC clone was significantly higher among patients with malignancies but their death rate was significantly lower than for patients infection with other [sub.R]5FC or [sub.S]5FC isolates. Multinomial logistic regression was adjusted by clinical centers to investigate the factors associated with infection by the [sub.R]5FC clone or others [sub.R]5FC isolates compared with [sub.S]5FC isolates. The risk of being infected by the [sub.R]5FC clone compared with a [sub.S]5FC isolate significantly increased in case of malignancy (odds ratio [OR] 3.7, 95% confidence interval confidence interval,
n a statistical device used to determine the range within which an acceptable datum would fall. Confidence intervals are usually expressed in percentages, typically 95% or 99%.
 [CI] 1.4-10.1, p = 0.009), and the risk for death at day 30 after fungemia was significantly decreased in patients infected by the [sub.R]5FC clone compared with the [sub.S]5FC isolates (OR 0.3, CI 0. I-0.9, p = 0.04), while no independent factor accounted for infection by other [sub.R]5FC isolates versus an [sub.S]5FC isolate. The only independent factor associated with infection by the [sub.R]5FC clone compared with other [sub.R]5FC isolates was the death rate at day 30 (OR 0.1, CI 0.03-0.6, p = 0.006).

Discussion

The bimodal distribution bimodal distribution

a distribution with two peaks separated by a region of low frequency of observations.
 of 5FC MICs against C. tropicalis isolates prospectively collected from 27 different clinical centers in the Paris area (YEASTS program, Figure) suggested that the C. tropicalis population was heterogenous (spelling) heterogenous - It's spelled heterogeneous. . On the basis of physiologic characteristics and molecular analysis (nucleotide sequences of the ITS regions, D1/D2 region of the large subunit, and large portions of the actin and 14-[alpha]-demethylase genes showing >99% similarity), we first assessed a subset of isolates (the first consecutive 14 [sub.R]5FC and 16 [sub.S]5FC isolates) and determined that both populations belong to the same species.

All 14 [sub.R]5FC isolates had a single nucleotide deletion in position 106 of the ITS2 region, although 5 of the 16 [sub.S]5FC isolates harbored it. When additional genotypic markers were used, all 14 [sub.R]5FC isolates had the same allelic combination for 2 PMMs selected (URA3 and CT14), the same missense mutation in the URA3 gene, and the same diploid sequences for the 3 MLST loci studied. By contrast, only 1 of 16 [sub.S]5FC isolates had the same PMM profiles as the [sub.R]5FC isolates, but this isolate differed in its MLST profile and the lack of mutation in the URA3 gene. In addition, the 16 [sub.S]5FC isolates exhibited 16 different MLST and 12 different PMM profiles. This finding suggested the existence of a [sub.R]5FC clone, but the rest of the population was genetically diverse. We thus analyzed the 130 isolates of C. tropicalis collected over 4 years in the YEASTS program by using the 2 PMMs and sequenced the URA3 gene when the PMM profile was identical to that of the 14 [sub.R]5FC isolates previously studied. We discovered that 29 (64%) of 45 [sub.R]5FC isolates had an identical PMM profile ([sub.R]5FC clone), while 11 and 30 different PMM profiles were found among the other 16 [sub.R]5FC isolates and the 85 [sub.S]5FC isolates, respectively. According to these data, we assumed that these 29 [sub.R]5FC isolates were clonal or at least highly genetically related.

The proportion of 35% of C. tropicalis isolates resistant to 5FC is unusual (3). Other studies report between 0 (12) and 15% (13) with intermediate values (14-16), and all the isolates stored as C. tropicalis in the CBS collection since 1912 exhibited 5FC MIC [less than or equal to] 0.5 [micro]g/mL. When we started the YEASTS program in 2002, the proportion of [sub.R]5FC was already at 46% and the clone accounted for 85% of the [sub.R]5FC isolates. The trend test suggested that the dispersal of the clone is declining in the Paris area. Whether this decline is specific for blood isolates or is a geographically and temporally restricted phenomenon deserves evaluation by using isolates collected over time from various body sites and geographic areas. An old report on isolates collected from various regions of France France is divided into 26 regions or régions (in French), of which 21 are in continental metropolitan France, one is the island of Corsica, and four lie overseas. Régions in mainland France are further subdivided in between 1 and 8 départements.  established with a nonstandardized technique that as many as 70% of the 63 isolates tested had an MIC [greater than or equal to] 32 [micro]g/mL in the 1980s (17), and a recent study from Germany on clinical isolates recovered from various body sites including blood reported that 58.3% of isolates were resistant (18). Whether any of these isolates belong to the [sub.R]5FC clone would be of interest. Of note, a recent study of 104 C. tropicalis clinical isolates recovered from various countries (9) showed that none of the 5 [sub.R]5FC isolates collected in the United Kingdom has the MLST profile of the [sub.R]5FC clone.

In the univariate analysis, patients infected by the [sub.S]5FC or [sub.R]5FC isolates or by the [sub.R]5FC clone differed significantly in terms of proportion of underlying malignancies (higher in patients with the clone) and death rate 30 days after fungemia (lower for patients infected by the clone). The [sub.R]5FC isolates as a whole, and the [sub.R]5FC clone specifically, were unevenly distributed around the Paris area. When adjusted for clinical center, logistic regression analysis showed that, compared to infection by [sub.S]5FC isolates, no factor was independently associated with infection by [sub.R]5FC isolates other than the clone, whereas 2 parameters were associated with infection by the clone. Indeed, malignancies multiplied the risk of being infected by the clone by almost 4 and the risk for death was divided by 3 in case of infection with the clone. C. tropicalis fungemia, independent of susceptibility to flucytosine, has already been associated with hematologic malignancies (19,20) (unpub. data from the YEASTS group). Whether the [sub.R]5FC clone is less virulent, as established for C. albicans isolates with decreased susceptibility to 5FC, remains to be determined (21).

The resistance to 5FC was associated with the K177E mutation in the URA3 gene in the clone. The mechanism of 5FC action is a consequence of intrafungal formation of 2 metabolites Metabolites
Substances produced by metabolism or by a metabolic process.

Mentioned in: Interactions
, 5-fluorodeoxyuridine monophosphate and 5-fluorouridine triphosphate triphosphate /tri·phos·phate/ (tri-fos´fat) a salt containing three phosphate radicals.

tri·phos·phate
n.
A salt or ester containing three phosphate groups.
, which alter DNA and protein synthesis Protein synthesis is the creation of proteins using DNA and RNA. Biological and artificial methods for creation of proteins differ significantly.
  • For biological protein synthesis, see protein biosynthesis.
  • For artificial protein synthesis, see peptide synthesis.
 (22). The URA3 enzyme (orotidine 5'-phosphate decarboxylase Orotidine 5'-phosphate decarboxylase is an enzyme involved in pyrimidine metabolism. Function
The enzyme converts orotidine monophosphate (OMP) to uridine monophosphate (UMP) by liberating carbon dioxide.
, ODCase) is involved in the metabolic pathway of uridyl-monophosphate (UMP UMP (uridine monophosphate): see uracil. ), which is a substrate of thymidylate synthetase synthetase /syn·the·tase/ (-the-tas) a term used in the names of some of the ligases, no longer favored because of its similarity to synthase and its emphasis on reaction products.

syn·the·tase
n.
 and UMP kinase, both involved in nucleic acid nucleic acid, any of a group of organic substances found in the chromosomes of living cells and viruses that play a central role in the storage and replication of hereditary information and in the expression of this information through protein synthesis.  synthesis. This mutation involves an amino acid amino acid (əmē`nō), any one of a class of simple organic compounds containing carbon, hydrogen, oxygen, nitrogen, and in certain cases sulfur. These compounds are the building blocks of proteins.  already known to be variable among reference strains (e.g., ATCC 20336), but it has not been associated with modification of the URA3 properties thus far (T. Noel, pers. comm.). Nevertheless, this mutation could, for example, modify the tridimensional tri·di·men·sion·al  
adj.
Of, relating to, or having three dimensions.
 structure of the protein, thereby affecting the binding affinity of the substrate for the catalytic site and thus modifying the ODCase efficacy. The ODCase is not known to interfere directly with 5FC activity. However, one of the resistance mechanisms against 5FC consists in increasing the transcription of all the genes involved in the de novo [Latin, Anew.] A second time; afresh. A trial or a hearing that is ordered by an appellate court that has reviewed the record of a hearing in a lower court and sent the matter back to the original court for a new trial, as if it had not been previously heard nor decided.  pyrimidine biosynthetic bi·o·syn·the·sis  
n.
Formation of a chemical compound by a living organism. Also called biogenesis.



bi
 pathway (including URA3) to overproduce o·ver·pro·duce  
tr.v. o·ver·pro·duced, o·ver·pro·duc·ing, o·ver·pro·duc·es
To produce in excess of need or demand.



o
 UMP (23).

The K177E mutation is associated with a specific PMM upstream the gene, with a possible role in the level of transcription. The fact that this PMM is homozygous may be due to a loss of heterozygosity Loss of heterozygosity (LOH) in a cell represents the loss of one parent's contribution to part of the cell's genome. LOH can arise via several pathways, including deletion, gene conversion, mitotic recombination and chromosome loss. . This phenomenon has been recently reported for C. albicans and the resistance to azoles (24) and for a specific C. albicans isolate and the resistance to caspofungin (25).

The mutations described in the 5FC resistance of C. albicans (26) or C. lusitaniae (27) involved 3 major genes: FCY2 coding for the purine cytosine permease, which enables 5FC to enter the fungal cell; FCY1 coding for the cytosine deaminase, which transforms 5FC into 5FU, and FUR1 coding for the uracil phosphoribosyl transferase, which transforms 5FU into 5FUMP FUMP First United Methodist Preschool (Austin, TX) . The fact that the clone was susceptible to 5FU suggests that the 5FC resistance could result from a mutation in the cytosine deaminase, the cytosine permease, or both (23). However, the sequences of the [sub.R]5FC clone, some [sub.S]5FC isolates, and the type strain CBS94 did not show any mutation in coding sequences of FCY1, FCY2, or FUR1 susceptible to explain the resistance of the clone to 5FC. The mechanism explaining the possible relationship between the specific PMM (URA3 178/178 and CT14 148/151), the KI77E mutation, and the resistance to 5FC remains to be determined.

Our results suggest that a clone of [sub.R]5FC isolates responsible for fungemia is widespread among patients hospitalized with malignancies in the Paris area and is associated with a lower mortality than that of other C. tropicalis isolates. Despite a trend toward a decreased proportion over time, further studies are needed to assess this clone's geographic and temporal distribution. Analysis of the 2 PMMs described in this study, coupled with determination of nucleotide at position 529 in the URA3 gene, should provide reliable means to track this clone.

Ms Desnos-Ollivier is an engineer at the National Reference Center of Mycoses and Antifungal at the Pasteur Institute in Paris, France. Her research interests include studying genotyping, sensibility to antifungal agents, and physiology of the yeasts responsible for human fongemia and underlining the relationship between genomic and phenotypic data.

References

(1.) Odds FC. Ecology of Candida and epidemiology of candidosis candidosis

see candidiasis.


candidiasis, candidosis

infection by fungi of the genus Candida, generally C. albicans. Three specific syndromes are recorded as being caused by C.
. Candida and candidosis: a review and bibliography. 2nd ed. London: Bailliere Tiudall; 1988. pp. 68-82.

(2.) Pfaller MA, Diekema DJ. Epidemiology of invasive candidiasis: a persistent public health problem. Clin Microbiol Rev. 2007:20: 133-63.

(3.) Pfaller MA, Messer SA, Boyken L, Huynh H, Hollis RJ, Diekema DJ. In vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment.

in vi·tro
adj.
In an artificial environment outside a living organism.
 activities of 5-fluorocytosine against 8,803 clinical isolates of Candida spp.: global assessment of primary resistance using National Committee for Clinical Laboratory Standards susceptibility testing methods. Antimicrob Agents Chemother. 2002;46:3518-21.

(4.) Cuenca-Estrella M, Moore CB, Barchiesi K Bille J, Chryssanthou E, Denning DW, et al. Multicenter evaluation of the reproducibility of the proposed antifungal susceptibility testing method for fermentative fer·men·ta·tive
adj.
1. Causing or having the ability to cause fermentation.

2. Relating to or of the nature of fermentation.
 yeasts of the Antifungal Susceptibility Testing Subcommittee of the European Committee on Antimicrobial Susceptibility Testing (AFST-EUCAST). Clin Microbiol Infect. 2003;9:467-74.

(5.) de Hoog GS, van den Ende GAH GAH Ground Antenna Hardware . Molecular diagnostics of clinical strains of filamentous filamentous /fil·a·men·tous/ (fil?ah-men´tus) composed of long, threadlike structures.

filamentous

composed of long, threadlike structures.
 Basidiomycetes Ba·sid·i·o·my·ce·tes
n.
A large group of fungi including puffballs, shelf fungi, rusts, smuts, and mushrooms that bear sexually produced spores on a basidium.



Basidiomycetes

a class of fungi.
. Mycoses. 1998;41:183-9.

(6.) Masclaux F, Gueho E, de Hoog GS, Christen chris·ten  
tr.v. chris·tened, chris·ten·ing, chris·tens
1.
a. To baptize into a Christian church.

b. To give a name to at baptism.

2.
a.
 R. Phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 relationships of human-pathogenic Cladosporium (Xylohypha) species inferred from partial LS rRNA sequences. J Med Vet Mycol. 1995;33:327-38.

(7.) O'Donnell K. Fusarium Fusarium

a genus of fungi; some species are plant pathogens and some are opportunistic infectious agents of humans and animals. Many also produce trichothecene toxins which cause poisoning of animals if the infected material, usually stored feed, is eaten.
 and its near relatives. Wallingford (UK): CAB International CAB International (CABI) is a not-for-profit inter-governmental organization. CABI was established in 1910 and is owned by 45 member countries. It is comprised of three divisions, each undertaking different activities relating to scientific research. : 1993.

(8.) Foulet F, Nicolas N, Eloy O, Botterel K Gantier JC, Costa JM, et al. Microsatellite marker analysis as a typing system for Candida glabrata. J Clin Microbiol. 2005;43:4574-9.

(9.) Tavanti A, Davidson AD, Johnson EM, Maiden MC, Shaw DJ, Gow NA, et al. Multilocus sequence typing for differentiation of strains of Candida tropicalis. J Clin Microbiol. 2005:43:5593-600.

(10.) Armitage P, Berry G. Statistical methods in medical research. 3rd ed. Oxford (UK): Blackwell Publishing: 1994.

(11.) Hosmer DW, Lemeshow S. Applied logistic regression. 2nd ed. Toronto; John Wiley & Sons Ltd.; 2000.

(12.) Cuenca-Estrella M, Diaz-Guerra TM, Mellado E, Rodriguez-Tudela JL. Flucytosine primary resistance in Candida species and Cryptococcus neoformans. Eur J Clin Microbiol Infect Dis. 2001;20:276-9.

(13.) Moore CB, Walls CM, Denning DW. Comparison of three methods for in vitro susceptibility testing of Candida species with flucytosine. J Antimicrob Chemother. 2003:51:297-304.

(14.) Alexander BD, Byrne TC, Smith KL, Hanson KE, Anstrom KJ, Perfect JR, et al. Comparative evaluation of Etest and sensititre yeastone panels against the Clinical and Laboratory Standards Institute M27-A2 reference broth microdilution method for testing Candida susceptibility to seven antifungal agents. J Clin Microbiol. 2007;45:698-706.

(15.) Quindos G, Ruesga MT, Martin-Mazuelos E, Salesa R, Alonso-Vargas R, Carrillo-Munoz AJ, et al. In-vitro activity of 5-fluorocytosine against 1,021 Spanish clinical isolates of Candida and other medically important yeasts. Rev Iberoam Micol. 2004;2 l:63-9.

(16.) Takakura S, Fujihara N, Saito T, Kudo ku·do  
n. pl. ku·dos
Usage Problem A praising remark; an accolade or compliment: "Children's book author Virginia Hamilton added another kudo to her prize-laden career" 
 T, Iinuma Y, Ichiyama S. National surveillance of species distribution in blood isolates of Candida species in Japan and their susceptibility to six antifungal agents including voriconazole and micafungin. J Antimicrob Chemother. 2004;53:283-9.

(17.) Nerson D, De Closets K Dupouy-Camet J, Kures L, Marjollet M, Poirot JL, et al. Antifungal susceptibility of yeasts (and a few filamentous fungi) by a standardized micromethod [in French]. Bulletin de la Societe Francaise de Mycologie Medicale. 1987; 16:395-8.

(18.) Fleck R, Dietz A, Hof H. In vitro susceptibility of Candida species to five antifungal agents in a German university hospital assessed by the reference broth microdilution method and Etest. J Antimicrob Chemother. 2007;59:767-71.

(19.) Almirante B, Rodriguez D, Park B J, Cuenca-Estrella M, Planes AM, Almela M, et al. Epidemiology and predictors of mortality in cases of Candida bloodstream infection: results from population-based surveillance, Barcelona, Spain, from 2002 to 2003. J Clin Microbiol. 2005;43:1829-35.

(20.) Tortorano AM, Peman J, Bernhardt H, Klingspor L, Kibbler CC, Faure O, et al. Epidemiology of candidaemia in Europe: results of 28-month European Confederation of Medical Mycology (ECMM ECMM European Community Monitor Mission (now European Union Monitoring Mission; diplomatic mission to Bosnia and Herzegovina starting 1991) ) hospital-based surveillance study. Eur J Clin Microbiol Infect Dis. 2004:23:317-22.

(21.) Fasoli MO, Kerridge D, Ryley JF. Pathogenicity of 5-fluorocytosine resistant strains of Candida albicans Candida albicans,
n a pathogenic yeast, which is the causal agent of thrush, vaginal infections, and systemic candidiasis.

Candida albicans 
 J Med Vet Mycol. 1990;28: 27-34.

(22.) Waldorf AR, Polak A. Mechanisms of action of 5-fluorocytosine. Antimicrob Agents Chemother. 1983;23:79-85.

(23.) Hope WW, Tabernero L, Denning DW, Anderson MJ. Molecular mechanisms of primary resistance to flucytosine in Candida albicans. Antimicrob Agents Chemother. 2004;48:4377-86.

(24.) Coste A, Turner V, Ischer F, Morschhauser J, Forche A, Selmecki A, et al. A mutation in Tac1p, a transcription factor regulating CDR (1) See CD-R and extension.

(2) (Call Detail Reporting) See call accounting.

(3) (Common Data Rate) A standard sampling rate for digital video for 480i and 576i systems. The rate is 13.5 MHz. See ITU-R BT.
1 and CDR2, is coupled with loss of heterozygosity at chromosome 5 to mediate antifungal resistance in Candida albicans. Genetics. 2006;172:2139-56.

(25.) Baixench MT, Aoun N, Desnos-Ollivier M, Garcia-Hermoso D, Bretagne S, Ramires S, et al. Acquired resistance to echinocandins in Candida albicans: case report and review. J Antimicrob Chemother. 2007;59:1076-83.

(26.) Vermes ver·mis  
n. pl. ver·mes
The region of the cerebellum lying between and connecting the two hemispheres.



[New Latin, from Latin, worm; see wer-2 in Indo-European roots.]
 A, Guchelaar HJ, Dankert J. Flucytosine: a review of its pharmacology, clinical indications, pharmacokinetics, toxicity and drug interactions. J Antimicrob Chemother. 2000;46:171-9.

(27.) Papon N, Noel T, Florent M, Gibot-Leclerc S, Jean D, Chastin C, et al. Molecular mechanism of flucytosine resistance in Candida lusitaniae: contribution of the FCY2, FCY1, and FUR1 genes to 5-fluorouracil and fluconazole cross-resistance. Antimicrob Agents Chemother. 2007;51:369-7l.

Address for correspondence: Francoise Dromer, Centre National de Reference Mycologie et Antifongiques, Unite de Mycologie Moleculaire, Center National de la Recherche Scientifique, URA3012, Institut Pasteur, 25 rue du Dr. Roux Roux , Pierre Paul Émile 1853-1933.

French bacteriologist. His work with the diphtheria bacillus led to the development of antitoxins to neutralize pathogenic toxins.
, 75724 Paris CEDEX 15, France; email: dromer@pasteur.fr

Marie Desnos-Ollivier, * Stephane Bretagne, * ([dagger]) Claire Bernede, * ([double dagger]) Vincent Robert, ([section]) Dorothee Raoux, * Elisabeth Chachaty, ([paragraph]) Elisabeth Forget, (#) Claire Lacroix, ** Francoise Dromer, * and the YEASTS group (1)

* Institut Pasteur, Paris, France; [dagger]-Hopital Henri Mondor--Assistance Publique Hopitaux de Paris, Creteil, France; ([double dagger]) Institut Pasteur Institut National de la Sante et de la Recherche Medicale Unite 657, Paris, France; ([section]) Centraal Bureau Voor Schimmelcultures, Utrecht, the Netherlands; ([paragraph]) Institut Gustave-Roussy, Villejuif, France; (#) Hopital Beaujon, Clichy, France; and ** Hopital Saint Louis, Paris, France

(1) The YEASTS group is composed of (in alphabetical order by city): Claire Bouges-Michel (Hopital Avicenne, Bobigny), Isabelle Poilane (Hopital Jean Verdier, Bondy), Marie-Elisabeth Bougnoux, Jean Dunand (Hopital Ambroise Pare, Boulogne), Guy Galeazzi (Hopital Louis Mourier, Colombes), Stephane Bretagne, Francoise Botterel (Hopital Henri Mondor, Creteil), Nathalie Fauchet (Centre Hospitalier Intercommunal in·ter·com·mu·nal  
adj.
Existing or occurring between communities: intercommunal strife. 
 de Creteil, Creteil), Elisabeth Forget (Hopital Beaujon, Clichy), Francoise Botterel, Christine Bonnal (Hopital du Kremlin Bicetre), Odile Eloy (Hopital Mignot, Le Chesnay), Christine Lawrence (Hopital Raymond Poincare, Garches), Marie-Francoise David, Liliana Mihaila (Hopital Paul Brousse, Villejuif), Elisabeth Chachaty, Olivier Adam (Institut Gustave Roussy, Villejuif), and in Paris: Christian Chochillon (Hopital Bichat), Andre Paugam, Marie-Therese Baixench (Hopital Cochin), Muriel Cornet (Hopital de l'Hotel Dieu), Marie-Christine Escande (Institut Curie Curie (kürē`), family of French scientists.

Pierre Curie, 1859–1906, scientist, and his wife,

Marie Sklodowska Curie, 1867–1934, chemist and physicist, b.
), Svetlana Challier, Marie-Elisabeth Bougnoux (Hopital Necker), Eric Dannaoui (Hopital Europeen Georges Pompidou), Annick Datry, Houria Laklache, Bader Lmimouni, Sophie Brun (Hopital de la Pitie-Salpetriere), Jean-Louis Poirot (Hopital Saint Antoine), Claire Lacroix (Hopital Saint Louis), Didier Moissenet (Hopital Trousseau), Michel Develoux (Hopital Tenon), and Stephane Bonacorsi (Hopital Robert Debre).
Table 1. Primers sequences and amplification parameters used
in the present study

Locus            Primer         5' labeling

14[alpha]        DMC1
  DM ([dagger])  DMC2 ([double
                 dagger])
Actin            ACTa
                 ACTb
URA3             URAF           HEX
                 URAr           ([section])
                 URAF2
                 URAr2
                 CTU2
Unknown          CT14a          6FAM
                 CT14b          ([paragraph])
FCY1             CTCDf
                 CTCDr
FCY2             CTCP1f
                 CTCP1r
FCY2             CTCP2f
                 CTCP2r
FUR1             FUR1f
                 FUR1r

                                                   Annealing
                                                   temperature,
Locus            Sequence (5'- 3') *               [degrees]C

14[alpha]        >TGGGTGGTCAACATACTTC                  50
  DM ([dagger])  <CATCTRTGTCTACCACCACC
Actin            >AAGGTATTATGGTTGGTATGG                55
                 <TCGAAATCTAAAGCAACGTAA
URA3             >ATTGGATAGTCCCTCTAAACTCACTACTA        55
                 <AGCATTAGTTATATCACTCCACGATGAA
                 >TGCCGATATTGGAAATACAGTTA              50
                 <AATCAACTATTCAAGTTGACCG
                 <GTTGGAACATCAATTGATGCACATAAAT         55
Unknown          >GTAAATCTTGTATACCGTGGA                55
                 <TAGCCCATTTTCTAGTTTTGC
FCY1             >ATCATTAGTTCAGATGGTAAAGTCTTG          58
                 <CCTTTTTAGTAACATGTCTATTCTCCA
FCY2             >TGCCCATAAATTAAATGCAGAA               58
                 <GGAAGCAACAAACCCAAAAA
FCY2             >TGCTGCCGATTATGTTGTTT                 58
                 <GTGAAAACGAGCCAATCCAT
FUR1             >TCATCAAAACCATGTCTGCTG                58
                 <AAGTGTATGTAGTGATAATTGCTATGC

* >, Sense primer; <, antisense primer.

([dagger]) 14 a demethylase.

([double dagger]) R = G or A.

([section]) 4, 7, 2',4', 5',7'-hexachloro-6-carboxyfluorescein.

([paragraph]) 6-carboxyfluorescein.

Table 2. Comprehensive analysis of 30 Candida tropicalis isolates *

                5FC MIC        Month of           SNP
Strain no.   ([micro]g/mL)     isolation          ITS2

ODL1-18           >64          2002 Nov            -
ODL1-40           >64          2002 Nov            -
ODL1-41           >64          2002 Nov            -
ODL1-53           16           2002 Dec            -
ODL2-105          >64          2003 Mar            -
ODL2-198          32           2003 Jul            -
ODL2-199          >64          2003 Jul            -
ODL3-237          >64          2003 Sep            -
ODL3-293          >64          2003 Oct            -
ODL4-311          >64          2003 Sep            -
ODL4-328          >64          2003 Nov            -
ODL4-341          >64          2003 Nov            -
ODL5-426          >64          2003 Dec            -
ODL6-558          32           2004 Apr            -
ODL1-58         <0.125         2003 Jan            +
ODL3-211         0.25          2003 Jul            +
ODL3-231        <0.125         2003 Sep            -
ODL4-302         0.25          2003 Sep            -
ODL4-347         0.25          2003 Nov            +
ODL4-384          0.5          2003 Dec            -
ODL5-460        <0.125         2004 Feb            +
ODL5-474        <0.125         2004 Mar            +
ODL5-476        <0.125         2004 Mar            +
ODL5-485        <0.125         2004 Mar            -
ODL5-488        <0.125         2004 Apr            +
ODL6-504        <0.125         2004 Feb            +
ODL6-511        <0.125         2004 Apr            +
ODL6-521        <0.125         2004 May            +
ODL6-539        <0.125         2004 Mar            +
ODL6-560        <0.125         2004 Jul            -
CBS94           <0.125            --               +

                      PMM alleles                 MLST

Strain no.       URA3            CT14             MDR1

ODL1-18         178/178         148/151            20
ODL1-40         178/178         148/151            20
ODL1-41         178/178         148/151            20
ODL1-53         178/178         148/151            20
ODL2-105        178/178         148/151            20
ODL2-198        178/178         148/151            20
ODL2-199        178/178         148/151            20
ODL3-237        178/178         148/151            18
ODL3-293        178/178         148/151            20
ODL4-311        178/178         148/151            20
ODL4-328        178/178         148/151            20
ODL4-341        178/178         148/151            20
ODL5-426        178/178         148/151            20
ODL6-558        178/178         148/151            20
ODL1-58         176/176         148/148            24
ODL3-211        174/178         148/148            1
ODL3-231        176/176         151/151           66#
ODL4-302        176/178         148/151            4
ODL4-347        174/174         151/154            7
ODL4-384        174/176         151/151           67#
ODL5-460        174/178         148/148           68#
ODL5-474        174/174         154/154            7
ODL5-476        178/178         151/151            27
ODL5-485        176/178         148/157            22
ODL5-488        176/178         148/151            25
ODL6-504        174/178         148/151            22
ODL6-511        174/178         148/148            1
ODL6-521        176/178         148/151           69#
ODL6-539        174/174         148/154            58
ODL6-560        178/178         148/151            4
CBS94           176/176         148/148           70#

                           MLST
                                                  URA3
Strain no.       XYR1            SAPT4          base 529

ODL1-18           26              10               G
ODL1-40           26              10               G
ODL1-41           26              10               G
ODL1-53           26              10               G
ODL2-105          26              10               G
ODL2-198          26              10               G
ODL2-199          26              10               G
ODL3-237          26              10               G
ODL3-293          26              10               G
ODL4-311          26              10               G
ODL4-328          26              10               G
ODL4-341          26              10               G
ODL5-426          26              10               G
ODL6-558          26              10               G
ODL1-58           30               7               A
ODL3-211          79#              1         A-G ([dagger])
ODL3-231           9              18               A
ODL4-302          36              23               A
ODL4-347          52               6               A
ODL4-384           4              19               A
ODL5-460          76#             36         A-G ([dagger])
ODL5-474          52               6               A
ODL5-476           4              11               A
ODL5-485          41               7               A
ODL5-488          24               7               A
ODL6-504           9              38               A
ODL6-511          80#              1         A-G ([dagger])
ODL6-521          77#             41#              A
ODL6-539          48              13               A
ODL6-560          36              23               A
CBS94             78#              5               A

* 5FC, flucytosine; SNP, single nucleotide polymorphism; ITS2,
internal transcribed spacer 2; PMM, polymorphic microsatellites
marker; MLST, multilocus sequence typing (boldface corresponds
to new alleles).

([dagger]) A-G heterozygous.

Note: boldface corresponds to new alleles indicated with #.

Table 3. Distribution of the polymorphic microsatellites markers
(PMM) profiles among 130 Candida tropicalis isolates, according to
their susceptibility to flucytosine (5FC) *

                                             No. isolate types

Allelic association   Total no.                [sub.R]5FC     Other
                      isolates    [sub.S]5FC     clone      [sub.R]5FC
URA3 PMM   CT14 PMM   (N = 130)    (n = 85)     (n = 29)     (n = 16)

172/172    142/148        3           3            --           --
172/172    148/154        2           2            --           --
172/174    142/148        3           2            --           1
172/174    148/148        1           1            --           --
172/174    148/154        1           1            --           --
172/176    142/148        5           4            --           1
174/174    142/148        5           3            --           2
174/174    148/148        1           --           --           1
174/174    148/151        1           1            --           --
174/174    148/154        6           6            --           --
174/174    151/154        1           1            --           --
174/174    154/154        1           1            --           --
174/176    142/148        6           6            --           --
174/176    148/151        1           1            --           --
174/176    151/151        3           3            --           --
174/178    142/148        8           5            --           3
174/178    145/151        1           --           --           1
174/178    148/148        5           5            --           --
174/178    148/151        2           1            --           1
176/176    142/148       11           10           --           1
176/176    148/148        3           3            --           --
176/176    148/151        4           4            --           --
176/176    151/151        1           1            --           --
176/178    142/148        3           3            --           --
176/178    145/151        1           1            --           --
176/178    148/148        1           -            --           1
176/178    148/151        5           5            --           --
176/178    148/157        1           1            --           --
176/180    151/151        1           1            --           --
178/178    142/148        3           2            --           1
178/178    145/151        6           3            --           3
178/178    148/151       33           4            29           --
178/178    151/151        1           1            --           --

* S subscript, susceptible; R subscript, resistant.

Table 4. Patient characteristics according to the 3 categories
delineated by the susceptibility of the Candida tropicalis
isolates to flucytosine (5FC) and their belonging to the
[sub.R]5FC clone *

                                                      [sub.R]5FC
                                         [sub.S]5FC     clone
Characteristic                            (n = 85)     (n = 29)

[greater than or equal to] 60 y of age    39 (46)      17 (59)
Male                                      55 (65)      18 (62)
Had malignancies                          41 (48)      22 (76)
  Cancerous                               15 (18)       7 (24)
  Hematologic                             26 (31)      15 (52)
In intensive care unit                    44 (52)      12 (41)
Had central venous catheter               68 (80)      24 (83)
Had recent surgery                        27 (32)       8 (30)
Had prior antifungal therapy              11 (13)         0
Died before day 30                       34/81 (42)   6/28 (21)

                                           Other
                                         [sub.R]5FC    p value
Characteristic                            (n = 16)    ([dagger])

[greater than or equal to] 60 y of age     9 (56)       0.452
Male                                      10 (63)       0.962
Had malignancies                           9 (56)       0.033
  Cancerous                                5 (31)       0.374
  Hematologic                              4 (25)       0.082
In intensive care unit                     4 (25)       0.116
Had central venous catheter               12 (75)       0.894
Had recent surgery                         4 (25)       0.918
Had prior antifungal therapy               2 (13)       0.093
Died before day 30                       10/15 (67)     0.014

* S subscript, susceptible, R subscript, resistant.
Values are no.

([dagger]) Fisher exact test.
COPYRIGHT 2008 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2008 Gale, Cengage Learning. All rights reserved.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:RESEARCH
Author:Desnos-Ollivier, Marie; Bretagne, Stephane; Bernede, Claire; Robert, Vincent; Raoux, Dorothee; Chach
Publication:Emerging Infectious Diseases
Geographic Code:4EUFR
Date:Apr 1, 2008
Words:6652
Previous Article:Determination of oseltamivir quality by colorimetric and liquid chromatographic methods.(RESEARCH)
Next Article:Emericella quadrilineata as cause of invasive aspergillosis.(RESEARCH)
Topics:



Related Articles
Candida dubliniensis fungemia: the first four cases in North American.
Successful Treatment of Cryptococcal Osteomyelitis and Paraspinous Abscess With Fluconazole and Flucytosine.
Disseminated Candida tropicalis in a patient with chronic mucocutaneous candidiasis.(Case Report)
Candida dubliniensis meningitis as delayed sequela of treated C. dubliniensis fungemia.(DISPATCHES)
The Gram stain goes molecular.
Ciprofloxacin resistance in Neisseria meningitidis, France.(LETTERS)
Systemic Yeast Infection
Chronic Yeast Infection ? Exposed
Do You Want to Know What the Best Natural Cures for Yeast Infection Are? and How You Can Cure It with 3 Easy Steps?

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles