Clonal multidrug-resistant Corynebacterium striatum strains, Italy.We assessed the clinical relevance and performed molecular characterization of 36 multidrug-resistant strains of Corynebacterium Corynebacterium /Co·ry·ne·bac·te·ri·um/ (-bak-ter´e-um) a genus of bacteria including C. ac´nes, a species present in acne lesions, C. diphthe´riae, the etiologic agent of diphtheria, C. striatum striatum /stri·a·tum/ (stri-a´tum) corpus striatum.stria´tal stri·a·tum n. pl. stri·a·ta . Pulsed-field gel electrophoresis confirmed a single clone, possessing erm(X), tetA/B, cmxA/B, and aphA1 genes, but few related subclones. This strain isemer in as a pathogen in Italy. ********** Isolation of Corynebacterium spp. as the only organism from clinical specimens from patients, mostly with varying degrees of immunocompromisation and severe infections, is increasing in Italy. Therefore, we evaluated the microbiologic characteristics, resistance profiles, and similarities among genomes of multidrug-resistant (MDR MDR, n See multidrug resistance. MDR, n the abbreviation for minimum daily requirement, specifically the Minimum Daily Requirements for Specific Nutrients compiled by the United States Food and Drug Administration. ) C. striatum strains. The Study We evaluated 36 strains of MDR C. striatum, isolated from 3 hospitals in Italy This is a list of hospitals in Italy.
(2) (Branch And Link) An instruction used to transfer control to another part of the program. BAL - Basic Assembly Language ) fluid, 3 from blood, 7 from central venous catheter central venous catheter n. A catheter passed through a peripheral vein and ending in the thoracic vena cava; it is used to measure venous pressure or to infuse concentrated solutions. tips, 5 from tracheal tracheal pertaining to or emanating from trachea. tracheal aspiration see transtracheal aspiration. tracheal band sign on contrast radiography of a dilated esophagus, the impression made ventrally by the trachea. aspirates, 4 from wound specimens, 1 from BAL and pleural fluid, 1 from urine, and 1 from a lung biopsy specimen. To assess the clinical relevance of these strains, we used the Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center. 2004 definition for nosocomial infections (www.cdc.gov/ncidod/dhqp/nnis_pubs.html) (1) and tracked antimicrobial drug-resistance determinants. We identified all strains as putative C. striatum by using the commercial system API 20 Coryne (bioMerieux, Marcy l'Etoile, France). C. striatum was differentiated from C. amycolatum by supplementary tests, i.e., tyrosine hydrolysis, N-acetylglucosamine assimilation, and phenylacetic acid assimilation (2); it was reconfirmed by sequencing the internal fragment of the 16S rRNA gene (3). The American Type Culture Collection American Type Culture Collection (ATCC) is a private, not-for-profit biological resource center whose mission focuses on the acquisition, authentication, production, preservation, development and distribution of standard reference microorganisms, cell lines and other materials for (ATCC ATCC American Type Culture Collection, see there ) 6940 C. striatum strain was included as phenotypic and molecular control. All strains were stored at -80[degrees]C until use. MICs were determined by using microdilution in cation-adjusted Mueller-Hinton broth in accordance with guidelines of the Clinical and Laboratory Standards Institute (CLSI CLSI Clinical and Laboratory Standards Institute (Wayne, PA) CLSI Cisco Link Services Interface ) (4). The following antimicrobial drugs were tested: tigecycline and piperacillin/tazobactam, oxacillin oxacillin /ox·a·cil·lin/ (ok?sah-sil´in) a semisynthetic penicillinase-resistant penicillin used as the sodium salt in infections due to penicillin-resistant, gram-positive organisms. , gentamicin gentamicin /gen·ta·mi·cin/ (jen?tah-mi´sin) an aminoglycoside antibiotic complex isolated from bacteria of the genus Micromonospora, , kanamycin kanamycin /kan·a·my·cin/ (kan?ah-mi´sin) an aminoglycoside antibiotic derived from Streptomyces kanamyceticus, effective against aerobic gram-negative bacilli and some gram-positive bacteria, including mycobacteria; used as the , levofloxacin, erythromycin erythromycin (ĭrĭth'rōmī`sĭn), any of several related antibiotic drugs produced by bacteria of the genus Streptomyces (see antibiotic). , clindamycin, piperacillin, vancomycin, teicoplanin, tetracycline tetracycline (tĕ'trəsī`klēn), any of a group of antibiotics produced by bacteria of the genus Streptomyces. They are effective against a wide range of Gram positive and Gram negative bacteria, interfering with protein , moxifloxacin, imipenem, meropenem, quinupristin/ dalfopristin, linezolid, and daptomycin. Etest strips (AB-BIODISK, Solna, Sweden) were used for vancomycin, teicoplanin, linezolid, and daptomycin. Daptomycin Etests were performed by using Muller-Hinton agar (Oxoid, Milan, Italy), supplemented to a final concentration of 50 mg/L calcium. In the absence of approved breakpoints for Corynebacterium spp., we used those for [alpha]-hemolytic streptococci Streptococcus (plural, streptococci) A genus of spherical-shaped anaerobic bacteria occurring in pairs or chains. Sydenham's chorea is considered a complication of a streptococcal throat infection. of the viridans group. Results were read after incubation at 37[degrees]C for 18-24 h. Susceptibility to daptomycin was defined as MIC [less than or equal to] 1 mg/L (5); CLSI guideline MIC breakpoints were used for all other drugs tested (4). To further characterize the C. striatum isolates, we used 2 DNA fingerprinting techniques: automated ribotyping (RiboPrinter Microbial Characterization System; DuPont Qualicon, Wilmington, DE, USA) with EcoRI as restriction enzyme and pulsed-field gel electrophoresis (PFGE PFGE Pulsed-Field Gel Electrophoresis ) macrorestriction analysis with 2 enzymes (XbaI and SwaI; New England Biolabs New England Biolabs (NEB) produces and supplies reagents for the life science industry. NEB offers a large selection of recombinant and native enzymes for genomic research. It also offers products in the areas related to proteomics and drug discovery. , Beverly, MA, USA). We had used 4 enzymes (XbaI, SwaI, SfiI, and PaeI) to test 10 random strains, but because XbaI and SwaI enzyme-restriction patterns gave a better resolution for low and high molecular weight fragments, respectively, we used only these 2 restriction enzymes to type all 36 strains. Whole genomic DNA chromosomal extraction, macrorestriction digestion, and PFGE (CHEF-DR II apparatus; Bio-Rad, Hercules, CA, USA) were performed as previously reported (6). Macrorestriction fragments were separated on 1% (wt/vol) ultrapure agarose gels (Sigma Aldrich, St. Louis, MO, USA) at 6 V/cm, for 21 h at 14[degrees]C with pulse times of 0.1-5 s, to separate XbaI fragments, and for 23 h with pulse times of 1-70 s, to separate SwaI fragments. Lambda DNA DNA: see nucleic acid. DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. concatemers (New England BioLabs) were used as molecular size markers. Similarities among macrorestriction patterns were identified according to established criteria (7). The sequence of pTPl0 (GenBank accession no. AF024666) (8) was used to design the primers for erm(X), tetA and tetB, cmx, aphA1, and repB genes. The VectorN-TI program (Invitrogen, www.invitrogen.com) was used for this purpose. The presence of pTP10 was confirmed first by amplification and sequencing of the resistance determinants and the replication gene (repB) and then by XbaI and SwaI PFGE hybridizations, performed with the specific probes (erm(X), tetAB, cmx, and aphA1), following a protocol previously described (9). The PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) amplifications were performed in a Techne TC412 thermal cycler (Barloworld Scientific, Staffordshire, UK). All primers and the related probe regions used in hybridization hybridization /hy·brid·iza·tion/ (hi?brid-i-za´shun) 1. crossbreeding; the act or process of producing hybrids. 2. molecular hybridization 3. experiments are shown in Table 1. All C. striatum isolates were recovered from hospitalized patients who had undergone surgery or been admitted to intensive care units (Table 2). We documented 19 cases of infections and discarded 17 as contaminants. The isolates that were considered causes of infections were responsible for 8 cases of ventilator-associated pneumonia (including 1 with associated pleural Pleural Pleural refers to the pleura or membrane that enfolds the lungs. Mentioned in: Pneumothorax pleural emanating from or pertaining to the pleura. empyema empyema (ĕmpē-ē`mə), persistent purulent discharge into a cavity such as the pleural space or the gallbladder. Empyema results as a complication of bacterial infections such as pneumonia and lung abscess. ), 2 cases of pneumonia, 1 case of catheter-related sepsis, 2 cases of ventilator-associated tracheobronchitis, and 6 cases of wound infections. The 36 strains showed an MDR phenotype, including resistance to [greater than or equal to] 3 classes of drugs; MICs required to inhibit growth of 90% (MIC90) were penicillins [greater than or equal to] 256 mg/L, carbapenems [greater than or equal to] 256 mg/L, gentamicin 32 mg/L, levofloxacin 256 mg/L, tetracycline [greater than or equal to] 256 mg/L, lincosamides [greater than or equal to] 256 mg/L, and erythromycin 32 mg/L. C. striatum strains were susceptible to only the most recent drugs used for treatment of infections with gram-positive organisms, such as glycopeptides and tigecycline ([MIC.sub.90] 1 mg/L), quinupristin/dalfopristin and daptomycin ([MIC.sub.90] 0.25 mg/L), and linezolid ([MIC.sub.90] 2 mg/L). A discrepancy was found when susceptibility testing using a disk-diffusion method was performed on different strains; the inhibition zone of erythromycin was always in the intermediate range, even if MICs for this drug were in the low-resistance range. Ribotyping gave a unique profile for all strains in this study. PFGE enabled us to discriminate the right number of macrorestriction fragments (5,10,11) for pattern comparison. Analyses of SwaI digestion patterns showed that of the 36 strains, only 1 clone had 3 different subtypes (30 strains subtype al, 4 strains a2, and 2 strains a3). Macrorestriction analysis with XbaI showed almost comparable results (27 strains A1, 7 strains A2, and 2 strains A3) (Figure). This genotyping method and the enzymes used were defined as appropriate, comparing PFGE patterns of our clinical isolates with C. striatum ATCC 6940 type strain, which was different with respect to the epidemic strains. This result demonstrates that single MDR C. striatum clones had been selected and were circulating in the 3 hospitals. Further, the molecular characterization of some of the resistance genes in the 36 C. striatum isolates demonstrated the presence of erm(X), codifying for the resistance to erythromycin and clindamycin; tetA, and tetB, codifying for the resistance to tetracycline, oxytetracycline oxytetracycline /oxy·tet·ra·cy·cline/ (ok?se-tet?rah-si´klen) a broad-spectrum tetracycline antibiotic produced by Streptomyces rimosus, used as the base or the hydrochloride salt. , and oxacillin; and cmx and aphA1, responsible for resistance to aminoglycosides and chloramphenicol chloramphenicol (klōr'ămfĕn`əkŏl'), antibiotic effective against a wide range of gram-negative and gram-positive bacteria (see Gram's stain). It was originally isolated from a species of Streptomyces bacteria. , respectively. The presence of pTP 10 carrying all these determinants was confirmed by amplification and sequencing of these genes and the replication gene of the plasmid, together with hybridization experiments demonstrating that all resistance determinants were localized in the same hybridization band generated by each probe onto [PFGE.sub.XbaI] ([approximately equal to] 15 kb) and [PFGE.sub.SwaI] ([approximately equal to] 280 kb) membranes (Figure). Conclusions We report isolation of MDR C. striatum from clinical specimens responsible for cases of pneumonia, catheter-related bacteremia, and wound infections. Infections sustained from this species are strongly associated with devices, not only tubes or catheters (91%) but also sternal sternal /ster·nal/ (ster´n'l) of or relating to the sternum. ster·nal adj. Of, relating to, or occurring near the sternum. sternal pertaining to the sternum. surgical wound wires. The MDR phenotype of these strains was immediately observed and was responsible for the alarm that led to the subsequent in-depth examination of these strains. Their clonal nature, as demonstrated in our study, is of particular concern. Further, the MDR phenotype correlated to the presence of the pTP10 plasmid, which demonstrates that these MDR microorganisms acquired not only the capability to cause infections but also increased resistance and the ability to spread by virtue of their clonal nature. The only drugs still active against these MDR strains are glycopeptides, linezolid, quinopristin/dalfopristin, daptomycin, and tigecycline. To avoid using drugs that appear active in vitro but that could be ineffective in vivo, clinicians should be aware of the circulation of these MDR strains. [FIGURE OMITTED] Acknowledgments We are indebted to Antony Brigdewood for the language revision of the manuscript. This work was supported by grants from European Union Drug Resistance Spread 2 project contract no. 018705 to S.S. and from Fondazione IRCCS IRCCS Istituto Di Ricovero e Cura a Carattere Scientifico (Italian Research Hospital) Policlinico San Matteo, Pavia, to E.C. (Ricerca Finalizzata 2006) and to P.M. (Ricerca Corrente 1998-2006: "Sorveglianza delle infezioni ospedaliere: tipizzazi one epidemiologica di microrganismi patogeni mediante metodiche molecolari"). References (1.) Mayall C, editor. Surveillance of nosocomial infections. 3rd ed. Philadelphia: Lippincott Williams & Wilkins; 2004. (2.) Renom F, Garau M, Rubi M, Ramis F, Galmes A, Soriano JB. Nosocomial nosocomial /noso·co·mi·al/ (nos?o-ko´me-il) pertaining to or originating in a hospital. nos·o·co·mi·al adj. 1. Of or relating to a hospital. 2. outbreak of Corynebacterium striatum infection in patients with chronic obstructive pulmonary disease chronic obstructive pulmonary disease n. Abbr. COPD A chronic lung disease, such as asthma or emphysema, in which breathing becomes slowed or forced. . J Clin Microbiol. 2007;45:2064-7. (3.) Pascual C, Lawson PA, Farrow JA, Gimenez MN, Collins MD. Phylogenetic analysis of the genus Corynebacterium based on 16S rRNA gene sequences. Int J Syst Bacteriol. 1995;45:724-8. (4.) Clinical and Laboratory Standard Institute. Performance standards for antimicrobial testing. Approved standards. Wayne (PA): The Institute; 2006. (5.) Iaria C, Stassi G, Costa GB, Biondo C, Gerace E, Noto A, et al. Outbreak of multi-resistant Corynebacterium striatum infection in an Italian general intensive care unit. J Hosp Infect. 2007;67:102-4. DOI (Digital Object Identifier) A method of applying a persistent name to documents, publications and other resources on the Internet rather than using a URL, which can change over time. : 10.1016/j.jhin.2007.07.002 (6.) Sampaio JLM JLM Jesus Loves Me JLM Just Like Me JLM Junior League of Memphis JLM Junior League of Minneapolis JLM Junior League of Mobile JLM Junior League of Madison JLM Junior League of Montgomery JLM Junior League of Miami, Inc. JLM Junior League of McAllen, Inc. , Chimara E, Ferrazoli L, da Silva Telles MA, Del Guercio VM, Jerico ZVN, et al. Application of four molecular typing methods for analysis of Mycobacterium mycobacterium Any of the rod-shaped bacteria that make up the genus Mycobacterium. The two most important species cause tuberculosis and leprosy in humans; another species causes tuberculosis in both cattle and humans. fi)rtuitum group strains causing post-mammaplasty infections. Clin Microbiol lnfect. 2006;12:142-9. DOI: 10.1111/j.i469-0691.2005.01312.x (7.) Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol. 1995;33:2233-9. (8.) Tauch A, Krieft S, Kalinowski J, Puhler A. The 51,409-bp R-plasmid pTP 10 from the multiresistant clinical isolate Corynebacterium striatum M82B is composed of DNA segments initially identified in soil bacteria and in plant, animal, and human pathogens. Mol Gen Genet. 2000;263:1-11. DOI: 10.1007/PL00008668 (9.) Mato R, Camapnile F, Stefani S, Crisostomo MI, Santagati M, Sanches SI, et al. Clonal types and multidrng resistance patterns of methicillin-resistant Staphylococcus aureus methicillin-resistant Staphylococcus aureus Methicillin-aminoglycoside resistant Staphylococcus aureus, MRSA An organism with multiple antibiotic resistances–eg, aminoglycosides, chloramphenicol, clindamycin, erythromycin, rifampin, tetracycline, (MRSA MRSA Methicillin-resistant Staphylococcus aureus. See MARSA. ) recovered in Italy during the 1990s. Microb Drug Resist. 2004;10:106-13. DOI: 10.1089/1076629041310109 (10.) Tarr PE, Stock F, Cooke RH, Fedorko DP, Lucey DR. Multidrug-resistant Corynebacterium striatum pneumonia in a heart transplant recipient. Transpl Infect Dis. 2003;5:53-8. (11.) Martin MC, Melon O, Celada MM, Alvarez J, Mendez FJ, Vazquez F. Septicaemia septicaemia or septicemia Noun an infection of the blood which develops in a wound [Greek sēptos decayed + haima blood] septicemia, septicaemia due to Corynebacterium striatum: molecular confirmation of entry via the skin. J Med Microbiol. 2003;52:599-602. Author affiliations: University of Catania Organization Faculties These are the 12 faculties in which the university is divided into:
DOI: 10.3201/eid1501.080804 Address for correspondence: Stefania Stefani, Department of Microbiology, University of Catania, Via Androne 81, 95124 Catania, Italy; email: stefanis@unict.it The opinions expressed by authors contributing to this journal do not necessarily reflect the opinions of the Centers for Disease Control and Prevention or the institutions with which the authors are affiliated. Dr Campanile is a researcher at the Department of Microbiology, University of Catania. She is involved in the fields of antimicrobial drug resistance, molecular typing, evolutionary relationships among strains of diverse sources, and horizontal exchange of antimicrobial drug resistance determinants by mobile genetic elements Mobile genetic elements (MGE) are a type of DNA that can move around within the genome. They include:
Table 1. Primer conditions, PCR products, and related sequences
confirmed by BLAST analysis of 36 strains of
multidrug-resistant Corynebacterium striatum, Italy, 2005-2007 *
Sequence (5'
Primer Related resistance [right arrow] 3')
ermX up Erythromycin and AACCATGATTGTGTTTCTGAACG
ermX down clindamycin ACCAGGAAGCGGTGCCCT
tetA up Tetracycline, TTAGCGTTCGGCGACCTGG
tetB down oxytetracycline, AACTGGGTGCCTTCAGGGTC
and oxacillin
cmxB up Cloramphenicol AGTCGGTATGGTCGTCGGC
cmxA down (2 identical subunits) GCTCCGATATTCAATGCTGCG
aphA1 up Aminoglycoside GGCAAGATCCTGGTATCGGTCT
aphA1 down AGACTAAACTGGCTGACGGCAT
repB up Replicase CGATCTGGAATTTGTCTGCCGT
repB down CTGGTTGATAGACCCCGTGT
Temperature, BLAST from-to,
Primer [degrees]C Size, by bp
ermX up 57 566 2,285-2,850
ermX down
tetA up 58 1,829 5,496-7,324
tetB down
cmxB up 57 879 16,031-16,909
cmxA down 36,078-36,956
aphA1 up 57 480 41,859-42,338
aphA1 down
repB up 57 875 32,523-33,397
repB down
* BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) analysis of
each gene with pTP10 sequence (GenBank accession no. AF024666)
showed nucleotide identities > 99%.
Table 2. Clinical diagnoses for 36 patients with
Corynebacterium striatum infection, Italy, 2005-2007 *
No. isolates
From
non-ICU
Specimens Total From ICU wards
BAL fluid, pleural fluid, blood, 8 7 1
tracheal aspirate
BAL fluid 2 2 0
BAL fluid, lung biopsy 2 0 2
Blood, CVC tip 1 1 0
CVC tip 1 1 0
Blood, surgical wound 5 1 4
Tracheal aspirate 10 10 0
CVC tip 6 4 2
Urine 1 0 1
Total 36 26 10
Specimens Diagnosis
BAL fluid, pleural fluid, blood, Ventilator-associated pneumonia
tracheal aspirate
BAL fluid Ventilator-associated
tracheobronchitis
BAL fluid, lung biopsy Pneumonia
Blood, CVC tip CVC-related bacteremia
CVC tip CVC exit-site cellulites
Blood, surgical wound Sternal wound cellulites and
infections
Tracheal aspirate Ventilator-associated
respiratory tract colonization
CVC tip CVC-exit site colonization
Urine Urinary tract catheter
colonization
Total
* ICU. intensive care unit: BAL, bronchoalveolar lavape:
CVC, central venous catheter.
|
|
||||||||||||||||||

Printer friendly
Cite/link
Email
Feedback
Reader Opinion