Printer Friendly
The Free Library
14,709,930 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Chromosomal mapping of 5S ribosomal RNA genes in the eastern oyster, Crassostrea virginica Gmelin by fluorescence in situ hybridization.


ABSTRACT Chromosomal location of the 5S ribosomal RNA gene was studied in the eastern oyster, Crassostrea virginica Gmelin, using fluorescence in situ hybridization Fluorescence in situ hybridization (FISH)
A technique for diagnosing DiGeorge syndrome before birth by analyzing cells obtained by amniocentesis with DNA probes. FISH is about 95% accurate.
 (FISH). Metaphase metaphase /meta·phase/ (met´ah-faz) the second stage of cell division (mitosis or meiosis), in which the chromosomes, each consisting of two chromatids, are arranged in the equatorial plane of the spindle prior to separation.  chromosomes were obtained from early embryos, and the FISH probe was made by PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 (polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is ) amplification of the 5S rRNA gene and labeled by incorporation of digoxigenin-11-dUTP during PCR. Hybridization hybridization /hy·brid·iza·tion/ (hi?brid-i-za´shun)
1. crossbreeding; the act or process of producing hybrids.

2. molecular hybridization

3.
 was detected with fluorescein-labeled antidigoxigenin antibodies. Two pairs of FISH signals were observed on metaphase chromosomes. Karyotypic analysis showed that the 5S rRNA gene cluster is interstitially located on short arms of chromosomes 5 and 6. On chromosome 5, the 5S rRNA genes were located immediately next to the centromere centromere

Structure in a chromosome that holds together the two chromatids. It is the point of attachment to the structure that pulls the chromatids to opposite ends of the cell during cell division (see mitosis).
, whereas on chromosome 6, they were located approximately half way between the telomere telomere /telo·mere/ (tel´o-mer) an extremity of a chromosome, which has specific properties, one of which is a polarity that prevents reunion with any fragment after a chromosome has been broken.  and the centromere. Chromosomes of C. virginica are difficult to identify because of their similarities in size and arm ratio, and the chromosomal location of 5S rRNA genes provides unambiguous identification of chromosomes 5 and 6. Previous studies have mapped the major rRNA gene cluster (18S-5.8S-28S) to chromosome 2, and this study shows that the 5S rRNA gene cluster is not linked to the major rRNA genes and duplicated during evolution.

KEY WORDS: FISH, chromosome identification, 5S ribosomal RNA genes, Crassostrea virginica

INTRODUCTION

The eastern oyster (Crassostrea virginica Gmelin) is an important fishery and aquaculture aquaculture, the raising and harvesting of fresh- and saltwater plants and animals. The most economically important form of aquaculture is fish farming, an industry that accounts for an ever increasing share of world fisheries production.  species of the United States. It is also a keystone species in the ecology of many estuaries along the Atlantic and Gulf Coasts. Eastern oyster populations along much of the Atlantic Coast have been in decline because of over-fishing, habitat destruction and diseases (MacKenzie 1996). Aquaculture production is limited by diseases and the lack of superior stocks. Domestication domestication

Process of hereditary reorganization of wild animals and plants into forms more accommodating to the interests of people. In its strictest sense, it refers to the initial stage of human mastery of wild animals and plants.
 and broodstock development through traditional selective breeding have been slow, and the application of molecular biotechnology depends on accurate and sophisticated knowledge about the oyster genome (Guo 2004). Unfortunately, the genome of the eastern oyster is poorly understood at this time including its most basic units--chromosomes. The characterization and identification of chromosomes are essential for several types of genomic research including physical mapping of genes to chromosomes and studies on aneuploidy aneuploidy /an·eu·ploi·dy/ (an?u-ploi´de) any deviation from an exact multiple of the haploid number of chromosomes, whether fewer or more.

an·eu·ploi·dy
n.
.

The eastern oyster has a haploid haploid /hap·loid/ (hap´loid)
1. having half the number of chromosomes characteristically found in the somatic (diploid) cells of an organism; typical of the gametes of a species whose union restores the diploid number.
 number of 10 chromosomes (Longwell et al. 1967). Despite the low haploid number, chromosome identification in the eastern oyster remains a challenge because the chromosomes are small in size and similar in arm ratio. Chromosome identification by karyotyping Karyotyping
A laboratory test used to study an individual's chromosome make-up. Chromosomes are separated from cells, stained, and arranged in order from largest to smallest so that their number and structure can be studied under a microscope.
 and traditional banding has been difficult. Traditional banding techniques, such as G-banding and C-banding, have been studied in three Crassostrea species including C. virginica (Rodriguez-Romero et al. 1979, Leitao et al. 1999a), but the reproducibility was low and banding characteristics were not clear and stable enough for routine chromosome identification. Nucleolar organizer regions (NORs) have been investigated with silver staining in 7 Crassostrea species: C. gigas (Thiriot-Quievreux & Insua 1992, Leitao et al. 1999b), C. virginica and C. ariakensis, C. sikamea, C. gasar (Leitao et al. 1999b), C. rhizophorae (Lapegue et al. 2002) and C. angulata (Cross et al. 2003). Whereas silver staining is helpful in identifying some chromosomes, the number and location of active NORs can vary within species.

Recently, fluorescence in situ hybridization (FISH), has been applied to oyster cytogenetics cytogenetics /cy·to·ge·net·ics/ (-je-net´iks) the branch of genetics devoted to cellular constituents concerned in heredity, i.e. chromosomes. , providing new opportunities for chromosome identification. By directly hybridizing DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 fragments to their homologous targets on chromosomes, FISH may produce specific and reproducible identification of chromosomes. FISH offers a powerful tool not only for chromosome identification but also for a range of genomic analyses, including the chromosomal mapping of genes (Swiger & Tucker 1996). Using FISH, a repetitive element has been mapped to centromeric cen·tro·mere  
n.
The most condensed and constricted region of a chromosome, to which the spindle fiber is attached during mitosis.



cen
 regions of several chromosomes in the Pacific oyster Crassostrea gigas (Clabby et al. 1996, Wang et al. 2001). The vertebrate telomere repeat, [(TTAGGG).sub.n], has been located to telomeres of three Crassostrea oysters C. gigas, C. virginica and C. rhizophorae (Guo & Allen 1997, Wang & Guo 2001). Major ribosomal RNA (18S-5.8S-28S) genes have been assigned to the chromosomes of 6 Crassostrea oysters: C. gigas, C. virginica, C. ariakensis, C. rhizophorae, C. plicatula and C. angulata (Zhang et al. 1999, Xu et al. 2001, Cross et al. 2003, Wang et al. 2004). Chromosome specific FISH probes have been developed from Pl-clones for some chromosomes (Wang et al. 2005).

Major rRNA genes and minor (5S) rRNA genes are two families of ribosomal RNA genes in higher eukaryotes. 5S ribosomal RNA is the smallest RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 component of the ribosome ribosome: see cell; nucleic acid.
ribosome

Tiny particle, the site of protein synthesis, that is present in large numbers in living cells. They occur both as free particles within cells and, in eukaryotes, as particles attached to the membranes of
. Both genes are organized into clusters of tandem repeats with up to hundreds or thousands of units (Martins & Galetti 2001). Because of its high copy number, 5S rRNA genes can be easily detected by FISH and used for chromosome identification and phylogenetic comparisons (Insua et al. 2001, Liu et al. 2002, Fontana et al. 2003). The chromosomal location of 5S rRNA genes is usually independent from the sites of the major rRNA genes in most organisms with a few exceptions (Liu et al. 2002). In the eastern oyster, major rRNA genes have been assigned to the telomeric region of long arms of chromosome 2 (Xu et al. 2001). However, no information is available about the chromosomal location of 5S rRNA genes in oysters. This study reports the successful mapping of the 5S rRNA genes to chromosomes 5 and 6 in the eastern oyster.

MATERIALS AND METHODS

Chromosome Preparation

The eastern oysters used in this study were from a hatchery hatchery

a commercial establishment dedicated to the hatching of bird eggs to provide day old chicks and poults to the poultry industry.


hatchery liquid
the contents of unfertilized eggs. Used in petfood manufacture.
 stock maintained at Rutgers University. Metaphase chromosomes were prepared from early embryos according to protocols in Guo and Allen (1997). Briefly, gametes were obtained from ripe oysters by stripping gonads. Eggs were passed through an 80-[micro]m nytex screen to remove the large tissue debris and rinsed on a 25-[micro]m nytex screen. Sperm were suspended in seawater after passing through a 25-[micro]m screen. Fertilization was performed by adding sperm to the eggs suspension at a final density of 6-8 sperm per egg. Embryos were cultured at 23[degrees]C to 25[degrees]C. At about 3-4 h postfertilization, embryos were collected into a 15-mL tube and treated with 0.005% colchicine colchicine (kŏl`chəsēn'), alkaloid extracted from plants of the genus Colchicum and especially from the corms of the autumn crocus, Colchicum autumnale (see meadow saffron).  for 12 min. The colchicine solution was removed by centrifugation Centrifugation

A mechanical method of separating immiscible liquids or solids from liquids by the application of centrifugal force. This force can be very great, and separations which proceed slowly by gravity can be speeded up enormously in centrifugal
, and embryos were treated with a hypotonic hypotonic /hy·po·ton·ic/ (-ton´ik)
1. denoting decreased tone or tension.

2. denoting a solution having less osmotic pressure than one with which it is compared.
 solution (0.075 M KCl) for 12 min. The hypotonic treatment was then replaced with the freshly prepared fixative fixative /fix·a·tive/ (fik´sit-iv) an agent used in preserving a histological or pathological specimen so as to maintain the normal structure of its constituent elements.

fix·a·tive
adj.
, 1:3 (v:v) acetic acid and methanol. The fixative was changed at least twice within an hour. The fixed samples were stored in the fixative at 4[degrees]C until use.

Chromosome spreads were prepared by loading the fixed cell suspension onto precleaned slides and air-dried under the hood under the hood - [hot-rodder talk] 1. The underlying implementation of a product (hardware, software, or idea). Implies that the implementation is not intuitively obvious from the appearance, but the speaker is about to enable the listener to grok it. . Slides were stored at 4[degrees]C before FISH analysis.

Probe Construction

A FISH probe was obtained by PCR amplification of the 5S ribosomal RNA genes and labeled with digoxigenin- 11-dUTP during PCR amplification. PCR primers for the 5S rRNA gene were designed using published sequence from the blue mussel Mytilus edulis (Genbank, accession number J01869; Fang et al. 1982). The primer sequences from 5' to 3' are: GTCTACGACCATATCACGTTGAAAA and TGTCTACAACACCCGGTATTCCC.

Genomic DNA of the eastern oyster was extracted from adductor muscle Noun 1. adductor muscle - a muscle that draws a body part toward the median line
adductor

skeletal muscle, striated muscle - a muscle that is connected at either or both ends to a bone and so move parts of the skeleton; a muscle that is characterized by
 by proteinase proteinase /pro·tein·ase/ (pro´ten-as?) endopeptidase.

pro·tein·ase
n.
A protease that begins the hydrolytic breakdown of proteins usually by splitting them into polypeptide chains.
 K digestion, according to the method described by Doyle and Doyle (1987). Each PCR reaction (25 [micro]l) contained 1.5 mM of Mg[Cl.sub.2], 0.2 mM each of dATP, dCTP, dGTP, 0.13 mM dTTP, 0.07 mM digoxigenin-11-dUTP, 0.63 U Taq DNA polymerase (Roche), 0.4 mg/mL BSA 1. BSA - Business Software Alliance.
2. BSA - Bidouilleurs Sans Argent.
, 1 [micro]M of each primer, 1 [micro]g of genomic DNA from the eastern oyster. The PCR reaction was performed in a DeltaCycler II System thermal cycler (ERICOMP Inc, San Diego, California “San Diego” redirects here. For other uses, see San Diego (disambiguation).
San Diego is a coastal Southern California city located in the southwestern corner of the continental United States. As of 2006, the city has a population of 1,256,951.
). Amplification was achieved using the following profile: an initial 5 min denaturing at 95[degrees]C; 35 cycles of 1 min denaturing at 95[degrees]C, 1 min annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  at 50[degrees]C and 1 min extension at 72[degrees]C; and a final extension at 72[degrees]C for 5 min, followed by holding at 4[degrees]C.

PCR products were analyzed using an aliquot aliquot (al-ee-kwoh) adj. a definite fractional share, usually applied when dividing and distributing a dead person's estate or trust assets. (See: share)  of the reaction (3 [micro]l) run on 2% (w:v) agarose gels. Gels were stained using 1 [micro]g/mL ethidium bromide in 1X TAE buffer (0.04 M Tris base, 0.1% acetic acid, 0.001 M EDTA EDTA: see chelating agents. , pH = 8.0). The labeled PCR products were purified with G-50 column (Fisher) before being used as FISH probes.

Fluorescence In situ Hybridization

FISH was carried out according to Guo and Allen (1997) with some modifications. Prior to FISH, slides were pretreated with 2x standard saline citrate citrate /cit·rate/ (sit´rat) a salt of citric acid.

citrate phosphate dextrose  (CPD) anticoagulant citrate phosphate dextrose solution.
 

(SSC SSC Secondary School Certificate
SSC Standard Systems Center (USAF)
SSC State Services Commission (New Zealand)
SSC Swedish Space Corporation
SSC Salem State College (Massachusetts) 
, 0.3 M sodium chloride, 0.03 M sodium citrate, pH 7.0) for 30 min at 37[degrees]C; dehydrated de·hy·drate  
v. de·hy·drat·ed, de·hy·drat·ing, de·hy·drates

v.tr.
1. To remove water from; make anhydrous.

2. To preserve by removing water from (vegetables, for example).
 in 70%, 80% and 95% ethanol for 2 min each, and air-dried. Slides were denatured de·na·ture  
tr.v. de·na·tured, de·na·tur·ing, de·na·tures
1. To change the nature or natural qualities of.

2.
 in 70% formamide in 2x SSC, pH 7.0 for 2 min at 72[degrees]C and then dehydrated in a series of cold ethanol (70%, 80% and 95%) and air-dried. The digoxigenin-labeled probe was mixed with 14 volumes of a formamide solution (65% in 2x SSC), denatured at 72[degrees]C for 5 min and chilled on ice for 5 min. The denatured probe was loaded onto denatured slides, covered with a glass coverslip coverslip /cov·er·slip/ (-slip) coverglass.

coverslip

see coverglass.
, and sealed with rubber cement. The slides were incubated overnight in a moist chamber at 37[degrees]C. Posthybridization washes were performed at a high stringency (5 min in 2x SSC at 72[degrees]C), followed by two 2-min washes in phosphate buffer detergent (PBD PBD - Programmer Brain Damage , 0.1 M Na[H.sub.2]P[O.sub.4], 0.4% BSA, 0.1% Tween-20, pH 7.4) at room temperature.

For detection, slides were stained with 10 [micro]l of fluorescein isothiocyanate (FITC FITC

fluorescein isothiocyanate; used as a fluorescent label for proteins, especially antibodies.
)-labeled antidigoxigenin antibodies (Ventana, Arizona) for 15 min at 37[degrees]C under the cover of plastic coverslips. Slides were rinsed three times with PBD buffer at room temperature for 2 min each. Amplification of the FISH signals was achieved by incubating two layers of antibodies at 37[degrees]C for 15 min, one is rabbit antisheep antibody I, and the other is FITC-labeled antirabbit antibody II. After incubation with each layer, the slides were washed three times with 1x PBD buffer for 3 min each. For counter-staining, 10 [micro]L of a propidium iodide (PI) solution (0.5[micro]g/ml) containing antifade (Ventana, Arizona) was added to each slide and covered with a glass coverslip. Slides were screened using a Nikon epi-fluorescence microscope equipped with PI (Nikon, G-2A) and FITC/PI bipass filters (Chroma Short for "chrominance." The attributes of a color, which include its hue (frequency) and saturation (amount of black). See hue and saturation. , #51005). FISH signals and karyotype were captured with a 3 CCD CCD
 in full charge-coupled device

Semiconductor device in which the individual semiconductor components are connected so that the electrical charge at the output of one device provides the input to the next device.
 digital camera and analyzed with the Image-Pro Plus 3.0 software.

Chromosomes were classified according to their centromeric index and arranged by decreasing size (Levan et al. 1964). Total length, relative length (100 x chromosome length/total haploid length) and centromeric index (length of short arm/total chromosome length) were calculated for each chromosome.

RESULTS

PCR amplification with 5S rRNA primers in C. virginica generated a single fragment of the expected size--about 120 bp (Fig. 1, Lane 2). After incorporation of digoxigenin-11-dUTP, the labeled fragment showed reduced mobility and shifted to ~200 bp (Fig. 1, lane 3), indicating the labeling was effective.

[FIGURE 1 OMITTED]

After hybridization with the 5S rRNA probe, 112 metaphase spreads were examined for specific FISH signals. Among the metaphases examined, 78 metaphases (or 70%) showed specific FISH signals, whereas the other 34 metaphases had no signals or signals that were apparently nonspecific nonspecific /non·spe·cif·ic/ (non?spi-sif´ik)
1. not due to any single known cause.

2. not directed against a particular agent, but rather having a general effect.


nonspecific

1.
. Specific signals were easily identified because they were strong and always appeared in doublets dou·blet  
n.
1. A close-fitting jacket, with or without sleeves, worn by European men between the 15th and 17th centuries.

2.
a. A pair of similar or identical things.

b. A member of such a pair.
 (i.e., present on both chromatids of the same chromosome). For metaphases with specific FISH signals, signals were most frequently found on four (or two pairs of) chromosomes (Fig. 2 A to C), suggesting that the 5S rRNA genes have two loci in C. virginica. Among the 78 metaphases with specific signals, 38 or about half had signals on four chromosomes. Deviation from four signals per metaphase was frequently observed, probably caused by random variations in FISH. Twenty metaphases had FISH signals on three chromosomes; 16 had signals on two chromosomes; and four had signals on one chromosome per metaphase.

[FIGURE 2 OMITTED]

To determine which chromosomes carry the 5S rRNA genes, 13 metaphases with clear and specific FISH signals were selected for measurements and karyotypic analysis. The karyotype of C. virginica consisted of one submetacentric (Chromosome 9) and nine metacentric chromosomes (Table 1). Among the 10 pairs of chromosomes, Chromosome 1, 2, 9 and 10 were easy to identify because of their length and arm ratio. Karyotypic analysis clearly indicated that the specific FISH signals were located on chromosomes 5 and 6 (Fig. 2 E). Both chromosomes were metacentric metacentric /meta·cen·tric/ (-sen´trik) having the centromere near the middle, so that the arms of the replicating chromosome are approximately equal in length.

met·a·cen·tric
adj.
 and similar in size. Chromosome 5 has a relative lower centromeric index (0.41) compared with chromosome 6 (0.47). On both chromosomes, FISH signals were located at an interstitial site on the short arm. On chromosome 5, the 5S rRNA genes were located immediately next to the centromere. On chromosome 6, the 5S rRNA genes were located approximately half way between the telomere and the centromere on the short arm (Fig. 2).

There was no apparent difference in the size or intensity of signals between chromosome 5 and 6. When FISH signals were missing, however, the missing FISH signals were more likely to be associated with chromosome 6 than chromosome 5 (Fig. 2 D). The distribution of FISH signals in all 112 metaphases screened is presented in Table 2. In 40 metaphases that FISH signals did not show up on all four chromosomes, 96 FISH signals were observed: 58 were on chromosome 5 and 38 on chromosome 6. The difference is significant (P = 0.041) according to the [chi square] test of independence. Another sign of the difference was that hybridization signals only appeared on chromosome 5 in 11.5% of the metaphases, compared with 6.5% of metaphases with signals on chromosome 6 only (Table 2). The number of FISH signals per nucleus was variable, which was expected because of varying stages of the cell-cycle and overlapping signals (Fig. 2A, B, D: nuclei). The major rRNA genes, which are often brightly stained by PI without FISH, were clearly observed on the telomeric region on the short arm of chromosome 2 (Fig. 2 C, arrow).

A P1 clones (P4801) was previously assigned to the long arm of chromosome 5, immediately next to the centromere (Wang et al. 2005). To verify the linkage between P4801 and the 5S genes, cohybridization of the two probes on the same metaphase was performed. The cohybridization signals were clearly observed on different arms of chromosome 5 (photo not shown), indicating that two were undoubtedly located on the same chromosome.

DISCUSSION

This study provides successful mapping of the 5S rRNA genes to chromosomes of C. virginica. Karyotypic analysis clearly demonstrates that the 5S rRNA genes have two loci in C. virginica: one on chromosome 5 and the other on chromosome 6. Although not all metaphases examined had FISH signals on two pairs of chromosomes, metaphases with signals on four chromosomes were the dominant form, and the 13 metaphases karyotyped showed unanimous assignment of 5S rRNA genes to chromosomes 5 and 6. The missing signals were probably caused by random failures in FISH because of factors such as insufficient denaturing of chromosomes or local variations in hybridization and detection conditions.

As far as we can determine, this is the first time that 5S rRNA genes are assigned to specific chromosomes in oysters. There is no comparable data in sibling species of Ostreidae. Available data from other bivalve bivalve, aquatic mollusk of the class Pelecypoda ("hatchet-foot") or Bivalvia, with a laterally compressed body and a shell consisting of two valves, or movable pieces, hinged by an elastic ligament.  groups suggest that the number and distribution of 5S rRNA loci are variable among different taxa taxa: see taxon. . In the queen scallop Aequipecten opercularis, the 5S rRNA genes were assigned to two interstitial sites on one metacentric pair (Insua et al. 1998). In 2 mussels, Mytilus galloprovincialis and M. edulis, the 5S rRNA genes were located at four loci on three pairs of chromosomes (Insua et al. 2001). In the cockle cockle, common name applied to the heart-shaped, jumping or leaping marine bivalve mollusks, belonging to the order Eulamellibranchia. The brittle shells are of uniform size, are obliquely spherical, and possess distinct radiating ridges, or ribs, which aid the  Cerastoderma edulef, on the other hand, the 5S rRNA genes were found at nine telomeric loci on five chromosomes pairs (Insua et al. 1999). Our study shows that 5S rRNA has two loci on two separate chromosomes in C. virginica. The number and distribution of 5S rRNA genes loci are expected to be different among species and are usually considered as species-specific characters (Fontana et al. 1999). It would be interesting to study and compare the number and distribution of 5S rRNA genes in oysters closely related to C. virginica. Previously, we have shown that the major rRNA-bearing chromosome provides a clear divide between Atlantic and Asian-Pacific species of Crassostrea (Wang et al. 2004).

The 5S and the major rRNA genes are located on different chromosomes in C. virginica. The latter was previously mapped to the telomeric region of chromosome 2 (Zhang et al. 1999, Xu et al. 2001), whereas this study assigned the 5S rRNA genes to chromosomes 5 and 6. The major rRNA locus was also observed on chromosome 2 in this study, because it was visible without FISH, confirming that two rRNA genes are not physically linked with each other. The separate locations of major and 5S rRNA genes were also observed in other bivalve species studied so far (Insua et al. 1998, 1999, 2001). In vertebrates, the major and 5S rRNA genes are rarely located on the same chromosome (Martins & Galetti 2001, Liu et al. 2002). In invertebrates, the two gene families are sometimes found on the same chromosome as it has been shown in the nematode nematode
 or roundworm

Any of more than 15,000 named and many more unnamed species of worms in the class Nematoda (phylum Aschelminthes). Nematodes include plant and animal parasites and free-living forms found in soil, freshwater, saltwater, and even vinegar
 Meloidogyne arenaria (Vahidi et al. 1991) and in the gastropod gastropod, member of the class Gastropoda, the largest and most successful class of mollusks (phylum Mollusca), containing over 35,000 living species and 15,000 fossil forms.  periwinkle periwinkle, in zoology
periwinkle, any of a group of marine gastropod mollusks having conical, spiral shells. Periwinkles feed on algae and seaweed.
 Melarhaphe neritoides (Colomba et al. 2002). Given that 5S and major rRNA genes are transcribed by different RNA polymerases (Martins & Galetti 2001), the different chromosomal location of two genes is not surprising. In some cases, the 5S rRNA genes were interspersed throughout the genome with other multicopy genes, such as histone genes, major rRNA genes or other repetitive sequences (Drouin & Moniz De Sa 1995).

FISH signals from the 5S rRNA probe were weak compared with the major rRNA genes. Our initial attempt to assign 5S rRNA genes without signal amplification failed to produce strong and specific FISH signals. It is only after two layers of signal amplification in this study that strong and specific FISH signals were obtained in about 70% of the metaphases. Even with signal amplification, FISH signals from the 5S rRNA probe were much weaker than signals from the major RNA genes, which are consistently observed in over 90% metaphase without signal amplification (Wang et al. 2004). The difference in signal strength may be caused by differences in probe size and quality, or the size of the targeted repeats.

Despite the need for signal amplification, results of this study clearly demonstrate that the 5S rRNA gene can be successfully used for chromosome identification in C. virginica and possibly in all oyster species. FISH with the 5S gene probe easily distinguishes chromosome 5 and 6 from other chromosomes of C. virginica, and it also provides clear and unambiguous separation of chromosome 5 from chromosome 6, based on differences in the chromosomal position of the 5S rRNA locus (immediately next to the centromere on chromosome 5).

Although chromosome identification is essential in chromosomal mapping and studies on aneuploidy and chromosomal rearrangements, it remains a major challenge in oysters and other marine molluscs because traditional karyotyping cannot distinguish all oyster chromosomes. Several karyotypes have been described for the eastern oyster, and the karyotypes varied considerably among reports. The karyotype reported here is similar to these described by Xu et al. (2001) and Wang et al. (2005), but differs from that of Longwell et al. (1967). Such a variation reflects the limits of traditional karyotyping. The application of FISH has led to considerable optimism and progress in the identification of oyster chromosomes (Clabby et al. 1996, Guo & Allen 1997, Zhang et al. 1999, Xu et al. 2001, Wang & Guo 2001, Cross et al. 2003, Wang et al. 2001, 2004, 2005). Still, the chromosome coverage in C. virginica is not yet complete, and more chromosome-specific probes are needed for chromosome identification. This study adds the 5S rRNA gene to the list of available chromosome-specific FISH probes in C. virginica, which may prove to be useful for comparative analysis of karyotypes in Ostreidae.

ACKNOWLEDGMENT

This study is supported by grants from the United States Sea Grant (B/T-9801; R/OD-2003-1), US Department of Agriculture (96-35205-3854), New Jersey Commission on Science and Technology (02-2042-007-11) and China's National Science Foundation (39825121) and 863 Program (2001AA628150). This is publication IMCS-2005-10 and NJMSC-05-606.

LITERATURE CITED

Clabby, C., U. Goswami, F. Flavin flavin: see coenzyme.
flavin

Any of a class of organic compounds, pale yellow biological pigments that fluoresce green. They occur in compounds essential to life as coenzymes in metabolism.
, N.P. Wilkins, J.A. Houghton & R. Powell. 1996. Cloning, characterization and chromosomal location of a satellite DNA from the Pacific oyster, Crassostrea gigas. Gene 168:205-209.

Colomba, M. S., R. Vitturi, L. Castriota, R. Bertoni & A. Libertini. 2002. FISH mapping of 18S-28S and 5S ribosomal DNA, [(GATA GATA Gold Anti-Trust Action Committee (International Financial Advocacy Organization)
GATA Georgia Academic Team Association
GATA Gülhane Askerý Tip Akademýsý
GATA Get At Their Asses
).sub.n] and (TTAGGG), telomeric repeats in the periwinkle Melarhaphe neritoides (Prosobranchia, Gastropoda, Caenogastropoda). Heredity 88:381-384.

Cross, I., L. Vega & L. Rebordinos. 2003. Nucleolar nucleolar

pertaining to or emanating from nucleolus.
 organizing regions in Crassostrea angulata: chromosomal location and polymorphism. Genetica 119:65-74.

Doyle, J.J. & J. L. Doyle. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19:11-15.

Drouin, G. & M. Moniz De Sa 1995. The concerted evolution of 5S ribosomal genes linked to the repeat units of other multigene families. Mol. Biol. Evol. 12:481-493.

Fang, B.L., R.D. Baere, A. V. d. Berghe & R. D. Wachter. 1982. Sequences of three molluscan mol·lus·can also mol·lus·kan  
adj.
Of or relating to the mollusks.

n.
A mollusk.
 5S ribosomal RNAs confirm the validity of a dynamic secondary structure model. Nucleic Acids Res. 10:4679-4685.

Fontana, F., M. Lanfredi, M. Chicca, L. Congiu, J. Tagliavini & R. Rossi. 1999. Fluorescence in situ hybridization with rDNA probes on chromosomes of Acipenser ruthenus and Acipenser naccarii (Osteichthyes Acipenseriforms). Genome 42:1008-1012.

Fontana, F., M. Lanfredi, L. Congiu, M. Leis, M. Chicca & R. Rossi. 2003. Chromosomal mapping of 18S-28S and 5S rRNA genes by two-color fluorescent in situ hybridization in situ hybridization A method for localizing a sequence of DNA, mRNA, or protein in a cell or tissue; the use of a DNA or RNA probe to detect a cDNA sequence in chromosome spreads or in interphase nuclei or an RNA sequence of cloned bacterial or cultured  in six sturgeon species. Genome 46: 473-477.

Guo, X. 2004. Oyster breeding and the use of biotechnology. Bull. Aquacult. Assoc. Canada 104:26-33.

Guo, X. & S. K. Allen, Jr. 1997. Fluorescence in situ hybridization of the vertebrate telomere sequence to chromosome ends of the Pacific oyster, Crassostrea gigas Thunberg. J. Shellfish Res. 16:87-89.

Insua, A., R. Freire, J. Rios & J. Mendez. 2001. The 5S rDNA of mussels Mytilus galloprovincialis and M. edulis: sequence variation and chromosomal location. Chromosome Res. 9:495-505.

Insua, A., M.J. Lopez-Pinon & J. Mendez. 1998. Characterization of Aequipecten opercularis (Bivalvia: Pectinidae) chromosomes by different staining techniques and fluorescent in situ hybridization. Genes Genet genet: see civet. . Syst. 73:193-200.

Insua, A., R. Freire & J. Mendez. 1999. The 5S rDNA of the bivalve Cerastoderma edule: nucleotide sequence of the repeat unit and chromosomal location relative to 18S-28S rDNA. Genet. Sel. Evol. (Paris) 31:509-518.

Lapegue, S., I. Boutet, A. Leitao, S. Heurtebise, P. Garcia, C. Thiriot-Quievreux & P. Boudry. 2002. Trans-Atlantic distribution of a mangrove mangrove, large tropical evergreen tree, genus Rhizophora, that grows on muddy tidal flats and along protected ocean shorelines. Mangroves are most abundant in tropical Asia, Africa, and the islands of the SW Pacific.  oyster species revealed by 16S mtDNA and karyological analysis. Biol. Bull. 202:232-242.

Leitao, A., P. Boudry, J. Labat & C. Thiriot-Quievreux. 1999b. Comparative karyological study of cupped oyster species. Malacologia 41:175-186.

Leitao, A., C. Thiriot-Quievreux, P. Boudry & I. Malheiro. 1999a. A "G" chromosome banding study of three cupped oyster species: Crassostrea gigas, Crassostrea angulata and Crassostrea virginica (Mollusca: Bivavia). Genet. Sel. Evol. 31:519-527.

Levan, A., D. Fredga & A. A. Sandberg. 1964. Nomenclature for centromeric position on chromosomes. Hereditas 52:201-220.

Liu, Z., D. Zhang, D. Hong & X. Wang. 2002. Chromosomal localization Customizing software and documentation for a particular country. It includes the translation of menus and messages into the native spoken language as well as changes in the user interface to accommodate different alphabets and culture. See internationalization and l10n.  of 5S and 18S-5.8S-25S ribosomal DNA sites in five Asian pines using fluorescence in situ hybridization. Theor. Appl. Genet. 122:1007-1024.

Longwell, A. C., S. S. Stiles Stiles can refer to: People
  • Bert Stiles, short story writer
  • Charles Wardell Stiles, American zoologist
  • Edgar Stiles, character on the popular drama 24
  • Ezra Stiles, president of Yale College
  • Innis Stiles, singer, musician
 & D. G. Smith. 1967. Chromosome complement of the American oyster Crassostrea virginica, as seen in meiotic meiotic

pertaining to meiosis.
 and cleaving eggs. Can. J. Genet. Cytol. 9:845-858.

MacKenzie, C. L., Jr. 1996. History of oystering in the United States and Canada, featuring the eight greatest oyster estuaries. Mar. Fish. Rev. 58:1-78.

Martins, C. & P. M. J. Galetti. 2001. Two 5S rDNA arrays in neotropical fish species: Is it a general rule for fishes? Genetica 111:439-446.

Rodriguez-Romero, F., A. Laguarda-Figueras, M. Uribe-Alcocer & M. L. Rojas-Lara. 1979. Distribution of "G" bands in the karyotype of Crassostrea virginica. Venus Jpn. J. Malacol. 38:180-184.

Swiger, R. R. & J. D. Tucker. 1996. Fluorescence in situ hybridization: a brief review. Environ. Mol. Mutagen mutagen: see mutation.
mutagen

Any agent capable of altering a cell's genetic makeup by changing the structure of the hereditary material, DNA. Many forms of electromagnetic radiation (e.g.
. 27:245-254.

Thiriot-Quievreux, C. & A. Insua. 1992. Nucleolar organizer region variation in the chromosomes of three oyster species. J. Exp. Mar. Biol. Ecol. 157:33-40.

Vahidi, H., A. Purac, J. M. Leblanc & B. M. Honda. 1991. Characterization of potentially functional 5S rRNA-encoding genes within ribosomal DNA repeats of the nematode Meloidogyne arenaria. Gene 108:281-284.

Wang, Y. & X. Guo. 2001. Chromosomal mapping of the vertebrate telomeric sequence (TTAGGG)n in four bivalve molluscs by fluorescence in situ hybridization. J. Shellfish Res. 20:1187-1190.

Wang, Y., Z. Xu & X. Guo. 2001. A centromeric satellite sequence in the Pacific oyster (Crassostrea gigas Thunberg) identified by fluorescence in situ hybridization. Mar. Biotechnol. 3:486-492.

Wang, Y., Z. Xu & X. Guo. 2004. Differences in the rDNA-bearing chromosome divide the Asian-Pacific and Atlantic species of Crassostrea (Bivalvia, Mollusca). Biol. Bull 206:46-54.

Wang, Y., Z. Xu, J. C. Pierce & X. Guo. 2005. Characterization of eastern oyster (Crassostrea virginica Gmelin) chromosomes by fluorescence in situ hybridization with bacteriophage P1 clones. Mar. Biotechnol. 7: 207-214.

Xu, Z., X. Guo, P. M. Gaffney & J. C. Pierce. 2001. Chromosomal location of the major ribosomal RNA genes in Crassostrea virginica and Crassostrea gigas. Veliger ve·li·ger  
n.
A larval stage of a mollusk characterized by the presence of a velum.



[New Latin v
 44:79-83.

Zhang, Q. Y., G. Yu, R. K. Cooper & T. R. Tiersch. 1999. Chromosomal location by fluorescence in situ hybridization of the 28S ribosomal RNA gene of the eastern oyster. J. Shellfish Res. 18:431-435.

YONGPING WANG, (1,2) ZHE ZHE Zero-Headspace Extractor
ZHE Zero-Headspace Extraction
 XU (1) AND XIMING GUO (1) *

(1) Haskin Shellfish Research Laboratory, Institute of Marine and Coastal Sciences The Institute of Marine and Coastal Sciences (IMCS) focuses on marine science-related education and research. IMCS was founded in 1993 on the Cook Campus at Rutgers University in New Brunswick, New Jersey. , Rutgers University, 6959 Miller Avenue, Port Norris, New Jersey Port Norris is a census-designated place and unincorporated area located within Commercial Township, in Cumberland County, New Jersey. It is part of the Vineland-Millville- Bridgeton Primary Metropolitan Statistical Area for statistical purposes. , 08349; (2) Experimental Marine Biology Laboratory, Institute of Oceanology, Chinese Academy of Sciences The Chinese Academy of Sciences (CAS) (Simplified Chinese: 中国科学院; Pinyin: Zhōngguó Kēxuéyuàn), formerly known as Academia Sinica , 7 Nanhai Road, Qingdao, Shandong 266071, People's Republic of China

* Corresponding author. E-mail: xguo@hsrl.rutgers.edu
TABLE 1.
Karyotype analysis of Crassostrea virginica chromosomes. Data were
from 13 metaphase arranged according to the relative length (RL)
and centromere index (CI).

Chromosome   Relative Length (1)   Centromeric Index (2)
   No.          ([+ or -] SD)          ([+ or -] SD)

    1        12.11 [+ or -] 0.33   0.48 [+ or -] 0.01
    2        11.40 [+ or -] 0.53   0.39 [+ or -] 0.01
    3        10.93 [+ or -] 0.28   0.41 [+ or -] 0.01
    4        10.77 [+ or -] 0.42   0.47 [+ or -] 0.01
    5        10.06 [+ or -] 0.38   0.40 [+ or -] 0.01
    6         9.98 [+ or -] 0.42   0.47 [+ or -] 0.01
    7         9.67 [+ or -] 0.29   0.40 [+ or -] 0.01
    8         8.92 [+ or -] 0.48   0.40 [+ or -] 0.01
    9         8.49 [+ or -] 0.37   0.35 [+ or -] 0.02
    10        7.67 [+ or -] 0.51   0.47 [+ or -] 0.01

Chromosome
   No.       Classification (3)

    1                 M
    2                 M
    3                 M
    4                 M
    5                 M
    6                 M
    7                 M
    8                 M
    9                SM
    10                M

(1) Relative length of each chromosome as percent total
length of the haploid complement.

(2) CI, length of short arm divided by total length.

(3) M = metacentric; SM = submetacentric.

TABLE 2.
The distribution FISH signals of 5S rRNA genes on the
chromosomes of Crassostrea virginica.

             Signal Location

Signal per   Chromo-   Chromo-     No. of     Frequency
Metaphase    some 5    some 6    Metaphases      (%)

    4           2         2          38         48.7
    3           2         1          17         21.8
    3           1         2           3          3.8
    2           2         0           6          7.7
    2           1         1           6          7.7
    2           0         2           4          5.2
    1           1         0           3          3.8
    1           0         1           1          1.3
    0           0         0          34         31.4
COPYRIGHT 2005 National Shellfisheries Association, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2005, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Ximing, Guo
Publication:Journal of Shellfish Research
Date:Dec 1, 2005
Words:4633
Previous Article:Spawning of king scallops, Pecten maximus (L.) in Mulroy Bay and the relationship with spatfall intensity.
Next Article:Recreational boating activity and its impact on the recruitment and survival of the oyster Crassostrea virginica on intertidal reefs in Mosquito...
Topics:



Related Articles
Condition index of the Eastern Oyster, Crassostrea virginica (Gmelin, 1791) in Sapelo Island Georgia--effects of site, position on bed and pea crab...
The case for sequencing the Pacific oyster genome.
Naturalized populations of oysters, Crassostrea gigas along the South African coast: distribution, abundance and population structure.
Seasonal variations on the biochemical composition and lipid classes of the gonadal and storage tissues of Crassostrea gigas (Thunberg, 1794) in...
Characterization of phenoloxidase from Crassostrea virginica hemocytes and the effect of Perkinsus marinus on phenoloxidase activity in the hemolymph...
Immunomodulation of Crassostrea gigas and Crassostrea virginica cellular defense mechanisms by Perkinsus marinus.
An AFLP approach to identify genetic markers associated with resistance to vibrio vulnificus and Perkinsus marinus in eastern oysters.(arbitrary...
Effect of homogenate from different oyster species on Perkinsus marinus proliferation and subtilisin gene transcription.
Apoptosis of the protozoan oyster pathogen Perkinsus marinus in vivo and in vitro in the Chesapeake Bay and the Long Island Sound.
Haplosporidium nelsoni (MSX) rDNA detected in oysters from the Gulf of Mexico and the Caribbean Sea.

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles