Chromosomal mapping of 5S ribosomal RNA genes in the eastern oyster, Crassostrea virginica Gmelin by fluorescence in situ hybridization.

ABSTRACT Chromosomal location of the 5S ribosomal RNA gene was studied in the eastern oyster, Crassostrea virginica Gmelin, using fluorescence in situ hybridization (FISH). Metaphase chromosomes were obtained from early embryos, and the FISH probe was made by PCR (polymerase chain reaction) amplification of the 5S rRNA gene and labeled by incorporation of digoxigenin-11-dUTP during PCR. Hybridization was detected with fluorescein-labeled antidigoxigenin antibodies. Two pairs of FISH signals were observed on metaphase chromosomes. Karyotypic analysis showed that the 5S rRNA gene cluster is interstitially located on short arms of chromosomes 5 and 6. On chromosome 5, the 5S rRNA genes were located immediately next to the centromere, whereas on chromosome 6, they were located approximately half way between the telomere and the centromere. Chromosomes of C. virginica are difficult to identify because of their similarities in size and arm ratio, and the chromosomal location of 5S rRNA genes provides unambiguous identification of chromosomes 5 and 6. Previous studies have mapped the major rRNA gene cluster (18S-5.8S-28S) to chromosome 2, and this study shows that the 5S rRNA gene cluster is not linked to the major rRNA genes and duplicated during evolution.

KEY WORDS: FISH, chromosome identification, 5S ribosomal RNA genes, Crassostrea virginica

INTRODUCTION

The eastern oyster (Crassostrea virginica Gmelin) is an important fishery and aquaculture species of the United States. It is also a keystone species in the ecology of many estuaries along the Atlantic and Gulf Coasts. Eastern oyster populations along much of the Atlantic Coast have been in decline because of over-fishing, habitat destruction and diseases (MacKenzie 1996). Aquaculture production is limited by diseases and the lack of superior stocks. Domestication and broodstock development through traditional selective breeding have been slow, and the application of molecular biotechnology depends on accurate and sophisticated knowledge about the oyster genome (Guo 2004). Unfortunately, the genome of the eastern oyster is poorly understood at this time including its most basic units--chromosomes. The characterization and identification of chromosomes are essential for several types of genomic research including physical mapping of genes to chromosomes and studies on aneuploidy.

The eastern oyster has a haploid number of 10 chromosomes (Longwell et al. 1967). Despite the low haploid number, chromosome identification in the eastern oyster remains a challenge because the chromosomes are small in size and similar in arm ratio. Chromosome identification by karyotyping and traditional banding has been difficult. Traditional banding techniques, such as G-banding and C-banding, have been studied in three Crassostrea species including C. virginica (Rodriguez-Romero et al. 1979, Leitao et al. 1999a), but the reproducibility was low and banding characteristics were not clear and stable enough for routine chromosome identification. Nucleolar organizer regions (NORs) have been investigated with silver staining in 7 Crassostrea species: C. gigas (Thiriot-Quievreux & Insua 1992, Leitao et al. 1999b), C. virginica and C. ariakensis, C. sikamea, C. gasar (Leitao et al. 1999b), C. rhizophorae (Lapegue et al. 2002) and C. angulata (Cross et al. 2003). Whereas silver staining is helpful in identifying some chromosomes, the number and location of active NORs can vary within species.

Recently, fluorescence in situ hybridization (FISH), has been applied to oyster cytogenetics, providing new opportunities for chromosome identification. By directly hybridizing DNA fragments to their homologous targets on chromosomes, FISH may produce specific and reproducible identification of chromosomes. FISH offers a powerful tool not only for chromosome identification but also for a range of genomic analyses, including the chromosomal mapping of genes (Swiger & Tucker 1996). Using FISH, a repetitive element has been mapped to centromeric regions of several chromosomes in the Pacific oyster Crassostrea gigas (Clabby et al. 1996, Wang et al. 2001). The vertebrate telomere repeat, [(TTAGGG).sub.n], has been located to telomeres of three Crassostrea oysters C. gigas, C. virginica and C. rhizophorae (Guo & Allen 1997, Wang & Guo 2001). Major ribosomal RNA (18S-5.8S-28S) genes have been assigned to the chromosomes of 6 Crassostrea oysters: C. gigas, C. virginica, C. ariakensis, C. rhizophorae, C. plicatula and C. angulata (Zhang et al. 1999, Xu et al. 2001, Cross et al. 2003, Wang et al. 2004). Chromosome specific FISH probes have been developed from Pl-clones for some chromosomes (Wang et al. 2005).

Major rRNA genes and minor (5S) rRNA genes are two families of ribosomal RNA genes in higher eukaryotes. 5S ribosomal RNA is the smallest RNA component of the ribosome. Both genes are organized into clusters of tandem repeats with up to hundreds or thousands of units (Martins & Galetti 2001). Because of its high copy number, 5S rRNA genes can be easily detected by FISH and used for chromosome identification and phylogenetic comparisons (Insua et al. 2001, Liu et al. 2002, Fontana et al. 2003). The chromosomal location of 5S rRNA genes is usually independent from the sites of the major rRNA genes in most organisms with a few exceptions (Liu et al. 2002). In the eastern oyster, major rRNA genes have been assigned to the telomeric region of long arms of chromosome 2 (Xu et al. 2001). However, no information is available about the chromosomal location of 5S rRNA genes in oysters. This study reports the successful mapping of the 5S rRNA genes to chromosomes 5 and 6 in the eastern oyster.

MATERIALS AND METHODS

Chromosome Preparation

The eastern oysters used in this study were from a hatchery stock maintained at Rutgers University. Metaphase chromosomes were prepared from early embryos according to protocols in Guo and Allen (1997). Briefly, gametes were obtained from ripe oysters by stripping gonads. Eggs were passed through an 80-[micro]m nytex screen to remove the large tissue debris and rinsed on a 25-[micro]m nytex screen. Sperm were suspended in seawater after passing through a 25-[micro]m screen. Fertilization was performed by adding sperm to the eggs suspension at a final density of 6-8 sperm per egg. Embryos were cultured at 23[degrees]C to 25[degrees]C. At about 3-4 h postfertilization, embryos were collected into a 15-mL tube and treated with 0.005% colchicine for 12 min. The colchicine solution was removed by centrifugation, and embryos were treated with a hypotonic solution (0.075 M KCl) for 12 min. The hypotonic treatment was then replaced with the freshly prepared fixative, 1:3 (v:v) acetic acid and methanol. The fixative was changed at least twice within an hour. The fixed samples were stored in the fixative at 4[degrees]C until use.

Chromosome spreads were prepared by loading the fixed cell suspension onto precleaned slides and air-dried under the hood. Slides were stored at 4[degrees]C before FISH analysis.

Probe Construction

A FISH probe was obtained by PCR amplification of the 5S ribosomal RNA genes and labeled with digoxigenin- 11-dUTP during PCR amplification. PCR primers for the 5S rRNA gene were designed using published sequence from the blue mussel Mytilus edulis (Genbank, accession number J01869; Fang et al. 1982). The primer sequences from 5' to 3' are: GTCTACGACCATATCACGTTGAAAA and TGTCTACAACACCCGGTATTCCC.

Genomic DNA of the eastern oyster was extracted from adductor muscle by proteinase K digestion, according to the method described by Doyle and Doyle (1987). Each PCR reaction (25 [micro]l) contained 1.5 mM of Mg[Cl.sub.2], 0.2 mM each of dATP, dCTP, dGTP, 0.13 mM dTTP, 0.07 mM digoxigenin-11-dUTP, 0.63 U Taq DNA polymerase (Roche), 0.4 mg/mL BSA, 1 [micro]M of each primer, 1 [micro]g of genomic DNA from the eastern oyster. The PCR reaction was performed in a DeltaCycler II System thermal cycler (ERICOMP Inc, San Diego, California). Amplification was achieved using the following profile: an initial 5 min denaturing at 95[degrees]C; 35 cycles of 1 min denaturing at 95[degrees]C, 1 min annealing at 50[degrees]C and 1 min extension at 72[degrees]C; and a final extension at 72[degrees]C for 5 min, followed by holding at 4[degrees]C.

PCR products were analyzed using an aliquot of the reaction (3 [micro]l) run on 2% (w:v) agarose gels. Gels were stained using 1 [micro]g/mL ethidium bromide in 1X TAE buffer (0.04 M Tris base, 0.1% acetic acid, 0.001 M EDTA, pH = 8.0). The labeled PCR products were purified with G-50 column (Fisher) before being used as FISH probes.

Fluorescence In situ Hybridization

FISH was carried out according to Guo and Allen (1997) with some modifications. Prior to FISH, slides were pretreated with 2x standard saline citrate 

(SSC, 0.3 M sodium chloride, 0.03 M sodium citrate, pH 7.0) for 30 min at 37[degrees]C; dehydrated in 70%, 80% and 95% ethanol for 2 min each, and air-dried. Slides were denatured in 70% formamide in 2x SSC, pH 7.0 for 2 min at 72[degrees]C and then dehydrated in a series of cold ethanol (70%, 80% and 95%) and air-dried. The digoxigenin-labeled probe was mixed with 14 volumes of a formamide solution (65% in 2x SSC), denatured at 72[degrees]C for 5 min and chilled on ice for 5 min. The denatured probe was loaded onto denatured slides, covered with a glass coverslip, and sealed with rubber cement. The slides were incubated overnight in a moist chamber at 37[degrees]C. Posthybridization washes were performed at a high stringency (5 min in 2x SSC at 72[degrees]C), followed by two 2-min washes in phosphate buffer detergent (PBD, 0.1 M Na[H.sub.2]P[O.sub.4], 0.4% BSA, 0.1% Tween-20, pH 7.4) at room temperature.

For detection, slides were stained with 10 [micro]l of fluorescein isothiocyanate (FITC)-labeled antidigoxigenin antibodies (Ventana, Arizona) for 15 min at 37[degrees]C under the cover of plastic coverslips. Slides were rinsed three times with PBD buffer at room temperature for 2 min each. Amplification of the FISH signals was achieved by incubating two layers of antibodies at 37[degrees]C for 15 min, one is rabbit antisheep antibody I, and the other is FITC-labeled antirabbit antibody II. After incubation with each layer, the slides were washed three times with 1x PBD buffer for 3 min each. For counter-staining, 10 [micro]L of a propidium iodide (PI) solution (0.5[micro]g/ml) containing antifade (Ventana, Arizona) was added to each slide and covered with a glass coverslip. Slides were screened using a Nikon epi-fluorescence microscope equipped with PI (Nikon, G-2A) and FITC/PI bipass filters (Chroma, #51005). FISH signals and karyotype were captured with a 3 CCD digital camera and analyzed with the Image-Pro Plus 3.0 software.

Chromosomes were classified according to their centromeric index and arranged by decreasing size (Levan et al. 1964). Total length, relative length (100 x chromosome length/total haploid length) and centromeric index (length of short arm/total chromosome length) were calculated for each chromosome.

RESULTS

PCR amplification with 5S rRNA primers in C. virginica generated a single fragment of the expected size--about 120 bp (Fig. 1, Lane 2). After incorporation of digoxigenin-11-dUTP, the labeled fragment showed reduced mobility and shifted to ~200 bp (Fig. 1, lane 3), indicating the labeling was effective.

[FIGURE 1 OMITTED]

After hybridization with the 5S rRNA probe, 112 metaphase spreads were examined for specific FISH signals. Among the metaphases examined, 78 metaphases (or 70%) showed specific FISH signals, whereas the other 34 metaphases had no signals or signals that were apparently nonspecific. Specific signals were easily identified because they were strong and always appeared in doublets (i.e., present on both chromatids of the same chromosome). For metaphases with specific FISH signals, signals were most frequently found on four (or two pairs of) chromosomes (Fig. 2 A to C), suggesting that the 5S rRNA genes have two loci in C. virginica. Among the 78 metaphases with specific signals, 38 or about half had signals on four chromosomes. Deviation from four signals per metaphase was frequently observed, probably caused by random variations in FISH. Twenty metaphases had FISH signals on three chromosomes; 16 had signals on two chromosomes; and four had signals on one chromosome per metaphase.

[FIGURE 2 OMITTED]

To determine which chromosomes carry the 5S rRNA genes, 13 metaphases with clear and specific FISH signals were selected for measurements and karyotypic analysis. The karyotype of C. virginica consisted of one submetacentric (Chromosome 9) and nine metacentric chromosomes (Table 1). Among the 10 pairs of chromosomes, Chromosome 1, 2, 9 and 10 were easy to identify because of their length and arm ratio. Karyotypic analysis clearly indicated that the specific FISH signals were located on chromosomes 5 and 6 (Fig. 2 E). Both chromosomes were metacentric and similar in size. Chromosome 5 has a relative lower centromeric index (0.41) compared with chromosome 6 (0.47). On both chromosomes, FISH signals were located at an interstitial site on the short arm. On chromosome 5, the 5S rRNA genes were located immediately next to the centromere. On chromosome 6, the 5S rRNA genes were located approximately half way between the telomere and the centromere on the short arm (Fig. 2).

There was no apparent difference in the size or intensity of signals between chromosome 5 and 6. When FISH signals were missing, however, the missing FISH signals were more likely to be associated with chromosome 6 than chromosome 5 (Fig. 2 D). The distribution of FISH signals in all 112 metaphases screened is presented in Table 2. In 40 metaphases that FISH signals did not show up on all four chromosomes, 96 FISH signals were observed: 58 were on chromosome 5 and 38 on chromosome 6. The difference is significant (P = 0.041) according to the [chi square] test of independence. Another sign of the difference was that hybridization signals only appeared on chromosome 5 in 11.5% of the metaphases, compared with 6.5% of metaphases with signals on chromosome 6 only (Table 2). The number of FISH signals per nucleus was variable, which was expected because of varying stages of the cell-cycle and overlapping signals (Fig. 2A, B, D: nuclei). The major rRNA genes, which are often brightly stained by PI without FISH, were clearly observed on the telomeric region on the short arm of chromosome 2 (Fig. 2 C, arrow).

A P1 clones (P4801) was previously assigned to the long arm of chromosome 5, immediately next to the centromere (Wang et al. 2005). To verify the linkage between P4801 and the 5S genes, cohybridization of the two probes on the same metaphase was performed. The cohybridization signals were clearly observed on different arms of chromosome 5 (photo not shown), indicating that two were undoubtedly located on the same chromosome.

DISCUSSION

This study provides successful mapping of the 5S rRNA genes to chromosomes of C. virginica. Karyotypic analysis clearly demonstrates that the 5S rRNA genes have two loci in C. virginica: one on chromosome 5 and the other on chromosome 6. Although not all metaphases examined had FISH signals on two pairs of chromosomes, metaphases with signals on four chromosomes were the dominant form, and the 13 metaphases karyotyped showed unanimous assignment of 5S rRNA genes to chromosomes 5 and 6. The missing signals were probably caused by random failures in FISH because of factors such as insufficient denaturing of chromosomes or local variations in hybridization and detection conditions.

As far as we can determine, this is the first time that 5S rRNA genes are assigned to specific chromosomes in oysters. There is no comparable data in sibling species of Ostreidae. Available data from other bivalve groups suggest that the number and distribution of 5S rRNA loci are variable among different taxa. In the queen scallop Aequipecten opercularis, the 5S rRNA genes were assigned to two interstitial sites on one metacentric pair (Insua et al. 1998). In 2 mussels, Mytilus galloprovincialis and M. edulis, the 5S rRNA genes were located at four loci on three pairs of chromosomes (Insua et al. 2001). In the cockle Cerastoderma edulef, on the other hand, the 5S rRNA genes were found at nine telomeric loci on five chromosomes pairs (Insua et al. 1999). Our study shows that 5S rRNA has two loci on two separate chromosomes in C. virginica. The number and distribution of 5S rRNA genes loci are expected to be different among species and are usually considered as species-specific characters (Fontana et al. 1999). It would be interesting to study and compare the number and distribution of 5S rRNA genes in oysters closely related to C. virginica. Previously, we have shown that the major rRNA-bearing chromosome provides a clear divide between Atlantic and Asian-Pacific species of Crassostrea (Wang et al. 2004).

The 5S and the major rRNA genes are located on different chromosomes in C. virginica. The latter was previously mapped to the telomeric region of chromosome 2 (Zhang et al. 1999, Xu et al. 2001), whereas this study assigned the 5S rRNA genes to chromosomes 5 and 6. The major rRNA locus was also observed on chromosome 2 in this study, because it was visible without FISH, confirming that two rRNA genes are not physically linked with each other. The separate locations of major and 5S rRNA genes were also observed in other bivalve species studied so far (Insua et al. 1998, 1999, 2001). In vertebrates, the major and 5S rRNA genes are rarely located on the same chromosome (Martins & Galetti 2001, Liu et al. 2002). In invertebrates, the two gene families are sometimes found on the same chromosome as it has been shown in the nematode Meloidogyne arenaria (Vahidi et al. 1991) and in the gastropod periwinkle Melarhaphe neritoides (Colomba et al. 2002). Given that 5S and major rRNA genes are transcribed by different RNA polymerases (Martins & Galetti 2001), the different chromosomal location of two genes is not surprising. In some cases, the 5S rRNA genes were interspersed throughout the genome with other multicopy genes, such as histone genes, major rRNA genes or other repetitive sequences (Drouin & Moniz De Sa 1995).

FISH signals from the 5S rRNA probe were weak compared with the major rRNA genes. Our initial attempt to assign 5S rRNA genes without signal amplification failed to produce strong and specific FISH signals. It is only after two layers of signal amplification in this study that strong and specific FISH signals were obtained in about 70% of the metaphases. Even with signal amplification, FISH signals from the 5S rRNA probe were much weaker than signals from the major RNA genes, which are consistently observed in over 90% metaphase without signal amplification (Wang et al. 2004). The difference in signal strength may be caused by differences in probe size and quality, or the size of the targeted repeats.

Despite the need for signal amplification, results of this study clearly demonstrate that the 5S rRNA gene can be successfully used for chromosome identification in C. virginica and possibly in all oyster species. FISH with the 5S gene probe easily distinguishes chromosome 5 and 6 from other chromosomes of C. virginica, and it also provides clear and unambiguous separation of chromosome 5 from chromosome 6, based on differences in the chromosomal position of the 5S rRNA locus (immediately next to the centromere on chromosome 5).

Although chromosome identification is essential in chromosomal mapping and studies on aneuploidy and chromosomal rearrangements, it remains a major challenge in oysters and other marine molluscs because traditional karyotyping cannot distinguish all oyster chromosomes. Several karyotypes have been described for the eastern oyster, and the karyotypes varied considerably among reports. The karyotype reported here is similar to these described by Xu et al. (2001) and Wang et al. (2005), but differs from that of Longwell et al. (1967). Such a variation reflects the limits of traditional karyotyping. The application of FISH has led to considerable optimism and progress in the identification of oyster chromosomes (Clabby et al. 1996, Guo & Allen 1997, Zhang et al. 1999, Xu et al. 2001, Wang & Guo 2001, Cross et al. 2003, Wang et al. 2001, 2004, 2005). Still, the chromosome coverage in C. virginica is not yet complete, and more chromosome-specific probes are needed for chromosome identification. This study adds the 5S rRNA gene to the list of available chromosome-specific FISH probes in C. virginica, which may prove to be useful for comparative analysis of karyotypes in Ostreidae.

ACKNOWLEDGMENT

This study is supported by grants from the United States Sea Grant (B/T-9801; R/OD-2003-1), US Department of Agriculture (96-35205-3854), New Jersey Commission on Science and Technology (02-2042-007-11) and China's National Science Foundation (39825121) and 863 Program (2001AA628150). This is publication IMCS-2005-10 and NJMSC-05-606.

LITERATURE CITED

Clabby, C., U. Goswami, F. Flavin, N.P. Wilkins, J.A. Houghton & R. Powell. 1996. Cloning, characterization and chromosomal location of a satellite DNA from the Pacific oyster, Crassostrea gigas. Gene 168:205-209.

Colomba, M. S., R. Vitturi, L. Castriota, R. Bertoni & A. Libertini. 2002. FISH mapping of 18S-28S and 5S ribosomal DNA, [(GATA).sub.n] and (TTAGGG), telomeric repeats in the periwinkle Melarhaphe neritoides (Prosobranchia, Gastropoda, Caenogastropoda). Heredity 88:381-384.

Cross, I., L. Vega & L. Rebordinos. 2003. Nucleolar organizing regions in Crassostrea angulata: chromosomal location and polymorphism. Genetica 119:65-74.

Doyle, J.J. & J. L. Doyle. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19:11-15.

Drouin, G. & M. Moniz De Sa 1995. The concerted evolution of 5S ribosomal genes linked to the repeat units of other multigene families. Mol. Biol. Evol. 12:481-493.

Fang, B.L., R.D. Baere, A. V. d. Berghe & R. D. Wachter. 1982. Sequences of three molluscan 5S ribosomal RNAs confirm the validity of a dynamic secondary structure model. Nucleic Acids Res. 10:4679-4685.

Fontana, F., M. Lanfredi, M. Chicca, L. Congiu, J. Tagliavini & R. Rossi. 1999. Fluorescence in situ hybridization with rDNA probes on chromosomes of Acipenser ruthenus and Acipenser naccarii (Osteichthyes Acipenseriforms). Genome 42:1008-1012.

Fontana, F., M. Lanfredi, L. Congiu, M. Leis, M. Chicca & R. Rossi. 2003. Chromosomal mapping of 18S-28S and 5S rRNA genes by two-color fluorescent in situ hybridization in six sturgeon species. Genome 46: 473-477.

Guo, X. 2004. Oyster breeding and the use of biotechnology. Bull. Aquacult. Assoc. Canada 104:26-33.

Guo, X. & S. K. Allen, Jr. 1997. Fluorescence in situ hybridization of the vertebrate telomere sequence to chromosome ends of the Pacific oyster, Crassostrea gigas Thunberg. J. Shellfish Res. 16:87-89.

Insua, A., R. Freire, J. Rios & J. Mendez. 2001. The 5S rDNA of mussels Mytilus galloprovincialis and M. edulis: sequence variation and chromosomal location. Chromosome Res. 9:495-505.

Insua, A., M.J. Lopez-Pinon & J. Mendez. 1998. Characterization of Aequipecten opercularis (Bivalvia: Pectinidae) chromosomes by different staining techniques and fluorescent in situ hybridization. Genes Genet. Syst. 73:193-200.

Insua, A., R. Freire & J. Mendez. 1999. The 5S rDNA of the bivalve Cerastoderma edule: nucleotide sequence of the repeat unit and chromosomal location relative to 18S-28S rDNA. Genet. Sel. Evol. (Paris) 31:509-518.

Lapegue, S., I. Boutet, A. Leitao, S. Heurtebise, P. Garcia, C. Thiriot-Quievreux & P. Boudry. 2002. Trans-Atlantic distribution of a mangrove oyster species revealed by 16S mtDNA and karyological analysis. Biol. Bull. 202:232-242.

Leitao, A., P. Boudry, J. Labat & C. Thiriot-Quievreux. 1999b. Comparative karyological study of cupped oyster species. Malacologia 41:175-186.

Leitao, A., C. Thiriot-Quievreux, P. Boudry & I. Malheiro. 1999a. A "G" chromosome banding study of three cupped oyster species: Crassostrea gigas, Crassostrea angulata and Crassostrea virginica (Mollusca: Bivavia). Genet. Sel. Evol. 31:519-527.

Levan, A., D. Fredga & A. A. Sandberg. 1964. Nomenclature for centromeric position on chromosomes. Hereditas 52:201-220.

Liu, Z., D. Zhang, D. Hong & X. Wang. 2002. Chromosomal localization of 5S and 18S-5.8S-25S ribosomal DNA sites in five Asian pines using fluorescence in situ hybridization. Theor. Appl. Genet. 122:1007-1024.

Longwell, A. C., S. S. Stiles & D. G. Smith. 1967. Chromosome complement of the American oyster Crassostrea virginica, as seen in meiotic and cleaving eggs. Can. J. Genet. Cytol. 9:845-858.

MacKenzie, C. L., Jr. 1996. History of oystering in the United States and Canada, featuring the eight greatest oyster estuaries. Mar. Fish. Rev. 58:1-78.

Martins, C. & P. M. J. Galetti. 2001. Two 5S rDNA arrays in neotropical fish species: Is it a general rule for fishes? Genetica 111:439-446.

Rodriguez-Romero, F., A. Laguarda-Figueras, M. Uribe-Alcocer & M. L. Rojas-Lara. 1979. Distribution of "G" bands in the karyotype of Crassostrea virginica. Venus Jpn. J. Malacol. 38:180-184.

Swiger, R. R. & J. D. Tucker. 1996. Fluorescence in situ hybridization: a brief review. Environ. Mol. Mutagen. 27:245-254.

Thiriot-Quievreux, C. & A. Insua. 1992. Nucleolar organizer region variation in the chromosomes of three oyster species. J. Exp. Mar. Biol. Ecol. 157:33-40.

Vahidi, H., A. Purac, J. M. Leblanc & B. M. Honda. 1991. Characterization of potentially functional 5S rRNA-encoding genes within ribosomal DNA repeats of the nematode Meloidogyne arenaria. Gene 108:281-284.

Wang, Y. & X. Guo. 2001. Chromosomal mapping of the vertebrate telomeric sequence (TTAGGG)n in four bivalve molluscs by fluorescence in situ hybridization. J. Shellfish Res. 20:1187-1190.

Wang, Y., Z. Xu & X. Guo. 2001. A centromeric satellite sequence in the Pacific oyster (Crassostrea gigas Thunberg) identified by fluorescence in situ hybridization. Mar. Biotechnol. 3:486-492.

Wang, Y., Z. Xu & X. Guo. 2004. Differences in the rDNA-bearing chromosome divide the Asian-Pacific and Atlantic species of Crassostrea (Bivalvia, Mollusca). Biol. Bull 206:46-54.

Wang, Y., Z. Xu, J. C. Pierce & X. Guo. 2005. Characterization of eastern oyster (Crassostrea virginica Gmelin) chromosomes by fluorescence in situ hybridization with bacteriophage P1 clones. Mar. Biotechnol. 7: 207-214.

Xu, Z., X. Guo, P. M. Gaffney & J. C. Pierce. 2001. Chromosomal location of the major ribosomal RNA genes in Crassostrea virginica and Crassostrea gigas. Veliger 44:79-83.

Zhang, Q. Y., G. Yu, R. K. Cooper & T. R. Tiersch. 1999. Chromosomal location by fluorescence in situ hybridization of the 28S ribosomal RNA gene of the eastern oyster. J. Shellfish Res. 18:431-435.

YONGPING WANG, (1,2) ZHE XU (1) AND XIMING GUO (1) *

(1) Haskin Shellfish Research Laboratory, Institute of Marine and Coastal Sciences, Rutgers University, 6959 Miller Avenue, Port Norris, New Jersey, 08349; (2) Experimental Marine Biology Laboratory, Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao, Shandong 266071, People's Republic of China

* Corresponding author. E-mail: [e-mail]

TABLE 1.
Karyotype analysis of Crassostrea virginica chromosomes. Data were
from 13 metaphase arranged according to the relative length (RL)
and centromere index (CI).

Chromosome   Relative Length (1)   Centromeric Index (2)
   No.          ([+ or -] SD)          ([+ or -] SD)

    1        12.11 [+ or -] 0.33   0.48 [+ or -] 0.01
    2        11.40 [+ or -] 0.53   0.39 [+ or -] 0.01
    3        10.93 [+ or -] 0.28   0.41 [+ or -] 0.01
    4        10.77 [+ or -] 0.42   0.47 [+ or -] 0.01
    5        10.06 [+ or -] 0.38   0.40 [+ or -] 0.01
    6         9.98 [+ or -] 0.42   0.47 [+ or -] 0.01
    7         9.67 [+ or -] 0.29   0.40 [+ or -] 0.01
    8         8.92 [+ or -] 0.48   0.40 [+ or -] 0.01
    9         8.49 [+ or -] 0.37   0.35 [+ or -] 0.02
    10        7.67 [+ or -] 0.51   0.47 [+ or -] 0.01

Chromosome
   No.       Classification (3)

    1                 M
    2                 M
    3                 M
    4                 M
    5                 M
    6                 M
    7                 M
    8                 M
    9                SM
    10                M

(1) Relative length of each chromosome as percent total
length of the haploid complement.

(2) CI, length of short arm divided by total length.

(3) M = metacentric; SM = submetacentric.

TABLE 2.
The distribution FISH signals of 5S rRNA genes on the
chromosomes of Crassostrea virginica.

             Signal Location

Signal per   Chromo-   Chromo-     No. of     Frequency
Metaphase    some 5    some 6    Metaphases      (%)

    4           2         2          38         48.7
    3           2         1          17         21.8
    3           1         2           3          3.8
    2           2         0           6          7.7
    2           1         1           6          7.7
    2           0         2           4          5.2
    1           1         0           3          3.8
    1           0         1           1          1.3
    0           0         0          34         31.4