Chikungunya virus in US travelers returning from India, 2006.Chikungunya
(East of India)
********** Chikungunya virus (CHIKV) is a mosquito-transmitted virus (genus Alphavirus, family Togaviridae) usually associated with acute epidemic polyarthralgia. The virus is serologically and genetically most closely related to o'nyong-nyong, Igbo Ora, and, to a lesser extent, Mayaro and Ross River viruses Ross River Virus Definition Ross River Virus (RRV) is Australia's most common and widespread mosquito-borne pathogen. Also known as RRV disease, it can cause debilitating polyarthritis, rash, fever, and constitutional symptoms. , all of which are associated with acute polyarthralgia (1). CHIKV epidemics have been described in Africa, the Middle East, India, and Southeast Asia Southeast Asia, region of Asia (1990 est. pop. 442,500,000), c.1,740,000 sq mi (4,506,600 sq km), bounded roughly by the Indian subcontinent on the west, China on the north, and the Pacific Ocean on the east. , and may have caused epidemics in the Caribbean and in the United States during the early 19th century (2). CHIKV epidemics can be explosive with large numbers of human cases and rapid virus dissemination. In the Reunion Island epidemic from April 2005 to June 2006, [approximately equal to] 270,000 cases were reported, representing nearly 40% of the population (3). Aedes aegypti is the principal vector; however, in recent epidemics in Reunion Island and southern India, Ae. albopictus has been co-implicated (4,5). In Africa, CHIKV is maintained in an enzootic en·zo·ot·ic adj. Prevalent among or restricted to animals of a specific geographic area. Used of a disease. n. An enzootic disease. enzootic peculiar to or present constantly in a location. See also endemic. cycle involving primates Primates The mammalian order to which humans belong. Primates are generally arboreal mammals with a geographic distribution largely restricted to the Tropics. , but in Asia and in recent large epidemics, the human-mosquito cycle predominates, possibly including mechanical transmission (6). Symptoms are characterized by acute onset of joint pain, followed by myalgia myalgia /my·al·gia/ (mi-al´jah) muscular pain.myal´gic epidemic myalgia see under pleurodynia. my·al·gia n. , fever, and rash with recovery usually within weeks. Laboratory diagnosis of CHIKV infection is accomplished by serologic se·rol·o·gy n. pl. se·rol·o·gies 1. The science that deals with the properties and reactions of serums, especially blood serum. 2. methods, virus isolation, and reverse transcription--PCR (RT-PCR RT-PCR reverse transcriptase-polymerase chain reaction. See PCR1. ). A typical serologic algorithm involves testing acute- and convalescent-phase serum specimens for immunoglobulin M immunoglobulin M n. Abbr. IgM The class of antibodies found in circulating body fluids and the first antibodies to appear in response to an initial exposure to an antigen. (IgM) and IgG antibody, followed by a plaque reduction neutralization test neutralization test n. See protection test. (PRNT). Virus isolation and RT-PCR are normally used with early acute-phase specimens (before day 5 post-onset) because duration of viremia viremia /vi·re·mia/ (vi-re´me-ah) the presence of viruses in the blood. vi·re·mi·a n. The presence of viruses in the bloodstream. is typically 2-4 days. Recent CHIKV outbreaks have been reported in several islands in the Indian Ocean as well as in southern India, where > 1 million cases were reported in 2006 (4, 7). CHIKV infections have also been documented in travelers returning from these areas (3, 7). We report confirmed CHIKV infections among 35 travelers returning from overseas travel; 33 were returning from India and 2 from Reunion Island (Table 1). The Study Serum samples were received by the Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center. (Fort Collins, CO, USA) from April 2006 to December 2006 as part of routine diagnostic and reference services available to public health laboratories. A total of 106 serum samples were received from persons returning from regions with epidemics or where CHIKV is endemic (79 from India and the Indian Ocean Indian Ocean, third largest ocean, c.28,350,000 sq mi (73,427,000 sq km), extending from S Asia to Antarctica and from E Africa to SE Australia; it is c.4,000 mi (6,400 km) wide at the equator. It constitutes about 20% of the world's total ocean area. islands and 27 from Africa) with compatible CHIKV illness and submitted by state public health laboratories. Serum samples were tested for antibodies to several viruses known to occur in the region of travel and residence by IgM capture ELISA ELISA (e-li´sah) Enzyme-Linked Immuno-Sorbent Assay; any enzyme immunoassay using an enzyme-labeled immunoreactant and an immunosorbent. ELISA n. and a standard IgG ELISA IgG ELISA, n.pr a diagnostic test for identifying reactive substances that provoke delayed hypersensitivity of the immune system. A solid-phase immunoassay that uses enzymes to test for IgG subclass reactions. (8,9). The 35 CHIKV IgM- and IgG-positive specimens were tested by using a PRNT (90% reduction cutoff) with several related alphaviruses (Sindbis, o'nyong-nyong, and Semliki Forest viruses Semliki forest virus an alphavirus associated with illness in horses in Africa. ) to confirm specificity of reactivity (10). A [greater than or equal to] 4-fold neutralizing titer titer /ti·ter/ (ti´ter) the quantity of a substance required to react with or to correspond to a given amount of another substance. difference between antibody to CHIKV and antibodies to other alphaviruses indicated a CHIKV-specific antibody response. IgM-positive and PRNT specificity--confirmed specimens were classified as recent CHIKV infections (Table 1). All serum specimens were tested by a quantitative, real-time, fluorescent probed--based RT-PCR assay for CHIKV RNA RNA: see nucleic acid. RNA in full ribonucleic acid One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic . Two primer probe sets were designed in unique regions of the viral genome and reacted specifically with CHIKV RNA and not with related or unrelated viruses (Table 2). Both sets showed an analytical sensitivity <1 PFU PFU plaque-forming unit; in virology, areas of cell lysis (CPE) in monolayer cell culture, under overlay conditions, initiated by infection with a single virus particle. , and CHIKV was detected in virus-spiked serum samples at a concentration of 10 PFU/mL (75 [micro]L of serum assayed). Eight serum specimens showed positive results by the real-time assay; all were acute-phase specimens with number of days post-onset of illness reported as [less than or equal to] 6. Viral titers of these specimens were estimated by quantitative RT-PCR that used CHIKV quantity standards (determined by plaque assay) to generate a standard curve. Titers of 8 specimens ranged from [10.sup.3.9] PFU/mL to [10.sup.6.8] PFU/mL. All acute-phase specimens (on or before day 8 poston-set) were also tested for CHIKV by virus isolation in Vero cells Vero cells are lineages of cells used in cell cultures.[1] The Vero lineage was isolated from kidney epithelial cells extracted from African green monkey (Cercopithecus aethiops). . Isolation was performed by using a recently developed protocol in which cells were grown in glass shell vials and centrifuged to enhance viral infectivity infectivity ability of an agent to infect. (J.O. Velez, unpub. data). Five serum specimens displayed prominent and characteristic cytopathic effect Cytopathic effect (CPE) refers to degenerative changes in cells (especially in tissue culture) associated with the multiplication of certain viruses. When in tissue culture, the spread of virus is restricted by an overlay of agar (or other suitable substance) and thus the on day 2 postinfection, and virus was identified as CHIKV by RT-PCR. All virus isolates were obtained from acute-phase specimens that also were positive by RT-PCR. Three serum specimens (samples 2, 8, and 10) showed positive RT-PCR results, but CHIKV was not isolated from these specimens. In these 3 specimens, inability to isolate virus may have been related to viral titers, which were lower than most of the virus isolation--positive samples, or to handling or storage of these samples. All 8 virus-positive specimens (whether positive by RT-PCR, virus isolation, or both) were collected <7 days post-onset and were negative for IgM and IgG antibodies to CHIKV. Nearly all of the specimens collected <7 days post-onset were positive by 1 of the virus-based tests. The 2 exceptions, samples 1 and 9, were positive for IgM and IgG antibodies to CHIKV and had high PRNT titers. These findings indicate that these samples were not true acute-phase specimens; the true onset or collection date had likely been reported incorrectly. To identify the strain of CHIKV in these specimens, a 2,122-bp fragment from the structural region of the gehome (nucleotide nucleotide (n  `klēətīd', ny`–), organic substance that serves as a monomer in forming nucleic acids. positions
9,648-11,770) was amplified from all 8 virus-positive specimens by
RT-PCR and subjected to nucleic acid nucleic acid, any of a group of organic substances found in the chromosomes of living cells and viruses that play a central role in the storage and replication of hereditary information and in the expression of this information through protein synthesis. sequencing with previously
described primers (11). All 8 sequences showed nucleotide identity
>99.7% (GenBank accession nos. EF451142-EF451149). BLAST analysis
(www.ncbi.nlm.nih.gov/blast) of the 8 sequences showed that the highest
percentage identity was to CHIKV strains recently isolated from
travelers returning from Indian Ocean islands (Reunion, Mauritius, and
Seychelles). Percentage identity matches between the 8 viruses and
Indian Ocean CHIKV strains were [greater than or equal to] 99.5%, with 5
to 8 mismatches occurring randomly. In comparison, percentage identities
of the 8 viruses to CHIKV prototype $27 or to a strain previously
isolated from India (Nagpur/653496) were 95.1% and 94.4%, respectively.
Conclusions The data reported confirm that the widespread CHIKV epidemic in southern India has infected US travelers. CHIKV infections among international travelers are not unexpected; in 2005-2006, ~800 CHIKV infections were reported in France, primarily in travelers retuming from Reunion Island (3). The more noteworthy observation of this study with potential public health ramifications ramifications npl → Auswirkungen pl is that high levels of infectious virus were detected in returning travelers. Primary vectors for CHIKV are Ae. aegypti and Ae. albopictus, which are established in several southeastem coastal states The U.S. Coastal states are states in the United States that have a coastline. This can be an ocean coast, a gulf coast, or a Great Lake coast. There are twenty three ocean/gulf of Mexico states, and eight Great Lake states. (New York is both an ocean state and a Great Lake state. in the United States. Vector competence studies ofAe. aegypti and Ae. albopictus strains from the United States, as well as strains from the Caribbean and South America South America, fourth largest continent (1991 est. pop. 299,150,000), c.6,880,000 sq mi (17,819,000 sq km), the southern of the two continents of the Western Hemisphere. , showed that a titer of gl04 PFU/mL in monkeys resulted in productive infection with virus dissemination in these mosquitoes, with Ae. albopictus showing higher infection and dissemination rates (12). The level of viremia reported in most of these imported CHIKV infections, >104 PFU/mL, could be sufficient to infect North American North American named after North America. North American blastomycosis see North American blastomycosis. North American cattle tick see boophilusannulatus. vectors, given the appropriate environmental conditions. However, the time of year and place of residence of the returning travelers in this study were not conducive to transmission; only 2 (patients 26 and 32) returned to US regions (South Carolina South Carolina, state of the SE United States. It is bordered by North Carolina (N), the Atlantic Ocean (SE), and Georgia (SW). Facts and Figures Area, 31,055 sq mi (80,432 sq km). Pop. (2000) 4,012,012, a 15. and Louisiana) known to have populations of Ae. albopictus. Nevertheless, returning travelers with high viremia levels, who live in areas with established Ae. aegypti and Ae. albopictus populations, could facilitate local transmission in the United States. Clinicians should therefore obtain travel histories from persons with CHIKV-compatible illness and include CHIKV in differential diagnoses when appropriate. Public health laboratories must carefully monitor CHIKV infections of returning travelers and conduct surveillance for CHIKV-infected vectors in high-risk areas to prevent local establishment of a new emerging virus. Diagnostic laboratory personnel involved in virus isolation protocols must be aware of the potential of isolating CHIKV (a biosafety level biosafety level Epidemiology A classification for the degree of caution required when working with specific groups of pathogens. See Maximum containment facility. 3 agent) from patients returning from regions endemic for CHIKV or regions with epidemics and take appropriate safety precautions. References (1.) Powers AM, Brault AC, Shirako Y, Strauss EG, Kang W, Strauss JH, et al. Evolutionary relationships and systematics systematics: see classification. of the alphaviruses. J Virol. 2001;75:10118-31. (2.) Carey DE. Chikungunya and dengue dengue or breakbone fever or dandy fever Infectious, disabling mosquito-borne fever. Other symptoms include extreme joint pain and stiffness, intense pain behind the eyes, a return of fever after brief pause, and a characteristic rash. : a case of mistaken identity mistaken identity n → erreur f d'identité mistaken identity mistake n → Verwechslung f mistaken identity n . J Hist MedAllied Sci. 1971;26:243-62. (3.) Krastinova E, Quatresous I, Tarantola A. Imported cases of chikungunya in metropolitan France Metropolitan France (French: France métropolitaine or la Métropole, or colloquially l'Hexagone) is the part of France located in Europe, including Corsica. : update to June 2006. Eurosurveillance. 2006; 11 :E060824.1. (4.) Outbreak news. Chikungunya, India. Wkly Epidemiol Rec. 2006;81:409-10. (5.) Reiter P, Fontenille D, Paupy C. Aedes albopictus Noun 1. Aedes albopictus - striped native of Japan thriving in southwestern and midwestern United States and spreading to the Caribbean; potential carrier of serious diseases Asian tiger mosquito as an epidemic vector of chikungunya virus: another emerging problem? Lancet Infect Dis. 2006;6:4634. (6.) Rao TR, Paul SD, Singh KR. Experimental studies on the mechanical transmission of Chikungunya virus by Aedes aegypti. Mosquito News. 1968;28:406-8. (7.) Centers for Disease Control and Prevention. Chikungunya fever diagnosed among international travelers--United States, 2005-2006. MMWR MMWR Morbidity & Mortality Weekly Report Epidemiology A news bulletin published by the CDC, which provides epidemiologic data–eg, statistics on the incidence of AIDS, rabies, rubella, STDs and other communicable diseases, causes of mortality–eg, Morb Mortal Wkly Rep. 2006;55:1040-2. (8.) Martin DA, Muth DA, Brown T, Johnson AJ, Karabatsos N, Roehrig JT. Standardization standardization In industry, the development and application of standards that make it possible to manufacture a large volume of interchangeable parts. Standardization may focus on engineering standards, such as properties of materials, fits and tolerances, and drafting of immunoglobulin M capture enzyme-linked immunosorbent assays enzyme-linked immunosorbent assay n. ELISA. Enzyme-linked immunosorbent assay (ELISA) A diagnostic blood test used to screen patients for AIDS or other viruses. for routine diagnosis of arboviral infections. J Clin Microbiol. 2000;38:1823--6. (9.) Johnson AJ, Martin DA, Karabatsos N, Roehrig JT. Detection of anti-arboviral immunoglobulin G immunoglobulin G n. Abbr. IgG The most abundant class of antibodies found in blood serum and lymph and active against bacteria, fungi, viruses, and foreign particles. Immunoglobulin G antibodies trigger action of the complement system. by using a monoclonal antibody-based capture enzyme-linked immunosorbent assay. J Clin Microbiol. 2000;38:1827-31. (10.) Lindsey HS, Calisher CH, Mathews JH. Serum dilution neutralization test for California group virus identification and serology Serology The division of biological science concerned with antigen-antibody reactions in serum. It properly encompasses any of these reactions, but is often used in a limited sense to denote laboratory diagnostic tests, especially for syphilis. . J Clin Microbiol. 1976;4:503-10. (11.) Schuffenecker I, Iteman I, Michault A, Murri S Murri can refer to any of following:
n. Evolution resulting from a succession of relatively small genetic variations that often cause the formation of new subspecies. of chikungunya viruses causing the Indian Ocean outbreak. PLoS Med. 2006;3:1058-70. (12.) Turell M J, Beaman JR, Tammariello RF. Susceptibility of selected strains of Aedes aegypti and Aedes albopicms (Diptera: Culicidae) to chikungunya virus. J Med Entomol. 1992;29:49-53. Dr Lanciotti is chief of the Diagnostic and Reference Laboratory in the Arbovirus arbovirus Any of a large group of viruses that develop in arthropods (chiefly mosquitoes and ticks). The name derives from “arthropod-borne virus.” The spheroidal virus particle is encased in a fatty membrane and contains RNA; it causes no apparent harm to the Diseases Branch at the Centers for Disease Control and Prevention, Fort Collins, Colorado The City of Fort Collins, a home rule municipality situated on the Cache la Poudre River along the Colorado Front Range, is the county seat and most populous city in Larimer County, Colorado. . His primary research interests are laboratory diagnosis of arbovirus infections and diagnostic test development and support for public health laboratories worldwide. Address for correspondence: Robert S Robert, Henry Martyn 1837-1923. American army engineer and parliamentary authority. He designed the defenses for Washington, D.C., during the Civil War and later wrote Robert's Rules of Order (1876). Noun 1. . Lanciotti, Diagnostic and Reference Laboratory, Arbovirus Diseases Branch, Centers for Disease Control and Prevention, 3150 Rampart Rd, Fort Collins, CO 80521, USA; email: rsl2@cdc.gov Robert S. Lanciotti, * Olga L. Kosoy, * Janeen J. Laven, * Amanda J. Panella, * Jason O. Velez, * Amy J. Lambert, * and Grant L. Campbell * * Centers for Disease Control and Prevention, Fort Collins, Colorado, USA
Table 1. Diagnostic test results for 35 travelers infected with
chikungunya virus (CHIKV), 2006 *
IgM IgG
ELISA ELISA PRNT
Sample ([dagger]) ([dagger]) ([section])
1 17.7 3.2 640
2 1.7 1.7 <10
3 1.2 1.1 ND
4 1.8 NS ND
5 1.2 0.8 ND
6 1.8 1.6 <10
7 1.6 1.2 ND
8 NS 1.4 ND
9 22.0 4.3 5,120
10 1.1 1.0 <10
11 7.4 1.0 40
12 15.0 0.6 320
13 26.2 1.2 160
14 12.9 5.8 180
15 38.8 2.3 2,560
16 12.7 1.5 640
17 16.9 4.8 640
18 8.3 3.7 640
19 6.6 1.5 640
20 2.6 6.8 320
21 5.0 NS 640
22 15.1 4.1 1,280
23 4.3 5.9 2,560
24 5.6 NS 320
25 3.1 3.7 640
26 26.6 13.4 5,120
27 30.7 6.6 5,120
28 6.1 11.4 2,560
29 9.4 16.0 640
30 7.5 8.4 1,280
31 5.3 5.8 640
32 3.7 16.1 320
33 9.8 10.1 2,560
34 7.5 3.1 160
35 24.60 11.90 20,480
Virus
isolation Viremia,
(Vero RT-PCR PFU/mL
Sample cells) ([section]) ([paragraph])
1 - - NA
2 - + [10.sup.4.0]
3 + + [10.sup.4.1]
4 + + [10.sup.6.8]
5 + + [10.sup.5.1]
6 + + [10.sup.6.0]
7 + + [10.sup.5.3]
8 - + [10.sup.3.9]
9 - - NA
10 - + [10.sup.4.5]
11 - - NA
12 - - NA
13 ND - NA
14 ND - NA
15 ND ND NA
16 ND - NA
17 ND - NA
18 ND ND NA
19 ND - NA
20 ND - NA
21 ND - NA
22 ND - NA
23 ND - NA
24 ND - NA
25 ND - NA
26 ND ND NA
27 ND - NA
28 ND - NA
29 ND - NA
30 ND - NA
31 ND - NA
32 ND - NA
33 ND - NA
34 ND - NA
35 ND - NA
Days from
onset of State of Return
illness US date,
Sample to collection residence 2006
1 0 NJ 10/12
2 1 CA Before 11/28
3 1 IL 9/29
4 2 CA Before 9/16
5 2 MA 9/10
6 3 PA Before 8/20
7 3 CA 10/2
8 4 WI 10/9
9 4 CA Before 10/6
10 6 CA Before 8/13
11 7 CA Before 9/23
12 8 CT Before 7/6
13 8 DC Before 10/16
14 10 CA Before 9/22
15 19 CT Before 7/6
16 20 IL 8/23
17 30 IL 6/25
18 31 HI Before 8/2
19 31 CA Before 8/13
20 34 MD Before 3/20
21 34 IL Before 9/22
22 38 CA Before 10/2
23 42 PA Before 8/20
24 43 Unknown Unknown
25 44 IL Before 9/12
26 48 SC 6/24
27 61 CA Before 10/26
28 62 CT Before 10/3
29 63 CA 8/23
30 71 MN 6/8
31 71 MN 6/8
32 75 LA Before 3/30
33 92 IL 7/9
34 101 PA Before 10/13
35 Unknown IL Before 11/08
* IgM, immunoglobulin M; PRNT, plaque reduction neutralization test;
RT-PCR, reverse transcription-PCR; NA, not applicable; ND, not done
(sample depleted); NS, nonspecific reaction in ELISA.
([dagger]) Values are patient sample optical densities divided by a
negative control optical density; values [greater than or equal to]
3 are positive.
([double dagger]) Values are 90% plaque reduction neutralization
titers.
([section]) Real-time, fluorescence-based assay for detecting CHIKV
RNA; positive samples had crossing threshold values [less than or
equal to] 37 with both primer sets.
([paragraph]) Estimated CHIKV PFU/mL by real-time RT-PCR using a
standard curve generated with plaque-titrated/calibrated CHIKV
standards.
Table 2. Sensitivity and specificity of chikungunya virus (CHIKV)
oligonucleotide primers used in real-time reverse transcription-PCR
assay
Primer Genome position *
CHIKV 874 874-894
CHIKV 961 961-942
CHIKV 899-FAM ([section]) 899-923
CHIKV 6856 6856-6879
CHIKV 6981 6981-6956
CHIKV 6919-FAM 6919-6941
Primer Sequence (5'[right arrow]3')
CHIKV 874 AAAGGGCAAACTCAGCTTCAC
CHIKV 961 GCCTGGGCTCATCGTTATTC
CHIKV 899-FAM ([section]) CGCTGTGATACAGTGGTTTCGTGTG
CHIKV 6856 TCACTCCCTGTTGGACTTGATAGA
CHIKV 6981 TTGACGAACAGAGTTAGGAACATACC
CHIKV 6919-FAM AGGTACGCGCTTCAAGTTCGGCG
Specificity
Primer Sensitivity ([dagger]) ([double dagger])
CHIKV 874
CHIKV 961 0.3 CHIKV
CHIKV 899-FAM ([section])
CHIKV 6856
CHIKV 6981 0.9 CHIKV
CHIKV 6919-FAM
* On the basis of CHIKV prototype strain S27, GenBank
accession no. NC_004162.
([dagger]) Absolute no. of PFU detected in triplicate testing.
([double dagger]) No reactivity was observed with the following
viruses: o nyong-nyong, Ross River, Mayaro, Semliki Forest, Sindbis,
western equine encephalitis, eastern equine encephalitis, and
Venezuelan equine encephalitis subtypes 1AB, 1C, 1D, and 1E.
([section]) Primer labeled at the 5' terminus with 5-FAM and 3'
Black Hole Quencher 1 (Operon Biotechnologies Inc., Huntsville,
AL, USA).
|
|
||||||||||||||||
Printer friendly
Cite/link
Email
Feedback
Reader Opinion