Chikungunya virus in US travelers returning from India, 2006.Chikungunya virus (CHIKV), a mosquitolborne alpha-virus, is endemic in Africa and Asia. In 2005-2006, CHIKV epidemics were reported in islands in the Indian Ocean and in southern India. We present data on laboratory-confirmed CHIKV infections among travelers returning from India to the United States during 2006. ********** Chikungunya virus (CHIKV) is a mosquito-transmitted virus (genus Alphavirus, family Togaviridae) usually associated with acute epidemic polyarthralgia. The virus is serologically and genetically most closely related to o'nyong-nyong, Igbo Ora, and, to a lesser extent, Mayaro and Ross River viruses, all of which are associated with acute polyarthralgia (1). CHIKV epidemics have been described in Africa, the Middle East, India, and Southeast Asia, and may have caused epidemics in the Caribbean and in the United States during the early 19th century (2). CHIKV epidemics can be explosive with large numbers of human cases and rapid virus dissemination. In the Reunion Island epidemic from April 2005 to June 2006, [approximately equal to] 270,000 cases were reported, representing nearly 40% of the population (3). Aedes aegypti is the principal vector; however, in recent epidemics in Reunion Island and southern India, Ae. albopictus has been co-implicated (4,5). In Africa, CHIKV is maintained in an enzootic cycle involving primates, but in Asia and in recent large epidemics, the human-mosquito cycle predominates, possibly including mechanical transmission (6). Symptoms are characterized by acute onset of joint pain, followed by myalgia, fever, and rash with recovery usually within weeks. Laboratory diagnosis of CHIKV infection is accomplished by serologic methods, virus isolation, and reverse transcription--PCR (RT-PCR). A typical serologic algorithm involves testing acute- and convalescent-phase serum specimens for immunoglobulin M (IgM) and IgG antibody, followed by a plaque reduction neutralization test (PRNT). Virus isolation and RT-PCR are normally used with early acute-phase specimens (before day 5 post-onset) because duration of viremia is typically 2-4 days. Recent CHIKV outbreaks have been reported in several islands in the Indian Ocean as well as in southern India, where > 1 million cases were reported in 2006 (4, 7). CHIKV infections have also been documented in travelers returning from these areas (3, 7). We report confirmed CHIKV infections among 35 travelers returning from overseas travel; 33 were returning from India and 2 from Reunion Island (Table 1). The Study Serum samples were received by the Centers for Disease Control and Prevention (Fort Collins, CO, USA) from April 2006 to December 2006 as part of routine diagnostic and reference services available to public health laboratories. A total of 106 serum samples were received from persons returning from regions with epidemics or where CHIKV is endemic (79 from India and the Indian Ocean islands and 27 from Africa) with compatible CHIKV illness and submitted by state public health laboratories. Serum samples were tested for antibodies to several viruses known to occur in the region of travel and residence by IgM capture ELISA and a standard IgG ELISA (8,9). The 35 CHIKV IgM- and IgG-positive specimens were tested by using a PRNT (90% reduction cutoff) with several related alphaviruses (Sindbis, o'nyong-nyong, and Semliki Forest viruses) to confirm specificity of reactivity (10). A [greater than or equal to] 4-fold neutralizing titer difference between antibody to CHIKV and antibodies to other alphaviruses indicated a CHIKV-specific antibody response. IgM-positive and PRNT specificity--confirmed specimens were classified as recent CHIKV infections (Table 1). All serum specimens were tested by a quantitative, real-time, fluorescent probed--based RT-PCR assay for CHIKV RNA. Two primer probe sets were designed in unique regions of the viral genome and reacted specifically with CHIKV RNA and not with related or unrelated viruses (Table 2). Both sets showed an analytical sensitivity <1 PFU, and CHIKV was detected in virus-spiked serum samples at a concentration of 10 PFU/mL (75 [micro]L of serum assayed). Eight serum specimens showed positive results by the real-time assay; all were acute-phase specimens with number of days post-onset of illness reported as [less than or equal to] 6. Viral titers of these specimens were estimated by quantitative RT-PCR that used CHIKV quantity standards (determined by plaque assay) to generate a standard curve. Titers of 8 specimens ranged from [10.sup.3.9] PFU/mL to [10.sup.6.8] PFU/mL. All acute-phase specimens (on or before day 8 poston-set) were also tested for CHIKV by virus isolation in Vero cells. Isolation was performed by using a recently developed protocol in which cells were grown in glass shell vials and centrifuged to enhance viral infectivity (J.O. Velez, unpub. data). Five serum specimens displayed prominent and characteristic cytopathic effect on day 2 postinfection, and virus was identified as CHIKV by RT-PCR. All virus isolates were obtained from acute-phase specimens that also were positive by RT-PCR. Three serum specimens (samples 2, 8, and 10) showed positive RT-PCR results, but CHIKV was not isolated from these specimens. In these 3 specimens, inability to isolate virus may have been related to viral titers, which were lower than most of the virus isolation--positive samples, or to handling or storage of these samples. All 8 virus-positive specimens (whether positive by RT-PCR, virus isolation, or both) were collected <7 days post-onset and were negative for IgM and IgG antibodies to CHIKV. Nearly all of the specimens collected <7 days post-onset were positive by 1 of the virus-based tests. The 2 exceptions, samples 1 and 9, were positive for IgM and IgG antibodies to CHIKV and had high PRNT titers. These findings indicate that these samples were not true acute-phase specimens; the true onset or collection date had likely been reported incorrectly. To identify the strain of CHIKV in these specimens, a 2,122-bp fragment from the structural region of the gehome (nucleotide positions 9,648-11,770) was amplified from all 8 virus-positive specimens by RT-PCR and subjected to nucleic acid sequencing with previously described primers (11). All 8 sequences showed nucleotide identity >99.7% (GenBank accession nos. EF451142-EF451149). BLAST analysis (www.ncbi.nlm.nih.gov/blast) of the 8 sequences showed that the highest percentage identity was to CHIKV strains recently isolated from travelers returning from Indian Ocean islands (Reunion, Mauritius, and Seychelles). Percentage identity matches between the 8 viruses and Indian Ocean CHIKV strains were [greater than or equal to] 99.5%, with 5 to 8 mismatches occurring randomly. In comparison, percentage identities of the 8 viruses to CHIKV prototype $27 or to a strain previously isolated from India (Nagpur/653496) were 95.1% and 94.4%, respectively. Conclusions The data reported confirm that the widespread CHIKV epidemic in southern India has infected US travelers. CHIKV infections among international travelers are not unexpected; in 2005-2006, ~800 CHIKV infections were reported in France, primarily in travelers retuming from Reunion Island (3). The more noteworthy observation of this study with potential public health ramifications is that high levels of infectious virus were detected in returning travelers. Primary vectors for CHIKV are Ae. aegypti and Ae. albopictus, which are established in several southeastem coastal states in the United States. Vector competence studies ofAe. aegypti and Ae. albopictus strains from the United States, as well as strains from the Caribbean and South America, showed that a titer of gl04 PFU/mL in monkeys resulted in productive infection with virus dissemination in these mosquitoes, with Ae. albopictus showing higher infection and dissemination rates (12). The level of viremia reported in most of these imported CHIKV infections, >104 PFU/mL, could be sufficient to infect North American vectors, given the appropriate environmental conditions. However, the time of year and place of residence of the returning travelers in this study were not conducive to transmission; only 2 (patients 26 and 32) returned to US regions (South Carolina and Louisiana) known to have populations of Ae. albopictus. Nevertheless, returning travelers with high viremia levels, who live in areas with established Ae. aegypti and Ae. albopictus populations, could facilitate local transmission in the United States. Clinicians should therefore obtain travel histories from persons with CHIKV-compatible illness and include CHIKV in differential diagnoses when appropriate. Public health laboratories must carefully monitor CHIKV infections of returning travelers and conduct surveillance for CHIKV-infected vectors in high-risk areas to prevent local establishment of a new emerging virus. Diagnostic laboratory personnel involved in virus isolation protocols must be aware of the potential of isolating CHIKV (a biosafety level 3 agent) from patients returning from regions endemic for CHIKV or regions with epidemics and take appropriate safety precautions. References (1.) Powers AM, Brault AC, Shirako Y, Strauss EG, Kang W, Strauss JH, et al. Evolutionary relationships and systematics of the alphaviruses. J Virol. 2001;75:10118-31. (2.) Carey DE. Chikungunya and dengue: a case of mistaken identity. J Hist MedAllied Sci. 1971;26:243-62. (3.) Krastinova E, Quatresous I, Tarantola A. Imported cases of chikungunya in metropolitan France: update to June 2006. Eurosurveillance. 2006; 11 :E060824.1. (4.) Outbreak news. Chikungunya, India. Wkly Epidemiol Rec. 2006;81:409-10. (5.) Reiter P, Fontenille D, Paupy C. Aedes albopictus as an epidemic vector of chikungunya virus: another emerging problem? Lancet Infect Dis. 2006;6:4634. (6.) Rao TR, Paul SD, Singh KR. Experimental studies on the mechanical transmission of Chikungunya virus by Aedes aegypti. Mosquito News. 1968;28:406-8. (7.) Centers for Disease Control and Prevention. Chikungunya fever diagnosed among international travelers--United States, 2005-2006. MMWR Morb Mortal Wkly Rep. 2006;55:1040-2. (8.) Martin DA, Muth DA, Brown T, Johnson AJ, Karabatsos N, Roehrig JT. Standardization of immunoglobulin M capture enzyme-linked immunosorbent assays for routine diagnosis of arboviral infections. J Clin Microbiol. 2000;38:1823--6. (9.) Johnson AJ, Martin DA, Karabatsos N, Roehrig JT. Detection of anti-arboviral immunoglobulin G by using a monoclonal antibody-based capture enzyme-linked immunosorbent assay. J Clin Microbiol. 2000;38:1827-31. (10.) Lindsey HS, Calisher CH, Mathews JH. Serum dilution neutralization test for California group virus identification and serology. J Clin Microbiol. 1976;4:503-10. (11.) Schuffenecker I, Iteman I, Michault A, Murri S, Frangeul L, Vaney M, et al. Genome microevolution of chikungunya viruses causing the Indian Ocean outbreak. PLoS Med. 2006;3:1058-70. (12.) Turell M J, Beaman JR, Tammariello RF. Susceptibility of selected strains of Aedes aegypti and Aedes albopicms (Diptera: Culicidae) to chikungunya virus. J Med Entomol. 1992;29:49-53. Dr Lanciotti is chief of the Diagnostic and Reference Laboratory in the Arbovirus Diseases Branch at the Centers for Disease Control and Prevention, Fort Collins, Colorado. His primary research interests are laboratory diagnosis of arbovirus infections and diagnostic test development and support for public health laboratories worldwide. Address for correspondence: Robert S. Lanciotti, Diagnostic and Reference Laboratory, Arbovirus Diseases Branch, Centers for Disease Control and Prevention, 3150 Rampart Rd, Fort Collins, CO 80521, USA; email: rsl2@cdc.gov Robert S. Lanciotti, * Olga L. Kosoy, * Janeen J. Laven, * Amanda J. Panella, * Jason O. Velez, * Amy J. Lambert, * and Grant L. Campbell * * Centers for Disease Control and Prevention, Fort Collins, Colorado, USA
Table 1. Diagnostic test results for 35 travelers infected with
chikungunya virus (CHIKV), 2006 *
IgM IgG
ELISA ELISA PRNT
Sample ([dagger]) ([dagger]) ([section])
1 17.7 3.2 640
2 1.7 1.7 <10
3 1.2 1.1 ND
4 1.8 NS ND
5 1.2 0.8 ND
6 1.8 1.6 <10
7 1.6 1.2 ND
8 NS 1.4 ND
9 22.0 4.3 5,120
10 1.1 1.0 <10
11 7.4 1.0 40
12 15.0 0.6 320
13 26.2 1.2 160
14 12.9 5.8 180
15 38.8 2.3 2,560
16 12.7 1.5 640
17 16.9 4.8 640
18 8.3 3.7 640
19 6.6 1.5 640
20 2.6 6.8 320
21 5.0 NS 640
22 15.1 4.1 1,280
23 4.3 5.9 2,560
24 5.6 NS 320
25 3.1 3.7 640
26 26.6 13.4 5,120
27 30.7 6.6 5,120
28 6.1 11.4 2,560
29 9.4 16.0 640
30 7.5 8.4 1,280
31 5.3 5.8 640
32 3.7 16.1 320
33 9.8 10.1 2,560
34 7.5 3.1 160
35 24.60 11.90 20,480
Virus
isolation Viremia,
(Vero RT-PCR PFU/mL
Sample cells) ([section]) ([paragraph])
1 - - NA
2 - + [10.sup.4.0]
3 + + [10.sup.4.1]
4 + + [10.sup.6.8]
5 + + [10.sup.5.1]
6 + + [10.sup.6.0]
7 + + [10.sup.5.3]
8 - + [10.sup.3.9]
9 - - NA
10 - + [10.sup.4.5]
11 - - NA
12 - - NA
13 ND - NA
14 ND - NA
15 ND ND NA
16 ND - NA
17 ND - NA
18 ND ND NA
19 ND - NA
20 ND - NA
21 ND - NA
22 ND - NA
23 ND - NA
24 ND - NA
25 ND - NA
26 ND ND NA
27 ND - NA
28 ND - NA
29 ND - NA
30 ND - NA
31 ND - NA
32 ND - NA
33 ND - NA
34 ND - NA
35 ND - NA
Days from
onset of State of Return
illness US date,
Sample to collection residence 2006
1 0 NJ 10/12
2 1 CA Before 11/28
3 1 IL 9/29
4 2 CA Before 9/16
5 2 MA 9/10
6 3 PA Before 8/20
7 3 CA 10/2
8 4 WI 10/9
9 4 CA Before 10/6
10 6 CA Before 8/13
11 7 CA Before 9/23
12 8 CT Before 7/6
13 8 DC Before 10/16
14 10 CA Before 9/22
15 19 CT Before 7/6
16 20 IL 8/23
17 30 IL 6/25
18 31 HI Before 8/2
19 31 CA Before 8/13
20 34 MD Before 3/20
21 34 IL Before 9/22
22 38 CA Before 10/2
23 42 PA Before 8/20
24 43 Unknown Unknown
25 44 IL Before 9/12
26 48 SC 6/24
27 61 CA Before 10/26
28 62 CT Before 10/3
29 63 CA 8/23
30 71 MN 6/8
31 71 MN 6/8
32 75 LA Before 3/30
33 92 IL 7/9
34 101 PA Before 10/13
35 Unknown IL Before 11/08
* IgM, immunoglobulin M; PRNT, plaque reduction neutralization test;
RT-PCR, reverse transcription-PCR; NA, not applicable; ND, not done
(sample depleted); NS, nonspecific reaction in ELISA.
([dagger]) Values are patient sample optical densities divided by a
negative control optical density; values [greater than or equal to]
3 are positive.
([double dagger]) Values are 90% plaque reduction neutralization
titers.
([section]) Real-time, fluorescence-based assay for detecting CHIKV
RNA; positive samples had crossing threshold values [less than or
equal to] 37 with both primer sets.
([paragraph]) Estimated CHIKV PFU/mL by real-time RT-PCR using a
standard curve generated with plaque-titrated/calibrated CHIKV
standards.
Table 2. Sensitivity and specificity of chikungunya virus (CHIKV)
oligonucleotide primers used in real-time reverse transcription-PCR
assay
Primer Genome position *
CHIKV 874 874-894
CHIKV 961 961-942
CHIKV 899-FAM ([section]) 899-923
CHIKV 6856 6856-6879
CHIKV 6981 6981-6956
CHIKV 6919-FAM 6919-6941
Primer Sequence (5'[right arrow]3')
CHIKV 874 AAAGGGCAAACTCAGCTTCAC
CHIKV 961 GCCTGGGCTCATCGTTATTC
CHIKV 899-FAM ([section]) CGCTGTGATACAGTGGTTTCGTGTG
CHIKV 6856 TCACTCCCTGTTGGACTTGATAGA
CHIKV 6981 TTGACGAACAGAGTTAGGAACATACC
CHIKV 6919-FAM AGGTACGCGCTTCAAGTTCGGCG
Specificity
Primer Sensitivity ([dagger]) ([double dagger])
CHIKV 874
CHIKV 961 0.3 CHIKV
CHIKV 899-FAM ([section])
CHIKV 6856
CHIKV 6981 0.9 CHIKV
CHIKV 6919-FAM
* On the basis of CHIKV prototype strain S27, GenBank
accession no. NC_004162.
([dagger]) Absolute no. of PFU detected in triplicate testing.
([double dagger]) No reactivity was observed with the following
viruses: o nyong-nyong, Ross River, Mayaro, Semliki Forest, Sindbis,
western equine encephalitis, eastern equine encephalitis, and
Venezuelan equine encephalitis subtypes 1AB, 1C, 1D, and 1E.
([section]) Primer labeled at the 5' terminus with 5-FAM and 3'
Black Hole Quencher 1 (Operon Biotechnologies Inc., Huntsville,
AL, USA).
|
|
||||||||||||||||

Printer friendly
Cite/link
Email
Feedback
Reader Opinion