Characterization of a Human Granulocytic Ehrlichiosis-like Agent from Ixodes scapularis, Ontario, Canada.To the Editor: Human granulocytic ehrlichiosis human granulocytic ehrlichiosis: see ehrlichiosis. (HGE HGE hemorrhagic gastroenteritis. ), a tick-associated febrile illness first described in Minnesota and Wisconsin in 1994 (1), has recently been reported in a number of European countries (2,3). Molecular and serologic se·rol·o·gy n. pl. se·rol·o·gies 1. The science that deals with the properties and reactions of serums, especially blood serum. 2. characterization has shown that the HGE agent is closely related or identical to Ehrlichia equi and E. phagocytophila (4,5). In the United States, human cases of HGE overlap the range of the blacklegged tick, Ixodes scapularis, and the detection of HGE agent DNA DNA: see nucleic acid. DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. in this species provides direct evidence that this arthropod arthropod Any member of the largest phylum, Arthropoda, in the animal kingdom. Arthropoda consists of more than one million known invertebrate species in four subphyla: Uniramia (five classes, including insects), Chelicerata (three classes, including arachnids and horseshoe is a competent vector (4). We report the first identification and characterization of an HGE-like agent in a blacklegged tick collected in a tick-endemic area of Canada (6). Sixty male and 60 female I. scapularis were collected from five white-tailed deer shot on Long Point Peninsula, Ontario, during November 1999. Live ticks were cut longitudinally into halves, and half of each specimen was placed in lysis buffer from a QIAamp DNA Mini Kit (Qiagen Inc., Canada); DNA was extracted per manufacturer's instructions. Five microliters of extracted tick DNA was then added to a polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is (PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) ) mixture containing primers Ehr 521 and Ehr 790 (7), and the resulting amplification products were run on agarose gels. Extracted DNA from one male tick generated the expected 293-bp HGE agent amplicon. Preliminary DNA sequencing analysis of the putative granulocytic granulocytic pertaining to granulocytes. granulocytic leukemia see myelocytic leukemia. granulocytic sarcoma extramedullary growth of multiple, focal granulocytic neoplasm. They may be neutrophilic or eosinophilic. Ehrlichia PCR product indicated a high sequence identity with HGE agent 16S rDNA. To further genotype this HGE-like agent, an 894-bp portion of 16S rDNA was amplified by using primers ge3a, ge9f, gel0r (8), and primer mdge9r (5' ATGTCAAGGAGTGGTAAGGT) in a nested PCR reaction. Genetic characterization of the Long Point HGE-like agent (designated here as L3H) was carried out by sequencing an 849-bp portion of the rDNA gene and comparing it with other HGE-like agents in GenBank. Within the rDNA portion sequenced, L3H shares 99.6% identity with the HGE agent and E. equi/E, phagocytophila. In the 849-bp portion of the rDNA gene amplified and sequenced, the L3H strain differed from the HGE agent by three nucleotides. Comparison of L3H with HGE-like agents from the United States, Europe, and China suggests a high degree of sequence identity at the rDNA level; however, a number of nucleotide positions did show variation. (GenBank accession number for L3H is AF311343.) This study documents for the first time (by rDNA sequence comparisons) that I. scapularis from a tick-endemic site in Canada can harbor an ehrlichia of the E. equi genogroup and is closely related to the HGE agent. The taxonomic significance of HGE-like agents that vary somewhat in their rDNA sequence is still unclear. HGE-like agents from diverse geographic locations and various hosts can exhibit nucleotide differences at a number of positions and still be [is greater than] 99% similar at the level of rDNA sequence identity. Recently it has been shown that sequencing of a more variable genomic region, such as the ank gene of granulocytic ehrlichia, can group these agents into different North American and European genetic clades or genogroups (9). Whether all HGE-like "variants" that differ somewhat in their rDNA or ank gene sequences can cause human or animal disease remains to be determined. The identification of an HGE-like agent further highlights the concern that I. scapularis may transmit a number of pathogens to humans or other animals in Canada. Public health officials and veterinarians should be aware of this finding and consider HGE in the differential diagnosis of patients or clients with relevant clinical presentations. Further studies documenting the prevalence of the HGE-like agent(s) in ticks from Canada and characterization of any agents identified are warranted to better define potential human and animal health risks. Michael A. Drebot,(*) Robbin Lindsay,(*) Ian K. Barker,([dagger]) and Harvey Artsob(*) (*) Health Canada, Canadian Science Centre for Human and Animal Health, National Microbiology Laboratory The National Microbiology Laboratory (NML) is located in the Canadian Science Centre for Human and Animal Health in Winnipeg, Manitoba. This modern state-of-the-art facility houses the NML's Biological Safety Level 4 (BSL-4) containment laboratory, currently Canada's only BSL-4 , Winnipeg, Manitoba, Canada; and ([dagger]) Ontario Veterinary College The Ontario Veterinary College (OVC), in Canada, is Canada's oldest veterinary school located on the campus of the University of Guelph in Guelph, Ontario. History The Ontario Veterinary College is one of the oldest veterinary schools in North America. , University of Guelph The University of Guelph is a medium-sized university located in Guelph, Ontario, established in 1964. While the U of G offers degrees in many different disciplines, the university is best known for its focus on life sciences, based in part on a long-standing history of , Guelph, Ontario, Canada References (1.) Bakken JS, Dumler JS, Chen SM, Eckman MR, Van Etta LL, Walker DH. Human granulocytic ehrlichiosis in the upper midwest United States. A new species emerging? JAMA JAMA abbr. Journal of the American Medical Association 1994;272:212-8. (2.) Petrovec M, Furlan SL, Zupanc TA, Strle F, Brouqui P, Roux V, et al. Human disease in Europe caused by a granulocytic Ehrlichia species. J Clin Microbiol 1997;35:1556-9. (3.) Laferl H, Hogrefe W, Kock T, Pichler H. A further case of acute human granulocytic ehrlichiosis in Slovenia. Eur J Clin Microbiol Infect Dis 1999;18:385-92. (4.) Walker DS, Dumler JS. Emergence of the ehrlichioses as human health problems. Emerg Infect Dis 1996;2:18-28. (5.) Chen SM, Dumler JS, Bakken JS, Walker DS. Identification of a granulocytotropic Ehrlichia species as the etiological etiological pertaining to etiology. etiological diagnosis the name of a disease which includes the identification of the causative agent, e.g. Streptococcus agalactiae mastitis. agent of human disease. J Clin Microbiol 1994;32:589-95. (6.) Watson TG, Anderson RC. Ixodes scapularis Say on white-tailed deer (Odocoileus viginianus) from Long Point, Ontario. J Wildl Dis 1976;12:66-77. (7.) Kolbert C. Detection of the agent of human granulocytic ehrlichiosis by PCR. In: Persing D, editor. PCR protocols for emerging infectious diseases. Washington: American Society for Microbiology The American Society for Microbiology (ASM) is a scientific organization, based in the United States although with over 43,000 members throughout the world. It is the largest single life science professional organization and its members include those whose interests encompass basic Press; 1996. p. 106-11. (8.) Massung RF, Slater K, Owens JH, Nicholson WL, Mather TN, Solberg VB, et al. Nested PCR assay for detection of granulocytic ehrlichia. J Clin Microbiol 1998;36:1090-5. (9.) Massung RF, Owens JH, Ross D, Reed KD, Petrovec M, Bjoersdorff A, et al. Sequence analysis of the ank gene of granulocytic ehrlichiae. J Clin Microbiol 2000;38:2917-22. |
|
||||||||||||||||||||

Printer friendly
Cite/link
Email
Feedback
Reader Opinion