Characterization of 35 new microsatellite genetic markers for the Pacific whiteleg shrimp, Litopenaeus vannamei: their usefulness for studying genetic diversity of wild and cultured stocks, tracing pedigree in breeding programs, and linkage mapping.

ABSTRACT A large number of polymorphic genetic markers are needed to examine genetic variation in wild and cultured penaeid species, trace pedigrees, and apply marker-assisted selection in breeding programs. The objectives of this study are to (1) isolate and characterize microsatellite genetic markers for the Pacific whiteleg shrimp, Litopenaeus vannamei, (2) demonstrate the usefulness of three randomly selected markers to examine allelic variation in wild and cultured shrimp populations, and trace the pedigree of two families from the breeding program of the US Marine Shrimp Farming Program (USMSFP); and (3) determine the potential usefulness of these microsatellites for linkage mapping. A total of 128 recombinant clones obtained from Sau3 A-digested genomic libraries prepared from ovary of specific pathogen-free L. vannamei were sequenced; 86 of which contained simple sequence repeats (SSRs), or microsatellites, with three or more repeat motifs. The frequency of microsatellites with five or more repeats was estimated at 1/2.74 kb. The most abundant di-, tri, tetra-, penta-, and hexa-nucleotide motifs were [(CT).sub.n], [(CCT).sub.n] and [(CTT).sub.n], [(CATA).sub.n], [(CTTCT).sub.n], and [(GAGATA).sub.n]. The octa-nucleotide [(CCCTCTCT).sub.3] was also identified. Sixty-two primer sets flanking microsatellites with single or multiple motifs were designed and tested for polymorphism with a small test panel representing individuals of the mapping families being used to develop a linkage map for L. vannamei (Shrimp Map), and 35 of these (56.4%) were polymorphic. Three of these markers (TUGAPv1-3.224, TUGAPv5-7.33, and TUGAPv7-9.17) were used for estimating allele diversity of wild populations of Ecuador and Mexico and tracing the pedigree in two families of the USMSFP breeding program. A large number of alleles (21-31) and allele size range (95-275 bp) was observed in wild shrimp. There was a large allele size range difference at all three loci examined, being smaller in cultured shrimp (32-74 bp) than in wild shrimp (77-180 bp), suggesting null alleles or mutations. The presence of stuttering bands with marker TUGAPv5-7.33 made it difficult to score the wild shrimp from Mexico and suggest the need to first test for inheritance pattern of shrimp microsatellites before using them in population genetics, relatedness/kinship, and traceability studies. Allele segregation in cultured shrimp confirmed codominant inheritance of markers. Observed heterozygosity was 100% for all loci scored. Fourteen randomly selected polymorphic markers were further genotyped with the entire IRMF panel and 8 of these amplified with most of the individuals tested. Linkage analysis using CRIMAP with LOD score of 5.0 placed four of the markers (TUGAPv1-3.132, TUGAPv3-5.213, TUGAPv7-9.179, and TUGAPv7-9.95) in linkage groups LG6, LG5, LG13, and LG14, respectively, and four markers (TUGAPv3-5.271, TUGAPv3-5.391, TUGAPv7-9.94, and TUGAPv7-9.226) remained unlinked. In summary, 35 new microsatellites were developed for L. vannamei, some of which are useful for studies on genetic diversity of wild and cultured stocks, pedigree tracing in breeding programs, and linkage mapping. Moreover, some of the genomic sequences reported here had significant homology to hypothetical proteins of various organisms, known (e.g., reverse transcriptase) or unknown genes, or no homology to any sequence in the GeneBank database, suggesting that sequences from a genomic library can also provide valuable information in identifying functional markers in shrimp.

KEY WORDS: simple sequence repeats (SSRs), expressed sequence tags (EST), EST- SSRs, microsatellites, Litopenaeus vannamei, Shrimp Map, transposable elements, non-LTR retrotransposons, reverse transcriptase

INTRODUCTION

Various selective breeding programs for penaeid shrimp have been established to genetically improve cultured stocks (reviewed in Argue & Alcivar-Warren 1999), which may help eliminate overfishing in the wild (Naylor et al. 2000). One such program, developed by the U.S. Marine Shrimp Farming Program Consortium (USMSFP), maintains specific pathogen-free (SPF) captive populations of Pacific whiteleg shrimp, Litopenaeus vannamei, for distribution to shrimp producers (Lotz et al. 1995, Moss et al. 1999, Argue et al. 2002). The USMSFP first began domestication of L. vannamei free of Infectious Hypodermal and Hematopoeitic Necrosis Virus (IHHNV) (Lotz et al. 1995, Alcivar-Warren et al. 1997, Carr et al. 1997). Later, when Taura Syndrome Virus (TSV) emerged as a major problem for the industry (Lightner et al. 1997), the same stocks were used to selectively breed for TSV resistance and other economically important traits like high growth and survival under near zero water exchange and low salinity conditions (Argue & Alcivar-Warren 1999, Moss et al. 1999, Argue et al. 2002, Xu et al. 2003a). To better understand these traits and increase the rate of genetic improvement in shrimp breeding programs, the loci responsible for them need to be identified for further use in marker-assisted selection. To do this, a large number of highly polymorphic genetic markers are needed to develop a framework linkage map for shrimp.

Simple sequence repeats, or microsatellites, are the markers of choice for genetic analysis and gene mapping of agricultural species because of their abundance, high levels of polymorphism, Mendelian inheritance and codominant expression (Wright & Bentzen 1994, O'Reilly & Wright 1995, Ozaki et al. 2000). In shrimp, a small number of microsatellites has been developed for various penaeid species (Garcia et al. 1996, Bagshaw & Bucholt 1997, Ball et al. 1998, Tassanakajon et al. 1998, Vonau et al. 1999, Moore et al. 1999, Pongsomboon et al. 2000, Xu et al. 1999, Cruz et al. 2002, Maggioni et al. 2003, Meehan et al. 2003, Wuthisuthimethavee et al. 2003a) and have mostly been used in population genetic studies (Garcia et al. 1994, Brooker et al. 2000, Xu et al. 2001, Ball & Chapman 2003, Maggioni et al. 2003), genetic relationships (Xu et al. 2003a), pedigree tracking and genetic diversity in breeding programs (Wolfus et al. 1997, Moore et al. 1999, Vonau et al. 1999), and gene mapping efforts (Moore et al. 1999, Alcivar-Warren et al. 2002, Wuthisuthimethavee et al. 2003b). Additional markers are needed for differentiating stocks of breeding programs, tracking pedigrees, studying fitness and genetic diversity of natural populations, mapping quantitative trait loci in penaeid shrimp, and traceability of imported shrimp. The specific objectives of this study are (1) to isolate and characterize microsatellite genetic markers isolated from genomic libraries of SPF L. vannamei, (2) to demonstrate the usefulness of three randomly selected markers to examine allelic variation in wild and cultured shrimp populations, and trace the pedigree of two families from the selective breeding program developed by the USMSFP, and (3) to determine potential usefulness of these microsatellites for linkage mapping.

MATERIALS AND METHODS

Construction and Screening of Genomie Libraries

The procedures for library construction and screening were as performed by Mr. Doug Holder in the laboratory of Dr. Scott Davis, TX A&M University, College Station, TX (pers. comm.) with minor modifications. Briefly, 10 [micro]g of ovary DNA was partially digested with 20 units of Sau 3A (Gibco BRL) restriction enzyme at 37[degrees]C for one hour. At the same time, the vector pBluescript II SK+ (Strategene) was digested with Bam HI (Gibco) following manufacturer's instructions. Digested DNA was electrophoresed on a 0.8% agarose gel in TAE (0.8 M Tris, 0.4 mM glacial acetic acid and 0.4 mM EDTA) (Garcia et al. 1994), and four different band ranges of approximately 100-300 (1-3) bp, 300-500 (3-5) bp, 500-700 (5 7) bp and 700-900 (7-9) bp were eluted using Spin-X columns (Costar, MA). DNA was precipitated with 3M sodium acetate (pH 5.2) and 100% ethanol. The 5' phosphate groups were removed using 5 units of calf intestinal alkaline phosphatase (Promega) and 10 mM Tris-HCl at 37[degrees]C for 45 min. Proteins in the mixture (100 [micro]l) were degraded by adding 2.5 [micro]l of 0. l% SDS, 1 [micro]l of 0.5 mM EDTA and 1 [micro]l 10 mg/mL Proteinase K, and incubating at 55[degrees]C for 30 min, and removed with phenol/ chloroform extraction. The four DNA fractions were each combined with an equal molar amount of digested pBluescript II SK+ vector and ethanol precipitated. The resulting DNA/ vector pellet was ligated with T4 DNA ligase (Promega) at 15[degrees]C for 18 h and transformed into DH5[alpha] competent cells (Gibco) following manufacturer's instructions. Transformed cells were each grown on plates containing LB/ampicillin/ IPTG/Bluo-Gal at 37[degrees]C overnight. The recombinant white colonies were streaked onto new plates, and also onto nylon membranes (MSI, Westboro, MA) and allowed to grow on the nylon filters for an additional 4-10 h. Filters were prehybridized in 20 mL of hybridization solution (5 x SSC, 0.5% SDS, 25 mM potassium phosphate [0.5 M KHzPO4, 0.5 M [K.sub.2]HP[O.sub.4], pH 6.5] and 5 x Denhardts] and incubated for 1 h at 65[degrees]C. Probes were labeled using [gamma]-[sup.32]P ATP and the 5'-end labeling exchange reaction (Gibco). Probes were sequentially labeled as follows: [(GT).sub.15], [(CT).sub.15], [(AT).sub.15)], [(CG).sub.15], [(GTG).sub.5] and a microsatellite, M2, found in previous work (Garcia et al. 1996). Probe hybridizations were performed at 37[degrees]C overnight using the same prehybridization solution. Filters were washed once in solution I (0.2% SDS, 2 x SSC) for 15 min at room temperature, once in solution II (0.1% SDS, 1 x SSC) for 15 min at room temperature and then once in solution iI for 20 min at 42[degrees]C. The positively identified clones were grown overnight and DNA isolated following standard procedures (Garcia et al. 1996, Meehan et al. 2003). Filters were stripped of the previous probe by placing the membranes in a boiling solution containing 0.1% SDS, 0.1 x SSC and gently shaken for 30 min.

DNA Sequencing, Microsatellite Characterization and Homology Searches

Positive plasmid clones were sequenced using either a manual protocol (Promega protocol VI of the fmol sequencing kit) or an ABI 377 DNA sequencer at the DNA Sequencing Facility of Tufts University, Boston, MA. The sequencing reaction and cycle conditions for manual protocol were as suggested by the manufacturer: 95[degrees]C for 2 min, then: 95[degrees]C for 30 sec, 44[degrees]C for 30 sec, and 70[degrees]C for 1 min for 30 cycles. Sequencing gels were run following standard procedures (Garcia et al. 1996) and the autoradiograms read by two different people to confirm the sequence. Some plasmids were sequenced using the forward and reverse primers of M13 and electrophoresed at least twice, from 4-12 h, to obtain unique sequences on either side of the microsatellite. All motifs with three or more repeats were counted as microsatellites (Meehan et al. 2003). These researchers reported amplification of 51 out of 93 polymorphic microsatellites that contained single or multiple motifs of less than six repeats each, greatly increasing the number of useful markers. To compare with microsatellites frequencies reported in previous studies, motifs with 5 or more repeats, and 10 or more repeats were also counted (Xu et al. 1999, Meehan et al. 2003).

To identify potential genes and proteins in the shrimp genome, sequence homology comparisons were performed using Blastn and Blastx run against the currently available GenBank sequences (GenBank flat file release 158, February 15, 2007) based on a cut-off E-value of [E0] < 0.005.

Animals Used in This Study

Wild L. vannamei juveniles (n = 24) originated from Oaxaca, Mexico (candidate-SPF Population 4) and adult females (n = 24) from Salinas, Ecuador. Cultured shrimp originated from two SPF families (#1.4 and #1.5) of Population l and consisted of two parents and 15 and 14 third-generation offspring each, respectively. Population 1 originated from Sinaloa, Mexico and has contributed to the development of the current "Kona" Line (also called Research Line, Reference Line, or TSV-susceptible Line); High Growth Line, and TSV-resistant Line of the USMSFP (Xu et al. 2003a).

Microsatellite Amplification and Scoring

The Primer3 program (Rozen & Skaletsky 1996, Rozen & Skaletsky 1997), as well as visual editing, was used to design primer sets flanking one or more motifs within a clone. Primer sets chosen were based on the uniqueness of sequences and percentage of GC content. Primers were synthesized (Operon Technologies Inc., Alameda, CA, or Integrated DNA Technology, Inc., Coraville, IA) and used to amplify alleles in DNA (100 ng) from wild and cultured shrimp. The forward and reverse oligonucleotide primer sequences are listed in Table 1.

Polymerase chain reaction (PCR) mixture (25 [micro]L) generally contained 100 ng DNA, 7.5 ng of [gamma]-[sup.32]p-ATP labeled reverse primer, 50 ng of forward primer, 2.0 mM Mg [Cl.sub.2], 0.2 mM of dNTPs, 2.5 units of Taq polymerase (Promega, WI), and 1x buffer. Thermal cycler (PTC-100, MJ Research, MA) profile was: 94[degrees]C for 3 min, followed by 21 cycles of 94[degrees]C for 1 min, 52[degrees]C for 1 min, and 72[degrees]C for 2 min and ran for 21 cycles (Wolfus et al. 1997). Polyacrylamide gel electrophoresis of amplified products was performed using standard laboratory procedures. Samples were run next to a known sequence (B20; Garcia et al. 1996) to provide estimates of allele sizes. Some primer sets did not amplify DNA at the 52[degrees]C annealing temperature and were tested by varying the concentrations of Mg[Cl.sub.2] in different annealing temperature conditions. Three markers (TUGAPv1-3.224, TUGAPv5-7.33, and TUGAPv7-9.17) were used at 44[degrees]C (after optimization of annealing temperature conditions) to examine genetic diversity in wild and cultured shrimp. A microsatellite was regarded as polymorphic when the frequency of the most common allele was equal to or less than 0.99 (Nei 1987). Theoretical or expected heterozygosity levels were calculated as in Nei and Roychoudhury (1974) to adjust for small sample size ([h.sub.e] = 1 - [SIGMA][p.sub.i.sup.2] [2N/(2N - 1)]) where [p.sub.i] is the ith allele frequency and N = sample size. Observed heterozygosity was calculated based on the number of heterozygotes in a population divided by the total number of individuals analyzed in that population.

Linkage Mapping

The polymorphism status of a marker was first examined using a small test panel consisting of DNA from eight offspring of the International Reference Mapping Family (IRMF), which is being used to develop a framework linkage map for L. vannamei (Shrimp Map) and eight parental broodstock of four Resource Mapping Families (RMF) being used for identifying candidate genes associated with resistance to TSV (Alcivar-Warren et al. 2002). Genotyping was performed using a [sup.32]P-based assay (Meehan et al. 2003). The polymorphic markers were then genotyped with the entire IRMF panel using either the [sup.32]P-based assay or a protocol modified from the user's manual of ABI PRISM 377 DNA sequencer (Alcivar-Warren et al. 2007a, Alcivar-Warren et al. 2007b). Briefly, PCR mixture consisted of 0.3 [micro]M (20 ng) template DNA, 0.333 [micro]M reverse primer (fluorescently labeled with 6-FAM, TET, or HEX), 0.333 [micro]M forward primer, 0.125 mM dNTPs, 0.04 U/[micro]L Taq polymerase (Promega), 2.5 mM MgCl2 and 1x buffer in a total of volume of 15 [micro]L. The following PCR profile was used in a MJ Research thermocycler PTC-100: 95[degrees]C for 12 min. followed by 30 cycles of 94[degrees]C for 1 min., annealing temperature for 1 min., 72[degrees]C for 2 min. and ending with 72[degrees]C for 30 min. The amplified products were then multiplexed by combining HEX (3 [micro]l), TET (2 [micro]L) and 6-FAM (2 gL) PCR product. Three gl of loading mix (250 [micro]L of deionized formamide, 50 [micro]L of GeneScan-500, and 25 [micro]L of loading buffer) and 1 [micro]L of the multiplexed PCR product were combined and used in loading the gel. After the ABI run was complete, GeneScan[R] Analysis Software processes the gel image. This was also manually checked (binned) to make sure all lanes used in the gel lined up properly and the size standard was applied appropriately. Once the gel image was processed, the information was exported into GenoTyper[R] Software which assigns sizes to the amplified product in each lane based on the size standard used. All genotypic results were compiled in an excel sheet and checked manually for potential genotyping errors. The allele sizes of amplified products were confirmed by two different researchers. The allele data obtained from the IRMF panel was examined using CRIMAP software with a limits-of-detection (LOD) score of 5.0 to accurately identify linkage groups and determine marker order "Alcivar-Warren et al. 2007a).

RESULTS AND DISCUSSION

Library Cloning and Characterization of Microsatellites

One hundred and thirty-four positive clones were identified after hybridization with di- and trinucleotide probes from ~1,400 recombinant colonies obtained from four sized-fractionated genomic libraries. The distribution of positive clones is shown in Table 2. Probes [(GTG).sub.5] and [(CG).sub.15] did not hybridize to any of the clones. The library with the largest inserts (700-900 bp) had the greatest percentage (18.4%) of positive clones when compared with the number of colonies screened for this library. Only 4% of the clones were positive in the 100-300 bp library and 8.0% and 9.2% were positive in the 300-500 and 500-700 bp library, respectively (Table 2).

Out of the 134 positive clones, 128 sequences were used for analysis, 83 of which contained microsatellite motifs of three or more repeats, 3 had no microsatellites, and 42 were either identical to each other, contained too many "N"s, could not be sequenced, or contained less than 50 nucleotides. Three of the 83 clones were sequenced from both ends, providing a total of 86 different sequences for further analysis. The GenBank accession numbers for the 86 sequences are AF006629-AF006631 and AY376912-AY376997 (Table 3). Overall, results indicated that only 5.9% (83/1400) of the positive clones actually contained microsatellite repeat motifs which is less than the 11.7% reported for another L. vannamei library (Meehan et al. 2003).

A total of 340 microsatellite arrays were present in the 86 sequences, consisting of 312 di-, 19 tri, 31 tetra-, 4 penta-, 4 hexa- and, 1 octanucleotide motifs; alone or in combination; with three or more repeats (Table 3). Most of the motifs (n = 371) consisted of three or more repeats, whereas 178 motifs had five or more repeats and 104 consisted of 10 or more repeats. The most abundant di-, tri, tetra-, penta-, and hexa-nucleotide motifs were CT, CCT and CTT, CATA, CTTCT, and GAG ATA. The octanucleotide [(CCCTCTCT).sub.3] was also identified.

Out of the 312 di-nucleotides motifs identified in these libxraries, 43% were CT (n = 147), followed by GT with 33% (n = 104), AT with 16% (n = 49) and CG with 3.8% (n = 12). These results are similar to those reported for L. vannamei (Meehan et al. 2003) and hymenopteran species like the yellowsjacket wasp and humble bee (Thoren et al. 1995) but different from those published in D. melanogaster (Schug et al. 1998) and most vertebrate species that found GT microsatellites to be the most abundant, followed by CT (Weber 1990, Estoup et al. 1993, Brooker et al. 1994). Interestingly, the 100-300 bp library only had CT (n = 19) positive clones (Table 2).

The number (n = 19) of trinucleotides reported here is lower than the number (n = 139) identified in another L. vannamei library (Meehan et al. 2003). The high number of CTT (n = 6) and CCT (n = 6) repeats found in this study may be attributed to hybridization with CT probe. [(CTT).sub.n] was also one of the first microsatellite motifs isolated from a RAPD (B20) marker in L. vannamei (Garcia et al. 1996).

Tetra-nucleotide repeats (n = 31) were more abundant than trinucleotide repeats (n = 19) in this L. vannamei library, contrary to results from Meehan et al. (2003) for the same species, but similar to findings in both human and murine species (Astolfi et al. 2001). Tetra-nucleotide motifs included CATA (n = 7), CTTT (n = 6), CGCA (n = 6), and GACA (n = 3) among others. The [CTTT.sub.n] repeat was also isolated as part of M1 microsatellite (RAPD B20 locus), a highly polymorphic marker that has been used to study genetic diversity of wild and cultured shrimp and track the pedigree of the USMSFP breeding program (Garcia et al. 1996, Wolfus et al. 1997) and examine allele frequency differences in TSV-resistant and TSV-susceptible shrimp (Xu et al. 2003a).

There were only 4 penta-nucleotide repeats in this library (2 CTTCT, 1 CCTTT and 1 AACCT), which was lower than the 35 reported for L. vannamei after probe hybridization of another ovarian genomic library (Meehan et al. 2003). Direct sequencing of all the clones obtained from the Meehan et al. (2003) library identified a large number of AACCT repeats in L. vannamei genome (Alcivar-Warren et al. 2002, 2006b and unpublished data). These pentanucleotide repeats appear to be the telomere sequences at ends of L. vannamei chromosomes and are also the site of introgression of telomere-specific retrotransposons in some insect and other arthropod species (Alcivar-Warren et al. 2006a). Similar AACCT repeats were reported by Bagshaw and Bucholt (1997). No AACCT repeats have been identified in P. monodon genomic libraries (Xu et al. 1999, Tassanakajon et al. 1998, Wuthisuthimethavee et al. 2003a).

Length and Frequency of Shrimp Microsatellites

Many of the shrimp microsatellites reported here contained three or more repeat motifs, but some contained up to 51 uninterrupted repeats. Indeed, 41 (47.7%) of the 86 sequences contained 25 or more uninterrupted repeats and 13 sequences contained 45 or more uninterrupted repeats, which differs from the mostly short repeats reported previously in L. vannamei (Meehan et al. 2003). Microsatellite repeats longer than 47, 60, and, 33 have been identified in rainbow trout, Atlantic cod and Atlantic salmon, respectively (Slettan et al. 1993, Brooker et al. 1994). In mammals, however, the longest size class ranged from 23-30 repeats (Weber 1990, Table 1 in Brooker et al. 1994).

The overall frequency of L. vannamei microsatellites with three or more repeats was 1/1.35 (Table 4), similar to that reported by Meehan et al. (2003). Di-nucleotides with three or more repeats had the highest frequency in this library, followed by tetra-nucleotide microsatellites. Among the di-nucleotides with three or more repeats, the frequencies of CT, GT, AT, and CG were 1/3.30 kb, 1/4.66 kb, 1/9.88 kb, and 1/40.37 kb, respectively, as reported in Meehan et al. (2003). Similar frequencies for CT (1/2.5 kb) and GT (1/8 kb) were found in yellow jacket wasp (Thoren et al. 1995). In D. melanogaster, however, GT was the most abundant microsatellite in arrays of five or more repeats, followed by TA (Schug et al. 1998). The frequencies of CT and GT reported here for L. vannamei are higher than those found in P. monodon (Tassanakajon et al. 1998, Brooker et al. 2000). Tassanakajon et al. (1998) found a low frequency of [(GT).sub.n], (1/93 kb), and [(CT).sub.n] (1/164 kb) in microsatellites with six or more repeats. Brooker et al. (2000) also reported a low frequency of [(GT).sub.n], (1/164 kb), and (CT)n (1/1,200 kb) in P. monodon. It is possible that CT is most abundant because of the number of clones that tested positive to the [(CT).sub.15] probe. However, only one clone tested positive to [(AT).sub.15] probe but there are 49 motifs being accounted for, suggesting caution when analyzing microsatellites obtained after probe hybridization.

Microsatellite Allelic Diversity in Wild and Cultured L. vannamei

Three microsatellites (TUDGLv1-3.224, TUDGLv5-7.33, and TUDGLv7-9.17) were used for genotyping in wild and cultured shrimp. In wild shrimp, these markers showed a large number of alleles for each locus, ranging from 21-31, as well as a large size range for each locus, from 90 bp to 275 bp (Table 1). In shrimp from Mexico and Ecuador, there were 25 and 21 alleles at locus TUDGLv1-3.224, and 26 and 31 alleles at locus TUDGLv7-9.17, respectively. The shrimp of Mexico was not scored for locus TUDGL5-7 33R because the amplification profiles contained many stuttering bands and it was difficult to determine the actual allele size, suggesting that this marker should not be used for population genetic analysis. The wild shrimp from Ecuador had 31 alleles at locus TUDGL5-7.33.

The highest frequency for any allele (excluding null alleles) was 0.14. However, this was only for one allele at the TUDGLv1-3.244 locus. All other alleles had frequencies of less than 0.10, the majority ranging from 0.02-0.04. Because of the low frequency, the probability of having a homozygote for any one allele is very small, therefore, individuals that showed only one allele were considered to be heterozygous for a null allele. These null alleles could occur if a mutation in one or both of the priming sites has arisen, as shown for L. vannamei using microsatellite M1 of B20 locus (Wolfus et al. 1997). With this assumption, the observed heterozygosity was 100% for Mexican and Ecuadorian stocks. The expected heterozygosity levels were slightly lower or equal to the observed values (97% to 100%). Relatively high heterozygosities using microsatellites have also been reported in wild P. monodon of Australia, Thailand, and Philippines (Brooker et al. 2000, Supungul et al. 2000, Xu et al. 2001), P. schimitti of Brazil (Maggioni et al. 2003) and P. setiferus of the United States (Ball & Chapman 2003). In wild L. vannamei from Mexico to Panama, however, observed heterozygosities ranged from 0.241-0.388 (Valle-Jimenez et al. 2004). The presence of stuttering bands with marker TUGAPv5-7.33 made it difficult to score the wild shrimp from Mexico. Considering potential null alleles for this and other markers, perhaps we should first test for inheritance pattern of shrimp microsatellites before using them in population genetics, relatedness/kinship, and traceability studies.

In cultured shrimp, high levels of allele diversity were found with the three microsatellites in the two SPF families studied, even though they are third-generation captive bred. Allele sizes ranged from 121 bp to 183 bp at locus TUDGLv5-7.33, 163-225 bp at locus TUDGLv1-3.224, and 125-199 bp at locus TUDGLv7-9.17 (Table 1). All parents and offspring were heterozygous giving a 100% observed heterozygosity for each locus. All parental alleles in the two families for each locus were inherited in a Mendelian fashion, with no pedigree error detected. Results indicate that at least two of the three microsatellites tested are useful for genetic diversity studies of wild shrimp populations, and all three microsatellites are useful as a managing tool to trace and maintain quality of the pedigree and estimate allele diversity among lines of the USMSFP breeding program. The inheritance of microsatellites developed for L. vannamei by Meehan et al. (2003) have also been reported in two other selectively bred families of L. vannamei maintained in a breeding program in China (Zhang & Xiang 2005). Other microsatellites have also been developed for pedigree tracing and genetic diversity analysis of L. vannamei from the USMSFP breeding program (Wolfus et al. 1997, Xu et al. 2003a, Steinberg et al. 2004, Alcivar-Warren et al. 2006b) and other breeding programs of L. vannamei and other penaeid species (Vonau et al. 1999, Moore et al. 1999, Sugaya et al. 2002, Cruz et al. 2004, Zhang & Xiang 2005).

There seems to be a very large size range for alleles at each locus in wild and cultured shrimp (Table 1). In wild shrimp, the largest allele size range differences between the largest and smallest allele sizes at locus TUGAPv7-9.17 were 178 bp and 180 bp for shrimp of Mexico and Ecuador, respectively. The smallest allele size differences at locus TUDGLv1-3.224 in wild shrimp of Mexico and Ecuador were 87 bp and 77 bp, respectively. In cultured shrimp, however, the allele size range differences at all three loci examined was smaller (32-74 bp) than in wild shrimp (77-180 bp). The larger size range differences observed in wild shrimp would occur if there were null alleles or a high mutation rate in these sequences. An average mutation rate of 5.0 x [10.sup.3] with a 95% CI of 2.4 x [10.sup.-3] 7.6 x [10.sup.-3] has been reported for other L. vannamei microsatellites (Xu et al. 2003b), which falls within the range of [10.sup.-2] to [10.sub.-6] reported for other species. Results indicate that inheritance patterns, null alleles, and mutation rate of microsatellite markers should first be tested before using them on population genetic, kinship/individual relatedness, or traceability studies.

Microsatellite Polymorphism in Mapping Families

Fifty nine (71.1%) of the microsatellite loci had unique flanking sequences to design primers covering all the motifs included in the clones (Table 3). These results were similar to those found in L. vannamei (Meehan et al. 2003, Alcivar-Warren et al. 2006a), P. monodon (Xu et al. 1999), and P. stylirostris (Vonau et al. 1999) but different from results in P. japonicus (Moore et al. 1999) and P. monodon (Tassanakajon et al. 1998, Pongsomboon et al. 2000, Brooker et al. 2000).

In an effort to increase the number of polymorphic markers for mapping studies, 62 primer sets were designed that included single or multiple motifs with three or more repeats (Meehan et al. 2003). Thirty five (56.4%) of the 62 primers successfully amplified scorable, polymorphic bands in DNA from stocks of the reference and resource mapping families, with allele sizes ranging from 67 bp to 323 bp. The remaining primer sets were either monomorphic (n = 1) or did not amplify at the annealing temperature used or amplified many unscorable bands (n = 26). Further optimization of allele amplification conditions for the 26 clones listed as N/NA in Table 3 may increase the number of useful markers from this genomic library. These results differ from those of other researchers who have suggested limitations for using genomic microsatellite markers for genetic mapping and other genetic studies (reviewed in Meehan et al. 2003). The polymorphic markers reported here for L. vannamei add to the growing number of SSR markers isolated for this species from both genomic (Cruz et al. 2002, Meehan et al. 2003, Alcivar-Warren et al. 2006a, Jia et al. 2006, Freitas et al. 2007) and cDNA libraries (Van Wormhoudt & Sellos, 1996, Alcivar-Warren et al. 2003, Perez et al. 2005, Wang et al. 2005, Wuthisuthimethavee et al. 2003b; Maneeruttanarungroj et al. 2006, Dhar et al. 2007, Alcivar-Warren et al. 2007b), and will be useful to develop a high-density linkage map for penaeid shrimp species.

Linkage Analysis

Out of the 35 polymorphic markers, 14 were randomly selected for genotyping with the entire IRMF panel of Shrimp-Map and 8 of these amplified in most of the individuals tested and were used for linkage analysis. CRIMAP analysis with LOD score of 3.0 placed three of the polymorphic markers (TUGAPv3-5.213, TUGAPv7-9.179, and TUGAPv7-9.95) on to linkage groups LG5, LG13, and LG14 of Shrimp Map, respectively, with five markers unlinked. Six markers did not amplify well in offspring of the IRMF panel and will be repeated. However, when linkage analysis was performed using CRIMAP with LOD score of 5.0 (Fig. 2 of Alcivar-Warren et al. 2007a), an additional marker (TUGAPv1-3.132) was placed in Shrimp Map's LG6 and four markers (TUGAPv3-5.271, TUGAPv3-5.391; TUGAPv7-9.94; TUGAPv7-9.226) remained unlinked (Table 3, in bold).

Many of the 35 polymorphic markers developed from this library had null alleles, including four of the eight markers tested with the entire mapping panel and used for CRIMAP analysis [TUGAPv3-5.213 (LG5), TUGAPv3-5.271 (unlinked), TUGAPv7-9.94 (unlinked), and TUGAPv7-9.179 (LG13)], suggesting that markers with null alleles can be useful for linkage mapping. Current efforts focus on optimization of amplification conditions for other potential microsatellites developed from this and other genomic libraries to increase density of ShrimpMap and provide a more accurate estimate of the genome size of L. vannamei and other penaeid species. Considering the high cost of developing microsatellite markers, efforts should be directed to development of EST-SSRs and SNP markers for mapping.

Sequence Comparisons: non-LTR Retrotransposon Reverse Transcriptase and Other Genes

Homology sequence comparison using Blastn against the EST databases showed similarities to only the repeats present in ESTs of unknown function or known genes from other species. Homology searches using Blastx showed that 49 of our genomic clones were similar to hypothetical or unknown proteins of various organisms, 16 were similar to known genes (retinitis pigmentosa GTPase regulator, RNA binding motif protein 25, integrin beta-like, hydroxyproline-rich glycopreotein precursor, etc.), and 24 sequences had no homology to any sequence in the public database. Four of the markers placed on Shrimp Map (TUGAPv1-3.132, TUGAPv3-5.391, TUGAPv7-9.179, and TUGAPv7-9.226) had no homology to any sequence in the Genbank database and thus represent novel sequences in the shrimp genome.

Our clone TUGAPv7-9.28 (AY376973) showed partial homology (53-119 nt) to motifs of RNA-directed DNA polymerase (reverse transcriptase) gene from various species including Leishmenia infantum (XP_001465072) and P. monodon (ABB73282.1). Partial homology to similar motifs of Leishmenia infantum (XP_001465072) were found in eight additional clones from this library. Presence of reverse transcriptase gene is usually indicative of active transposable elements such as a non-LTR (long terminal repeat) retrotransposons. A large number of clones with similarities to motifs of non-LTR retrotransposon reverse transcriptase gene and other transposable elements were also identified in sequences from another genomic library cloned from ovary of SPF L. vannamei (Meehan et al. 2003, Alcivar-Warren et al. 2006a) and from a cDNA library of whole shrimp challenged with White Spot Syndrome Virus (Alcivar-Warren et al. 2007b). The first report of transposable elements in penaeid shrimp originated from 66 sequences of a genomic library of P. monodon (Xu et al. 2004). Using Blastn against nr databases, these researchers identified homologies to portions of four known genes (sbm and Rfe genes of E.coli, 18s rRNA, and O1GC3 sensory organ-specific membrane guanylyl cyclase) and three uncharacterized sequences, whereas sequence comparison against EST databases identified three genes (methy-malonyl-COA mutase, 18s rRNA, and hemocyte-glutamine gamma-glutamyl transferase) and three uncharacterized sequences. Using Blastx, Xu et al. (2004) identified 1 hypothetical protein, 2 uncharacterized sequences, and 9 known homologs, 7 of which were similar to transposable elements of other species (three transposable-like elements from Culexpipiens and Drosohpila, a sbm protein metal binding cobalt from E. coli, two reverse transcriptase Penelope-related retrotransposons from Schistosoma and Drosophila, a lipopolysaccharide biosynthesis protein wzzE from E. coli, a non-LTR retrotransposon from Schistosoma, and a reverse transcriptase-like protein from Bos taurus). Results indicate that in silico data mining approach using sequences from genomic libraries of L. vannamei and P. monodon (this study and Xu et al. 2004), especially using Blastx, provide valuable information in identifying transposable elements and other expressed genes in shrimp that would be useful for shrimp linkage and comparative mapping studies.

In summary, results demonstrate that useful microsatellite genetic markers can be obtained from Sau3 A-digested genomic libraries of L. vannamei, some of which are useful for population genetic analysis and pedigree tracing in breeding programs. They also provide an abundance of variation from which to develop a high-density linkage map for shrimp. Moreover, some of the polymorphic markers had significant homology to various hypothetical and known proteins in the GeneBank database and suggest that sequences from a genomic library can also provide valuable information in identifying functional markers in shrimp.

ACKNOWLEDGMENTS

The authors thank Maura Faggart, Julie Gonsalves, and Kelly Johnson for assistance with shrimp DNA extraction; Will Carr, Jim Sweeney, Fernanda Calderon, Steve Arce, and all the technical staff at the Oceanic Institute in Honolulu, Hawaii for provision of SPF shrimp; John Dooley for plasmid DNA preparation for sequencing; Dawn Meehan-Meola, Zhenkang Xu, Gladys Zuniga, and John Dooley for assistance in determining usability of markers; Dawn Meehan-Meola and Zhenkang Xu for assistance with genotyping in the reference mapping family and linkage analysis; Se Won Park for confirming linkage status and reading the manuscript; David Garriques and Gorky Arevalo from Graujas Marinas E1 Rosario S.A., Salinas, Ecuador for access to wild shrimp; Kireina Bell for editing the cloned sequences, and William B. Warren for assistance with homology searches. Giovanni Widmer, John Dooley, Arun Dhar, Zhenkang Xu and Dawn Meehan-Meola provided useful comments to an earlier draft of the manuscript. This work was supported in part by a grant (#98-388-1424) from the U.S. Department of Agriculture to the U.S. Marine Shrimp Farming Program Consortium (A-W), the Curriculum Program and the Department of Environmental and Population Health, Tufts University School of Veterinary Medicine (A-W), the Rockefeller Brothers Fund Inc NY (A-W), and NOAA National Sea Grant College Program Office, Department of Commerce, under grants No. NA90-AA-D-SG480, Woods Hole Oceanographic Institution Sea Grant Project No. R/A-28-PD-New Initiatives Program (A-W). The views expressed herein are those of the authors and do not necessary reflect the views of NOAA.

LITERATURE CITED

Alcivar-Warren, A., R. Overstreet, A. K. Dhar, K. Astrofsky, W. Carr, J. Sweeney & J. Lotz. 1997. Genetic susceptibility of cultured shrimp (Penaeus vannamei) to Infectious Hypodermal and Hematopoeitic Necrosis Virus and Baculovirus penaei: Possible relationship with growth status and metabolic gene expression. J. Invert. Path. 70: 190-197.

Alcivar-Warren, A., Z. Xu, D. Meehan, Y. Fan & L. Song. 2002. Shrimp genomics: development of a genetic map to identify QTLs responsible for economically important traits in Litopenaeus vannamei. In: N. Shimizu, T. Aoki, I. Hirono & F. Takashima, editors. Aquatic Genomics: Steps Toward a Great Future. Tokyo, Japan: Springer-Verlag. pp. 61-72.

Alcivar-Warren, A., L. Song, D. Meehan, B. Poulus, D. Lightner, J. Xiang & Z. Xu. 2003. Mapping simple sequence repeat markers identified in ESTs from a subtracted cDNA library of White Spot Virus-challenged shrimp Penaeus (Litopenaeus) Vannamei. Book of Abstracts, World Aquaculture Society Meeting, May 18-23, Salvador Brazil. Abstract.

Alcivar-Warren, A., D. Meehan-Meola, Y. Wang, X. Guo, L. Zhou, J. Xiang, S. Moss, S. Arce, W. Warren, Z. Xu & K. Bell. 2006a. Isolation and mapping of telomeric pentanucleotide [(TAACC).sub.n] repeats of the Pacific whiteleg shrimp, Penaeus vannamei, using fluorescent in situ hybridization. Mar. Biotechnol. 8:467-480. (NY)

Alcivar-Warren, A., D. Meehan-Meola & Xu. Z. 2006b. ShrimpTest12a panel of genetic markers for genetic analysis of cultured and wild shrimp. Book of abstracts. Aquaculture America 2006, Los Vegas, February 13-17, 2006. Abstr. 400.

Alcivar-Warren, A., D. Meehan-Meola, S. W. Park, Z. Xu & M. Dlaney. 2007a. ShrimpMap: a microsatellite-based low-density linkage map for the Pacific whiteleg shrimp, Litopenaeus vannamei: Identification of sex-linked markers in linkage group 4. J. Shellfish Res. (This issue).

Alcivar-Warren, A., L. Song, D. Meehan-Meola, Z. Xu, B. Poulos, D. Lightner, J. Xiang & W. Warren. 2007b. Characterization and linkage mapping of expressed sequence tags (ESTs) isolated from a subtracted cDNA library of Pacific whiteleg shrimp, Litopenaeus vannamei, injected with White spot syndrome virus. J. Shelfish Res. (This issue).

Argue, B. J. & A. Alcivar-Warren. 1999. Genetics and breeding applied to the penaeid shrimp farming industry. In: R. A. Bullis & G. D. Pruder, editors. Controlled and biosecure production systems. Proceedings of a special session on Evolution and Integration of Shrimp and Chicken Models at the World Aquaculture Society Meeting, April 27-30, Sydney, Australia. pp. 29-54.

Argue, B. J., S. M. Arce, J. M. Lotz & S. M. Moss. 2002. Selective breeding of Pacific white shrimp Litopenaeus vannamei for growth and resistance to Taura Syndrome Virus. Aquaculture 204:447-460.

Astolfi, P., D. Bellizzi, M. A. Losso & V. Sgaramella. 2001. Triplet repeats, over expanded in neuromuscular diseases, are underrepresented in mammalian DNA. A survey of models. Brain Res. Bull. 56:265-271.

Bagshaw, J. & M. Bucholt. 1997. A novel satellite/microsatellite combination in the genome of the marine shrimp, Penaeus vannamei. Gene 184:211-214.

Ball, A. O. & R. W. Chapman. 2003. Population genetic analysis of white shrimp, Litopenaeus setiferus, using microsatellite genetic markers. Mol. Ecol. 12:2319-2330.

Ball, A. O., S. Leonard & R. W. Chapman. 1998. Characterization of (GT)n microsatellites from native white shrimp (Penaeus setiferus). Mol. Ecol. 7:1251-1253.

Brooker, A. L., C. Cook, P. Bentzen, J. M. Wright & R. W. Doyle. 1994. Organization of microsatellites differs between mammals and coldwater teleost fishes. Can. J. Fish. Aquat. Sci. 51:1959-1966.

Brooker, A. L., J. A. H. Benzie & D. Blair. 2000. Population structure of the giant tiger prawn Penaeus monodon in Australian waters determined using microsatellite markers. Mar. Biol. 136:149-157.

Carr, W. H., K. T. Fjalestad, D. Godin, J. Swingle, J. N. Sweeney & T. Gjedrem. 1997. Genetic variation in weight and survival in a population of specific pathogen-free shrimp, Penaeus vannamei. Pages 265-271 In: T. W. Flegel & I. H. MacRae, editors. Diseases in Asian Aquaculture III, Fish Health Section, Asian Fisheries Society, Manila.

Cruz, P., C. H. Mejia-Ruiz, R. Perez-Enriquez & A. M. Ibarra. 2002. Isolation and characterization of microsatellites in Pacific white shrimp Penaeus (Litopenaeus) vannamei. Mol. Ecol. Notes 2:239-241.

Cruz, P., A. M. Ibarra, H. Mejia-Ruiz, P. M. Gaffney & R. Perez-Enriquez. 2004. Genetic variability assessed by microsatellites in a breeding program of Pacific white shrimp (Litopenaeus vannamei). Mar. Biotechnol (NY). 6:157-164.

Dhar, A. K., A. Alcivar-Warren, D. Meehan-Meola, J. M. Lotz & W. H. Carr. 2007. Linkage mapping of developmentally expressed cDNAs containing AT-rich elements in pacific whiteleg shrimp (Penaeus vannamei): differential expression after challenge with taura syndrome virus. J. Shellfish Res. In review.

Estoup, A., P. Presa, F. Krieg, D. Vaiman & R. Guyomard. 1993. (CT)n and (GT)n microsatellites: a new class of genetic markers for Salmo trutta L. (brown trout). Heredity 71:488-496.

Freitas, P. D., C. M. Jesus & P. M. Galetti, Jr. 2007. Isolation and characterization of new microsatellite loci in the Pacific white shrimp Litopenaeus vannamei and cross-species amplification in other penaeid species. Mol. Ecol. Notes 7:324-326.

Garcia, D. K., M. A. Faggart, L. Rhoades, J. A. Wyban, W. H. Carr, J. N. Sweeney, K. M. Ebert & A. Alcivar-Warren. 1994. Genetic diversity of cultured Penaeus vannamei shrimp using three molecular genetic techniques. Mol. Mar. Biol. Biotechnol. 3:270-280.

Garcia, D. K., A. K. Dhar & A. Alcivar-Warren. 1996. Molecular analysis of a RAPD marker (B20) reveals two microsatellites and differential mRNA expression. Mol. Mar. Biol. Biotechnol. 5:71-83.

Jia, Z., X. Sun, L. Liang, D. Li & Q. Lei. 2006. Isolation and characterization of microsatellite markers from Pacific white shrimp (Litopenaeus vannamei). Mol. Ecol. Notes 6:1282-1284.

Lightner, D. V., R. M. Redman, B. T. Poulus, L. M. Nuna, J. L. Mari & K. W. Hasson. 1997. Risk of spread of penaeid shrimp viruses in the Americas by the international movement of live and frozen shrimp. Rev. Sci. Tech. Off Int. Epiz. 16:146-160.

Lotz, J. M., C. L. Browdy, W. H. Carr, P. P. Frelier & D. V. Lightner. 1995. USMSFP suggested procedures and guidelines for assuring the specific pathogen status of shrimp broodstock and seed. In: C. L. Browdy & J. S. Hopkins, editors. Swimming Through Troubled Waters. Proceedings of the special session on shrimp farming, World Aquaculture Society, Baton Rouge, LA. pp. 66-75.

Meehan, D., X. Xu, G. Zuniga & A. Alcivar-Warren. 2003. High frequency and large number of polymorphic microsatellites in cultured shrimp Penaeus (Litopenaeus) vannamei. [Crustacea: Decapoda]. Mar. Biotechnol. 5:311-330. (NY).

Maggioni, R., A. D. Rogers & N. Maclean. 2003. Population structure of Litopenaeus schmitti (Decapoda: Penaeidae) from the Brazilian coast identified using six polymorphic microsatellite loci. Mol. Ecol. 12:3213-3217.

Maneeruttanarungroj C, S. Pongsomboon, S. Wuthisuthimethavee, S. Klinbunga, K. J. Wilson, J. Swan, Y. Li, V. Whan, K. H. Chu, CP. Li, J. Tong, K. Glenn, M. Rothschild, D. Jerry & A. Tassanakajon. 2006. Development of polymorphic expressed sequence tag-derived microsatellites for the extension of the genetic linkage map of the black tiger shrimp (Penaeus monodon). Anim Genet. 37:363-368.

Moore, S. S., V. A. Whan, G. P. Davis, K. Byrne, D. J. S. Hetzel & N. Preston. 1999. The development and application of genetic markers for the kuruma prawn Penaeusjaponicus. Aquaculture 173:19-32.

Moss, S. M., B. J. Argue & S. M. Arce. 1999. Genetic improvement of the Pacific white shimp Litopenaeus vannamei, at the Oceanic Institute. Global Aquacul. Advoc. 2:41-43.

Naylor, R. U, R. J. Goldburg, J. H. Primavera, N. Kautsky, M. C. M. Beveridge, J. Clay, C. Folke, J. Lubchenco, H. Mooney & M. Troell. 2000. Effect of aquaculture on world fish supplies. Nature 405: 1017-1024.

Nei, M. 1987. Molecular evolutionary genetics. New York: Columbia University Press, pp. 176-207.

Nei, M. & A. K. Roychoudhury. 1974. Sampling variances of heterozygosity and genetic distance. Genetics 76:379-390.

O'Reilly, P. & J. M. Wright. 1995. The evolving technology of DNA fingerprinting and its application to fisheries and aquaculture. J. Fish Biol. 47:29-55.

Ozaki, A., T. Sakamoto, S. Khoo, K. Nakamura, M. R. Coimbra, T. Akutsu & N. Okamoto. 2000. Quantitative trait loci (QTLs) associated with resistance/susceptibility to infectious pancreatic necrosis virus (IPNV) in rainbow trout (Oncorhynchus mykiss). Mol. Genet. Genomics 265:23-31.

Perez, F., J. Ortiz, M. Zhinaula, C. Gonzabay, J. Calderon & F. A. Volckaert. 2005. Development of EST-SSR markers by data mining in three species of shrimp: Litopenaeus vannamei, Litopenaeus stylirostris, and Traehypenaeus birdy. Mar. Biotechnol. 7:554-569. (NY).

Pongsomboon, S., V. Whan S. S. Moore & A. Tassanakajon. 2000. Characterization of tri- and tetranucleotide microsatellites in the black tiger prawn, Penaeus monodon. ScienceAsia 26:1-8.

Rozen, S. & H. J. Skaletsky. 1996, 1997. Primer 3. Code available at <http://www-genome.wi.mit.edu/genome_software/other/primer3. html>.

Schug, M. D., K. A. Wetterstrand, M. S. Gaudette, R. H. Lim, C. M. Hurter & C. F. Aquadro. 1998. The distribution and frequency of microsatellite loci in Drosophila melanogaster. Mol. Ecol. 7:57-70.

Slettan, A., I. Olsaker & O. Lie. 1993. Isolation and characterization of variable (GT)n repetitive sequences from Atlantic salmon, Salmo salar L. Anim. Genet. 24:195-197.

Steinberg, L., Z. Xu, D. Meehan, D. Moss, S. Moss & A. Alcivar-Warren. 2004. Genetic diversity and pedigree tracking of a new low salinity line of Pacific white shrimp Penaeus (Litopenaeus) vannamei using microsatellite genetic markers. Book of Abstracts. World Aquaculture Society meeting, Honolulu, Hawaii, March 1-5, 2004. Abstracts. pp. 559.

Sugaya, T., M. Ikeda, H. Mori & N. Taniguchi. 2002. Inheritance mode of microsatellite DNA markers and their use for kinship estimation in kuruma prawn Penaeus japonicus. Fish. Sci. 68:299-305.

Supungul, P., P. Sootanan, S. Klinbunga, W. Kamonrat, P. Jarayabhand & A. Tassanakajon. 2000. Microsatellite polymorphism and the population structure of the black tiger shrimp (Penaeus monodon) in Thailand. Mar. Biotechnol. 2:339-347.

Tassanakajon, A., A. Tiptawonnukul, P. Supungul, V. Rhimphanitchayakit, D. Cook, P. Jarayabhand, S. Klinbunga & V. Boonsaeng. 1998. Isolation and characterization of microsatellite markers in the black tiger prawn Penaeus monodon. Mol. Mar. Biol. Biotechnol. 7:55-61.

Thoren, P. A., R. J. Paxton & A. Estoup. 1995. Unusually high frequency of [(CT).sub.n] and [(GT).sub.n] microsatellite loci in a yellowjacket wasp, Vespula rufa (P.) (Hymenoptera: Vespidae). Insect Mol. Biol. 4:14l-148.

Valles-Jimenez, R., P. Cruz & R. Perez-Enriquez. 2004. Population genetic structure of Pacific white shrimp (Litopenaeus vannamei) from Mexico to Panama: microsatellite DNA variation. Mar. Biotechnol. 6:475484. (NY)

Van Wormhoudt, A. & D. Sellos. 1996. Cloning and sequencing analysis of three amylase cDNAs in the shrimp Penaeus vannamei (Crustacea decapoda): evolutionary aspects. J. Mol. Evol. 42:543-551.

Vonau, V., M. Ohresser, N. Bierne, C. Delsert, I. Beuzart, E. Bedier & F. Bonhomme. 1999. Three polymorphic microsatellites in the shrimp Penaeus stylirostris. Anim. Genet. 30:234-235.

Wang, H., F. Li & J. Xiang. 2005. Polymorphic EST-SSR markers and their mode of inheritance in Fenneropenaeus chinensis. Aquaculture 249:107-114.

Weber, J. L. 1990. Informativeness of human [(dC-dA).sub.n] [(dG-dT).sub.n] polymorphisms. Genomics 7:524-530.

Wolfus, G. M., D. K. Garcia & A. Alcivar-Warren. 1997. Application of the microsatellite technique for analyzing genetic diversity in shrimp breeding programs. Aquaculture 152:35-47.

Wright, J. M. & P. Bentzen. 1994. Microsatellites: genetic markers for the future. Rev. Fish Biol. Fish. 4:384-388.

Wuthisuthimethavee, S., P. Lumubol, A. Vanavichit & S. Tragoonrung. 2003a. Development of microsatellite markers in black tiger shrimp (Penaeus monodon Fabricius). Aquaculture 224:39-50.

Wuthisuthimethavee, S., P. Lumubol, A. Vanavichit & S. Tragoonrung. 2003b. Linkage map construction in the black tiger shrimp (Penaeus monodon Fabricius) by SSLP markers. Book of Abstracts. Plant and animal genome (PAG XI) conference, Town and Country Hotel, San Diego, Jan 11-15. Abstr. P645. pp. 235.

Xu, Z., A. K. Dhar, J. Wyrzykoswki & A. Alcivar-Warren. 1999. Identification of abundant and informative microsatellite from shrimp (Penaeus monodon) genome. Anita. Genet. 30:1-7.

Xu, Z., J. H. Primavera, L. D. de la Pena, P. Pettit, J. Belak & A. Alcivar-Warren. 2001. Genetic diversity of wild and cultured Black Tiger Shrimp (Penaeus monodon) in the Philippines using microsatellites. Aquaculture 199:13-40.

Xu, Z., J. Wyrzykowski, A. Alcivar-Warren, B. J. Argue, J. M. Moss, S. M. Arce, M. Traub, F. R. O. Calderon, J. Lotz & V. Breland. 2003a. Genetic analyses for TSV-susceptible and TSV-resistant shrimp (Litopenaeus vannamei) using M1 microsatellite. J. Worm Aqua. Soc. 34:332-343.

Xu, Z., D. Meehan & A. Alcivar-Warren. 2003b. High mutation rates at microsatellite loci in shrimp, Penaeus (Litopenaeus) vannamei. Book of Abstracts. Plant and Animal Genome (PAG XI) conference, Town & Country Hotel, San Diego, Jan 11-15. Abstr. P642:235.

Xu, Z., J. Alcivar & A. Alcivar-Warren. 2004. Transposable elements identified in the genome of black tiger shrimp (Penaeus monodon). Book of Abstracts. World Aquaculture Society meeting, Honolulu, Hawaii, March 1-5, 2004. Abstracts. pp. 657.

Zhang, L.-S. & J. Xiang. 2005. A preliminary study on the inheritance of microsatellite in two selective breeding families of shrimp (Litopenaeus vannamei). Hereditas (Beijing) 27:919-924. (in Chinese, abstract and tables in English).

DENISE K. GARCIA (1) AND ACACIA ALCIVAR-WARREN *

Environmental and Comparative Genomics Section, Department of Environmental and Population Health, Cummings School of Veterinary Medicine at Tufts University, 200 Westboro Road, North Grafton, Massachusetts 01536

(1) Current address: Department of Biological Sciences, California State University, San Marcos, San Marcos, CA 92096

* Corresponding author. E-mail: [e-mail]

TABLE 1.
Summary of forward and reverse primer sequences, allele number,
and size ranges obtained after genotyping wild and cultured
Litopenaeus vannamei with three microsatellites.

                                                 Number of Alleles

                                                   Wild (a)

                   Forward (F) and Reverse (R)   Oaxaca,    Saunas,
Locus ID              Primer Sequences           Mexico     Ecuador

TUDGLv1-3.224   F: 5'-ACTAGTGGATCTGTCTATTC-3'    25 (21)    21 (18)
                R: 5'-ATACCCACCCATGCATGTTAG-3'
TUDGLv5-7.33    F: 5'-TGCTAGAATGTCTTTCGAAG-3'      NA       31 (24)
                R: 5' GTCTGGGGAAATCTTTAATG-3'
TUDGLv7-9.17    F: 5'-ATGGTGAATATAAGGAAGCT-3'    26 (20)    31 (24)
                R: 5'-TGTGATATGGTTTTTGGAG-3'

                                                  Number of Alleles

                                                  Cultured (b)

                   Forward (F) and Reverse (R)   Family      Family
Locus ID                Primer Sequences           1.4        1.5

TUDGLv1-3.224   F: 5'-ACTAGTGGATCTGTCTATTC-3'     (l7)      4 (16)
                R: 5'-ATACCCACCCATGCATGTTAG-3'
TUDGLv5-7.33    F: 5'-TGCTAGAATGTCTTTCGAAG-3'     (l7)      4 (16)
                R: 5' GTCTGGGGAAATCTTTAATG-3'
TUDGLv7-9.17    F: 5'-ATGGTGAATATAAGGAAGCT-3'     (l7)      4 (16)
                R: 5'-TGTGATATGGTTTTTGGAG-3'

                                                    Size Range (bp)

                                                         Wild

                   Forward (F) and Reverse (R)    Oaxaca,     Salinas,
Locus ID                Primer Sequences           Mexico     Ecuador

TUDGLv1-3.224   F: 5'-ACTAGTGGATCTGTCTATTC-3'     137-224     157-234
                R: 5'-ATACCCACCCATGCATGTTAG-3'
TUDGLv5-7.33    F: 5'-TGCTAGAATGTCTTTCGAAG-3'        NA        90-186
                R: 5' GTCTGGGGAAATCTTTAATG-3'
TUDGLv7-9.17    F: 5'-ATGGTGAATATAAGGAAGCT-3'      96-274      95-275
                R: 5'-TGTGATATGGTTTTTGGAG-3'

                                                    Size Range (bp)

                                                       Cultured

                   Forward (F) and Reverse (R)    Family      Family
Locus ID                Primer Sequences           1.4        1.5

TUDGLv1-3.224   F: 5'-ACTAGTGGATCTGTCTATTC-3'     63-199    168-225
                R: 5'-ATACCCACCCATGCATGTTAG-3'
TUDGLv5-7.33    F: 5'-TGCTAGAATGTCTTTCGAAG-3'     21-182    129-183
                R: 5' GTCTGGGGAAATCTTTAATG-3'
TUDGLv7-9.17    F: 5'-ATGGTGAATATAAGGAAGCT-3'     25-157    125-199
                R: 5'-TGTGATATGGTTTTTGGAG-3'

(a) Numbers in parenthesis are number of individuals scored.
NA = not scored; amplification profiles contained many stuttering
bands making it difficult to determine the actual allele sizes.
Annealing temperature for au loci was 44[degrees]C and Mg[Cl.sub.2]
concentration was 2mM.

(b) See materials and methods section for details on the origin
of these families.

TABLE 2.
Summary of positive recombinant clones identified in
size-fractionated genomic libraries of Litopenaeus vannamei after
hybridization with various oligonucleotide probes.

               # of Colonies      # Positives
Library (bp)      Screened     with [(GT).sub.15]

  100-300           415                0
  300-500           410                9
  500-700           325                l7
  700-900           250                21
    Total           1400               47

                  # Positives          # Positives
Library (bp)   with [(CT).sub.15]   with [(AT).sub.15]

  100-300            l9                  0
  300-500            24                  0
  500-700            10                  1
  700-900            19                  0
    Total            72                  1

                # Positives        Total # of
Library (bp)   with [M.sub.2]   positive Clones

  100-300          0                  19
  300-500          0                  33
  500-700          2                  30
  700-900          6                  46
    Total          8                 128

TABLE 3. Polymorphism status of microsatellite repeat motifs
identified in 86 clones isolated from ovary genomic libraries of
Litopenaeus vannamei.

                        Forward and Reverse
Clone ID (a)            Primers (5' [right arrow]3')

TUGAPv 1-3.6            F: TACTNTCCACGCCACACTAA
                        R: GATTGAGGGATTTTGATGGG

TUGAPv1-3.19F (c)

TUGAPv1-3.24F (c)

TUGAPv 1-3.49 (d)       F: CACAGAAACACGCACACAAA
                        R: ATTTGTGTGTGTGTGCAGAG

TUGAPv 1-3.66 (d)       F: GTGGGATATATTGGT
                        R: CGTGTGTGTAAAGAA

TUGAPv1-3.132 (d)       F: CCGCCATCATCATCAACA
                        R: TCATTCGGGTTCGAGACTC

TUGAPv1-3.184 (c,d)     F: CATAACTTAGAATGTAAAAGAG
                        R: AAGAAAATGGACAGGGCAGTT

TUGAPv 1-3.185 (c)

TUGAPv1-3.219           F: CAGGCAAGGTAACAGGCATT
                        R: AATTCGTACATTTTA

TUDGLv1-3.2244 (d)      F: ACTAGTGGATCTGTCTATTCAT
                        R: ATACCCACCCATGCATGTTA

TUGAPv1-3.254 (c,g)     F2: ACTAGTGGATCTTCGGTTGT
                        R2: GGATAGACTCGACAAATGGA

TUGAPv1-3.267           F: TTACACCGATCTTGACAATCATAG
                        R: AGGCAGGGAGTCCTGTGAAC

TUGAPv 1-3.319

TUGAPv1-3.339

TUGAPv 1 -3.371 (c)

TUGAPv1-3.381           F: GGAATGAATGGATGTGGATTG
                        R: AACAGGCCTACAAATTTCACG

TUGAPv1-3 387F (c)

TUGAPv.3-5.1 B

TUGAPv3-5.34 (c,d)      F: CACTGAGCCCAGCACCTC
                        R: GAGGGTGGAAGAGGAGGC

TUGAPv3-5.82            F: TCGCTGTGATTTGTTTTGGA
                        R: CGTTATGGATCTCGTGGCTT

TUGAPv3-5.147F (d,h)    F2: TTGATAGATACGCGC
                        R2: GTGTTCAGGATGTTTAG

TUGAPv3-5.175           F: TATGTCTCCCTCTTTCTCCC
                        R: GGGATCTTGATTTGTGGGTG

TUGAPv3-5.200 (c,d)     F: AAACCTTTCTTGGCAGCG
                        R: GAAAGTGCAAAGAGTGTG

TUGAPv3-5.213           F: CCCAGAACCATGTGATTGC
                        R: GTGAA000GGAATTATCCA

TUGAPv3-5.222 (c)

TUGAPv3-5.235 (d)       F: AGACAGATAGATAGAGAGAG
                        R: CGTTCTGCTTACATATTTGG

TUGAPv3-5 237F (c)

TUGAPv3-5.242 (c,d,h)   F: TCGTTCCTCTTCGTCTTTCG
                        R: CTATGTTCGGAGCCTAGCCA

TUGAPv3-5.256F (c)

TUGAPv3-5.259 (c,d)     F: TGAGGTATAGGCAC
                        R: GCTTTGTTAGTGCA

TUGAPv3-5.271           F: CCACCCAACGTTTAAATAAC
                        R: GTCAGAGGATTGTATGATGT

TUGAPv3-5.273           F: GACACCAGCACAAATGCAAA
                        R: AGAGCGTGTTTGTGTATGTGTC

TUGAPv3-5.289F (c)

TUGAPv3-5.292           F: GAGTTAGGACTGCTGTGC
                        R: TA000ATACATAGATACC

TUGAPv3-5.312 (d)       F: ATCCTCAAAGACCTCCAGGG
                        R: CACACAAAAGCTTCCTCAATG

TUGAPv3-5.337           F: GATCTATCGGTGCATGTTCA
                        R: ACATTTTTGATAGAA

TUGAPv3-5.342 (g)       F: TAACTGTCTCAAAGCGTGGC
                        RA: ATGGGAGNGAGGGACATAAA

TUGAPv3-5.350

TUGAPv3-5.356

TUGAPv3-5.378           F: TCGGAAGGTGTCTTTCCAAAC
                        R: AGGAAACCTATCATCGCCGT

TUGAPv3-5.384

TUGAPv3-5.391           F: TTATTTGCTTGCCCCCCTCC
                        R: CGGGGGATCATACATCAACATC

TUGAPv5-7.9A
TUGAPv5-7.33
 (TU5733R in GB)        F: TGCTAGAATGTCTTTCGAAG
                        R: GTCTGGGGAAATCTTTAATG

TUGAPv5-7.36            F: CTCATTCCCCATTATTCCCA
                        R: TCTGCGCTAAATTGGTGTCA

TUGAPv5-7.41            F: GTTTTCTATCATGAATTCCC
                        R: GACATTGGGAACTTAACG

TUGAPv5-7.74            F: ACCACTAAAATAACC
                        R: ATTCAAATTCAAAGA

TUGAPv5-7.166 (c)       F: AGGCGCTTTGGAGCAAGT
                        R: ACCGAGTTCGCATTCCAG

TUGAPv5-7.167 (c)       F: TTAATGACATCAATAGTAGCCT
                        R: TCAAATACGAAAGCAGAGGACA

TUGAPv5-7.178 (c)       F: TCACCTCTTGATGTGAAGTTGG
                        R: CATTGGATTTTATCGCTGGC

TUGAPv5-7.203           F: ATTTCCCTTTCCCTTACCCC
                        R: TACAAGCAAAGGGTGGATGC

TUGAPv5-7.204

TUGAPv5-7.221           F: AACTGATATCGAGAAACGAG
                        R: AGTGGAGGAGGCCGGG

TUGAPv5-7.264F (c)

TUGAPv5-7.266 (c)

TUGAPv5-7.277 (c)

TUGAPv5-7.284 (d,i)     F2: TTGGTGTGTGCGTGAGTGT
                        R2: GGTTTAACTTCTGTCAGACTGC

TUGAPv5-7.298F (c)

TUGAPv5-7.309A (c)      F: TTCAGCTTGACCTTCGACCT
                        R: CATTACGCTGGCTATGGTGA

TUGAPv5-7.322           F: GGACGCTTTTTATTGTTGTCG
                        R: TGGTCATTAGGAACGCATACA

TUGALv7-9.17            F: ATGGTGAATATAAGGAAGCT
                        R: TGTGATATGGTTTTTGGAG

TUGAPv7-9.28            F: TCGTTCTCCATTGCATGACT
                        R: GGGGATTTGAACGATAAAAAG

TUGAPv7-9.35            F: GAAAGGATTCTGCCTTCGAG
                        R: AGCGGATAACCGAAGAAGC

TUGAPv7-9.35F (c)

TUGAPv7-9.52            F: GCCTCATATGTTGTATTAGGCA
                        R: ATCTTCCACATATAGGATT

TUGAPv7-9.59 (c)        F: TGAATTCCGACAGTAGGGTTG
                        R: CAATCTGTGATGTGGATGCC

TUGAPv7-9.94            F: TTTTCTCTTTCCACCTCGCA
                        R: AACATATTGCGGACCAGACA

TUGAPv7-9.94F           F: GCGCTGTCCTGTTATGTGAAAG
                        R: CACAGACAACCCGAAAGCTAAA

TUGAPv7-9.95 (c)        F: GATCCTGCGAGTCACTTTATCTC
                        R: TTTATTGCGTATCCCAGAAGC

TUGAPv7-9.115           F: ACGAGAATGCTGTCCGAAGT
                        R: TGTGCACGTTTGTATCTGATTG

TUGAPv7-9.117
TUGAPv7-9.119           F: CATGACCTGCCTTTAATCCC
                        R: AAAGACAAGGAACGAGCGAG

TUGAPv7-9.132 (c)       F: TCGGTTAAATAATGTATGGATATGT
                        R: CATGATGCTAGTTTTGGAGGTG

TUGAPv7-9.134           F: TCGTGTTTCATGTGTAGGCTG
                        R: ATGAGATGATAAGGGAGTGAATG

TUGAPv7-9.137           F: ATCTAATTGGCCTGATAGC
                        R: AGGAATATTGTGCTGAAGAG

TUGAPv7-9.142           F: CTTCTGCTTTCGCCAAATTC
                        R: CTGGTAACACCTCT000ACC

TUGAPv7-9.154           F: GCTAACAAAGCTGAGAGGAAGAG
                        R: TGGTATAAACGCAACTCGTGTC

TUGAPv7-9.166           F: TCTGACTTCACTTCGCTTCAG
                        R: TCTACCGCGTTGATACTATGG

TUGAPv 7-9.179          F: GCTGTCTGGCAGTCATTAA
                        R: TGAGGAAAGGATGGCTGAA

TUGAPv7-9.188           F: GGCTGTCTGGCAGTCATTAAC
                        R: CCCTTCCCTTCTTCCTTCTA

TUGAPv7-9.202           F: TTATGATTGTGCGAGGAACG
                        R: AAAAGGGAAACGAAGGATGG

TUGAPv7-9.202F (c)

TUGAPv7-9.226           F: GTGGCAATCACAACACCAAA
                        R: GGTCTGGTTTTCTGTACTGTGA

TUGAPv7-9.234           F: GGGAAGTTCTATAGATGTACGATACG
                        R: CCAAAAAGTGCAAGCAGATG

TUGAPv7-9.247 (c)       F: TTCAGTTCATTTCCGAACCC
                        R: ACGTGAGAGTGGCACTTGAG

TUGAPv7-9.250           F: CAGTTCATTTCCAACCCCC
                        R: ATGTGCAGCTGATGACTTC

Clone ID (a)                       Repeat Motifs (b)

TUGAPv 1-3.6            ... [(TC).sub.25] ... [(TC).sub.5] ...

TUGAPv1-3.19F (c)       ... [(AG).sub.11] AA[(AG).sub.42]

TUGAPv1-3.24F (c)         [(AG).sub.51] [(A).sub.8]
                          [(AG).sub.2] CA[(G)sub.12] ...

TUGAPv 1-3.49 (d)       ... [(CA).sub.3] ... [(TC)sub.12] ...
                          [(TC)sub.5] ... [(TC).sub.3] ...
                          [(TC).sub.10]A[(CT).sub.3]G
                          [(CA).sub.6] ... [(CATA).sub.3] ...

TUGAPv 1-3.66 (d)       ... [(AT).sub.3] ... [(TC).sub.16] ...
                          [(CT).sub.6] ... [(TC).sub.3] ...
                          [(AC).sub.4] ...

TUGAPv1-3.132 (d)       ... [(GA).sub.3] ... [(CAT).sub.3] ...
                          [(TC)sub.3] GG[(TC).sub.25] ...

TUGAPv1-3.184 (c,d)     ... [(AG).sub.51] ... [(CCTA).sub.3] ...
                          [(CT).sub.3]

TUGAPv 1-3.185 (c)      [(GACA).sub.3] ...  [(AG).sub.4] ...
                          [(CT).sub.29]T[(TC)sub.13]TA[(TC)sub.3]
                          ...  [(TC).sub.3] ...
                          [(CCCTCTCT).sub.3]CC[(CT).sub.7] ...
                          [(CT)sub.3] ...

TUGAPv1-3.219           ... [(AG).sub.34] ... [(AG)sub.4] ...

TUDGLv1-3.2244 (d)      ... [(TAGA).sub.3] ... [(TAGA).sub.3]
                          ... [(ACAG).sub.4]
                          [(AG).sub.21]A[(AG)sub.30] ...

TUGAPv1-3.254 (c,g)     ... [(TG)sub.10] ... [(TA).sub.3] ...
                          [(AG).sub.6]AA[(AG).sub.38]

TUGAPv1-3.267           ... [(CT).sub.3] ... [(CT).sub.3] ...

TUGAPv 1-3.319          ... [(TC).sub.21]CC[(TC).sub.3] ...
                          [(GC).sub.3] ...

TUGAPv1-3.339           ... [(GAGATA).sub.5]GATA[(GA).sub.21] ...

TUGAPv 1-3.371 (c)      ...  [(CT).sub.48]

TUGAPv1-3.381           ... [(GA).sub.3] ... [(GA).sub.17]CT
                          [(AG).sub.17] ...
TUGAPv1-3 387F (c)      ... [(AG).sub.7] ... [(AG).sub.4]

TUGAPv.3-5.1 B          [(TA).sub.3] ...
                          [(TC).sub.15]C[(CT).sub.3] ...
                          [(TC).sub.3] ... [(TC).sub.3] ...

TUGAPv3-5.34 (c,d)      ... [(TCCC).sub.3] ... [(CCCT).sub.4]
                          ... [(TC).sub.37]TN[(TC).sub.4] ...
                          [(TC).sub.6]

TUGAPv3-5.82            ... [(TC).sub.4] ... [(TC)sub.3] ...
                          [(TC).sub.5][(GC).sub.4] ...
                          [(CT).sub.8]CG[(CT).sub.3] ...
                          [(TC).sub.4] ...
                          [(CT).sub.9]T[(TC).sub.21]C[(CT).sub.6]
                          ... [(CT).sub.7] ...

TUGAPv3-5.147F (d,h)    ... [(AT).sub.3] ... [(CG).sub.3]
                          [(CA).sub.8][(CGCA).sub.10]
                          [(CA).sub.10]T[(AC).sub.4] ...

TUGAPv3-5.175           ... [(CT).sub.4] ...
                          [(CT).sub.4]TC[(CT).sub.3] ...
                          [(CT).sub.3]T[(TC).sub.6] ...
                          [(CT).sub.3]TT[(TC).sub.3] ...
                          [(TC).sub.6] ... [(CT).sub.3] ...
                          [(TC).sub.6] ...
                          [(CT).sub.3]TC[(CT).sub.4] ...
                          [(TC).sub.6] ... (CT)3TC[(CT).sub.6] ...
                          [(CT).sub.3][(TCC).sub.3] ...
                          [(GA).sub.6] ... [(GA).sub.5] ...

TUGAPv3-5.200 (c,d)     [(TC).sub.3] ...
                          (TC).sub.6][(TCCC).sub.5] ...
                          [(CT).sub.3] ...
                          [(TC).sub.45]T[(CA).sub.3] ...

TUGAPv3-5.213           ... [(ATC).sub.3] ... [(TTA).sub.3] ...
                          [(GA).sub.49] ...

TUGAPv3-5.222 (c)       [(TG).sub.3][(GA).sub.3] ...
                          [(TA).sub.4] ... [(GC).sub.4] ...
                          [(CA).sub.3] ...  [(CA).sub.17] ...
                          [(CA).sub.3] ... [(CA).sub.3] ...
                          [(CA).sub.3]

TUGAPv3-5.235 (d)       ... [(AG).sub.4] ... [(AG).sub.6] ...
                          [(AG).sub.4] ...

TUGAPv3-5 237F (c)      ... [(A).sub.7]T[(A).sub.4]G[(A).sub.5]T
                          [(AG).sub.48]

TUGAPv3-5.242 (c,d,h)   [(CTTCT).sub.3] ... [(CTTT).sub.3] ...
                          [(CTC).sub.3] ... [(CT).sub.3] ...
                          [(TCC).sub.3] ... [(CCT).sub.5] ...

TUGAPv3-5.256F (c)      ... [(GAAA).sub.3][(GA).sub.47]

TUGAPv3-5.259 (c,d)     ... [(CA).sub.43] ...
                          [(AC).sub.7][(AC).sub.4] ...
                          [(AC).sub.4] ... [(AC).sub.3]

TUGAPv3-5.271           ... [(GA).sub.50] ...

TUGAPv3-5.273           ... [(AC).sub.4]TAG[(AC).sub.5] ...
                          [(CG).sub.3] ... [(AC).sub.4]G
                          [(CA).sub.10] ...

TUGAPv3-5.289F (c)      ... [(TA).sub.3] ... [(AG).sub.48]AC
                          [(AG).sub.8]

TUGAPv3-5.292           ... [(TG).sub.3] ... (TG).sub.3] ...
                          [(CA).sub.16] ...

TUGAPv3-5.312 (d)       ... [(GA).sub.3] ... [(TG).sub.3] ...
                          [(AG).sub.51] ... [(CA).sub.35][
                          (TA).sub.26] ...

TUGAPv3-5.337           ... [(TG).sub.5] ... [(TC).sub.35] ...
                          [(CT).sub.10] ...

TUGAPv3-5.342 (g)       ... [(TC).sub.25] ...

TUGAPv3-5.350           ... [(TC).sub.3] ... [(AC).sub.7] ...
                          [(CACG).sub.4][(CA).sub.29] ...
                          [(CA).sub.21]T[AC).sub.14]

TUGAPv3-5.356           ... [(AG).sub.3]C[(GA).sub.3]TA
                          [(GA).sub.2][(GAGATA).sub.3]
                          [(GATA).sub.5][(GA).sub.28]AA
                          [(GA).sub.2]GT[(GA).sub.10]G
                          [(GA).sub.6] ...

TUGAPv3-5.378           ... [(AC).sub.5] ...
                          [(GC).sub.3]G[(CA).sub.3] ...
                          [(CA).sub.5]CG[(CA).sub.3] ...
                          [(GCAC).sub.3][(AC).sub.5] ...
                          [(CA).sub.4] ... [(AC).sub.12] ...

TUGAPv3-5.384           ... [(AC).sub.6] ... [(AC).sub.5] ...
                          AT[(AC).sub.12] ... [(C).sub.9] ...

TUGAPv3-5.391           ... [(GC).sub.3] ... [(TC).sub.14] ...

TUGAPv5-7.9A            ... [(TG).sub.3] ... [(CA).sub.9] ...
TUGAPv5-7.33              [(AT).sub.29][(CA).sub.21]
                          [(TA).sub.26] ...

 (TU5733R in GB)        ... [(AC).sub.11]AT[(AC).sub.14] ...
                          [(CA).sub.3] ...

TUGAPv5-7.36            ... [(CT).sub.4] ... [(CA).sub.3] ...
                          [(CA).sub.3] ... [(CA).sub.3] ...
                          [(CA).sub.23]
                          CT[(CA).sub.3]CT[(CA).sub.45] ...
                          [(AC).sub.4]AT[(AC).sub.6] ...
                          [(AC).sub.3] ... [(AC).sub.4] ...

TUGAPv5-7.41            .. [(TC).sub.3]TT[(TC).sub.3] ...
                          [(TC).sub.3] ...
                          [(CCT).sub.3]T[(CTC).sub.3] ...
                          [(TG).sub.3] ... [(GA).sub.42] ...
                          [(TA).sub.3] ... [(GT).sub.3] ...

TUGAPv5-7.74            ... [(CA).sub.3] ... [(CT).sub.3] ...

TUGAPv5-7.166 (c)       ... [(CCTTT).sub.3]CTCT[(TC).sub.3] ...
                          [(TC).sub.4] ... [(TC).sub.4]T
                          [(TC).sub.3]T[(TC).sub.3]TTT
                          [(TC).sub.3]TTT[(TC).sub.5] ...
                          [(TC.sub.33] ... [(CTTCT).sub.4]

TUGAPv5-7.167 (c)       [(C).sub.12] ...
                          [(CT).sub.5]T[(TC).sub.3] ...
                          [(TC).sub.4]G[(TC).sub.4] ...
                          [(TC).sub.5]TT[(TC).sub.3] ...
                          [(CT).sub.5]T[(TC).sub.3] ...
                          [(TC).sub.4]G[(TC).sub.5] ...
                          [(TC).sub.5]TT[(TC).sub.7]TT
                          [(TC).sub.34]

TUGAPv5-7.178 (c)       ... [(TC).sub.20][(TA).sub.27]NAT
                          [(GT).sub.3] ... [(GT).sub.3] ...
                          [(GA).sub.3] ...
TUGAPv5-7.203           ... [(TA).sub.9] ...

TUGAPv5-7.204           ... [(C).sub.11] ... [(GT).sub.3] ...

TUGAPv5-7.221           ... [(ACAG).sub.3] ...
                          [(AC).sub.14]G[(CA).sub.3] ...
                          [(AC).sub.5] ... (CA).sub.3] ...
                          [(TACA).sub.3][(TA).sub.25]TG
                          [(TA).sub.6]TN[(TA).sub.7]
                          [(T).sub.9] ...

TUGAPv5-7.264F (c)      ...  [(AAT).sub.3] ...  [(TA).sub.3] ...
                          [(TA).sub.3] ...  [(TA).sub.28] ...
                          [(TG).sub.35]

TUGAPv5-7.266 (c)       ...  [(GT).sub.3] ...
                          [(TG).sub.3]CG[(GT).sub.45]

TUGAPv5-7.277 (c)       ... [(CA), .sub.4] ...  [(CG).sub.5]
                          [(TG).dup.6]

TUGAPv5-7.284 (d,i)     ... [(TG).sub.3] ... [(GTGTGC).sup.4] ...
                          [(AT).sub.4] ...

TUGAPv5-7.298F (c)      ... [(GT).sub.5] ... [(TG).sub.22] ...
                          [(GT).sub.3] ... [(AT).sub.3] ...
                          [(AT).sub.29]

TUGAPv5-7.309A (c)      ... [(TG).sub.3] ... [(TG).sub.4] ...
                          [(TG)].sub.19]C[(GT)].sub.12]A
                          [(TG)].sub.10]AG[(TGTA).sub.3]
                          [(AG)].sub.6] ...  [(AG).sub.3]T
                          [(GC).sub.12] ... [(A).sub.16] ...
                          [(GAA).sub.3] ... [(C).sub.14]

TUGAPv5-7.322           ... [(TC).sub.9] ... [(CT).sub.4] ...
                          [(CT).sub.3]T[(TC).sub.3] ...
                          [(TC).sub.8] ... [(TC).sub.6] ...
                          [(CT).sub.3] ...
                          [(TC).sub.45]TT[(TC).sub.4] ...
                          [(TTC).sub.3] ... [(TG).sub.3] ...
                          [(T).sub.8] ...

TUGALv7-9.17            ... [(T).sub.13]N[(TA).sub.4] ...
                          [(AC).sub.10] ... [(AC).sub.11] ...

TUGAPv7-9.28            ... [(CT).sup.3] ... [(CT).sup.3] ...
                          [(CA).sup.6]CG[(CA).sup.8] ...
                          [(CA)2.sub.8][(TA).sub.22] ...

TUGAPv7-9.35            ... [(TA).sub.3] ... [(T).sub.10] ...
                          [(AT).sub.3] ...

TUGAPv7-9.35F (c)       ... [(TG).sub.4] ... [(TG).sub.4]TA
                          [(TG).sub.7] ... [(TG).sub.37]

TUGAPv7-9.52            ... [(AAT).sub.3] ... [(CA).sub.3] ...
                          [(GA).sub.3] ... [(AC).sub.27]A
                          [(AT).sub.11] ... [(CA).sub.3] ...

TUGAPv7-9.59 (c)        ... [(AC).sub.9] ... [(CA).sub.5]C
                          [(CA).sub.30]TA[(CA).sub.3]
                          ... [(CA).sub.7]
                          TA[(CA).sub.13][(CGCA).sub.3] ...
                          [(CA).sub.15] ... [(CA).sub.6] ...
                          [(CA).sub.13] ... [(GA).sub.3] ...
                          [(AT).sub.38]

TUGAPv7-9.94            [(TC).sub.56] ... [(TG).sub.5] ...

TUGAPv7-9.94F           [(CA).sub.5] ... [(CA),.sub.4]
                          [(CATA).sub.3][(TA).sub.27]
                          ... [(TA).sub.3] ...  [(TA).sub.4] ...
                          [(G).sub.14] ... [(GA).sub.15] ...
                          [(GA).sub.3] ...

TUGAPv7-9.95 (c)        ... [(TC).sub.3] ... [(AT).sub.3] ...
                          [(AG).sub.3] ... [(TC),.sub.3] ...
                          [(AT).sub.24] G[(TA).sub.5]
                          TG[(TA).sub.4]TG[(TA).sub.4] ...
                          [(AT).sub.3] ... [(AT).sub.24]

TUGAPv7-9.115           ... [(AC).sub.8]AT[(AC).sub.4] ...

TUGAPv7-9.117           ... [(AT).sub.3] ... [(CA).sub.9]TA
                          [(CA).sub.3] ...

TUGAPv7-9.119           ... [(TC).sub.15] ... [(CT).sub.8] ...
                          [(C).sub.10][(CT).sub.5]A
                          [(TC).sub.3] TT[(TC).sub.8]A
                          [(CT).sub.9] ... [(CT).sub.5] ...
                          [(TC).sub.4] ... [(CT).sub.5] ...
                          [(CT).sub.3] ... [(TC).sub.3] ...

TUGAPv7-9.132 (c)       ... [(TA).sub.3] ... [(AT).sub.3] ...
                          [(TC).sub.39] ... [(CA).sub.5]

TUGAPv7-9.134           ... [(TTA).sub.3] ... [(CA).sub.3] ...
                          [(AACCT).sub.3] ... [(TTATCA).sub.3] ...

TUGAPv7-9.137           ... [(TTC).sub.3] ... [(CT).sub.4] ...
                          [(CT).sub.5]A[(TC).sub.3] ...
                          [(CT).sub.20] ... [(CT).sub.5]
                          [(CCCT).sub.3] ... [(CT).sub.5]AT
                          [(CT).sub.3] ... [(CT).sub.7] ...
                          [(TC).sub.3] ...  [(CT).sub.3] ...
                          [(CT).sub.4] ...  [(CT).sub.3] ...
                          [(CT).sub.6]T[(TC).sub.3]CT
                          [(TCCC).sub.3][(TC).sub.3] ...

TUGAPv7-9.142           ... [(CA)g ... [(CT)g ... [(CT);T[(TC)q ...

TUGAPv7-9.154           ... [(GC).sub.3] ... [(GATA).sub.3] ...
                          [(AT).sub.4] ... [(AT).sub.4]A
                          [(CATA).sub.4] ... [(TA).sub.6] ...
                          [(TA).sub.5]T[(GT).sub.6]
                          [(GC).sub.3][(GT).sub.]22] ... .
                          [(GA).sub.3] ... [(AG).sub.3] ...
                          [(GA).sub.7] ...

TUGAPv7-9.166           ... [(CT).sub.4] ... [(TC).sub.3] ...
                          [(CA).sub.11]T[(CA).sub.32]
                          [(TA).sub.2] ... [(AT).sub.3] ...
                          [(TA).sub.6] ... [(TA).sub.17] ...
                          [(AC).sub.6]AG[(AC).sub.4] ...
                          [(CA).sub.22] ... [(AT).sub.5] ...
                          [(CT).sub.6] ...

TUGAPv 7-9.179          ... [(TC).sub.25] ...

TUGAPv7-9.188           ... [(CT).sub.3] ... [(TC).sub.11]TT
                          [(TC).sub.13] ... [(CCCT).sub.3] ...
                          [(GC) .sub.3] ... [(GA).sub.3] ...
                          [(GGA).sub.3] ...

TUGAPv7-9.202           ... [(CA).sub.9] ...

TUGAPv7-9.202F (c)      ... [(CAT).sub.3] ... [(GAA).sub.3] ...
                          [(AAG).sub.4] ... [(AAG).sub.3] ...
                          [(TG).sub.7]TA[(TG).sub.3]A
                          [(GT).sub.6][(TG).sub.19]A
                          [(GT).sub.8]N[(GT).sub.5]

TUGAPv7-9.226           ... [(AGAA).sub.4] ...

TUGAPv7-9.234           ... [(CA).sub.3] ... [(CACG).sub.3]
                          [(CA).sub.3]CG[(CA).sub.4] ...
                          [(CACG).sub.6][(CA).sub.6]T
                          [(AC).sub.43]AT[(AC).sub.3] ...
                          [(CA).sub.5][(TA).sub.3] ...
                          [(ATAC).sub.3] ... [(CA).sub.13] ...
                          [(TAAA).sub.5] ...

TUGAPv7-9.247 (c)       ... [(TA).sub.27] ... [(TA).sub.3] ...
                          [(AT).sub.3] ... [(AAG).sub.3]

TUGAPv7-9.250           ... [(TA).sub.18] ... [(TA).sub.3] ...
                           [(TATG).sub.3][(CA).sub.3]  ...
                           [(GA).sub.3] ...

                        Expected   Anneal. Temp          P(e)
Clone ID (a)            Size(bp)   ([degrees]F)    (# of alleles)(f)
                          (bp)         (F)

TUGAPv 1-3.6               114          52               P (13)

TUGAPv1-3.19F (c)                                        NT

TUGAPv1-3.24F (c)                                        NT

TUGAPv 1-3.49 (d)          105          52               N

TUGAPv 1-3.66 (d)           85          52               N

TUGAPv1-3.132 (d)          118          52               P (8)

TUGAPv1-3.184 (c,d)        249          52               N

TUGAPv 1-3.185 (c)                                       NT

TUGAPv1-3.219              276          52               NA

TUDGLv1-3.2244 (d)         185          44               P (9)

TUGAPv1-3.254 (c,g)        109        42-50              P (2)

TUGAPv1-3.267              191          52               N

TUGAPv 1-3.319                                           NT

TUGAPv1-3.339                                            NT

TUGAPv 1-3.371 (c)                                       NT

TUGAPv1-3.381              212          52               N

TUGAPv1-3 387F (c)                                       NT

TUGAPv.3-5.1 B                                           NT

TUGAPv3-5.34 (c,d)         109          52               N

TUGAPv3-5.82               332          52               P (3)

TUGAPv3-5.147F (d,h)       118         402               P (2)

TUGAPv3-5.175              387          52               P (2)

TUGAPv3-5.200 (c,d)        186          52

TUGAPv3-5.213              281          52               P (2)

TUGAPv3-5.222 (c)                                        NT

TUGAPv3-5.235 (d)           54          52               P (3)

TUGAPv3-5 237F (c)                                       NT

TUGAPv3-5.242 (c,d,h)      293          52               NA

TUGAPv3-5.256F (c)                                       NT

TUGAPv3-5.259 (c,d)        125          52               N

TUGAPv3-5.271              141          52               P (8)

TUGAPv3-5.273               87          52               N

TUGAPv3-5.289F (c)                                       NT

TUGAPv3-5.292               89          52               P (2)

TUGAPv3-5.312 (d)           69          52               P (2)

TUGAPv3-5.337              280          52               NA

TUGAPv3-5.342 (g)           54          52               N

TUGAPv3-5.350                                            NT

TUGAPv3-5.356                                            NT

TUGAPv3-5.378              186          52               P (8)

TUGAPv3-5.384                                            NT

TUGAPv3-5.391              114          52               P (9)

TUGAPv5-7.9A                                             NT

TUGAPv5-7.33

 (TU5733R in GB)           126          44               P (3)

TUGAPv5-7.36               477          52               P (3)

TUGAPv5-7.41               430          52               NA

TUGAPv5-7.74               275          52               NA

TUGAPv5-7.166 (c)           95          52               P (2)

TUGAPv5-7.167 (c)           91          52               NA

TUGAPv5-7.178 (c)          210          52               NA

TUGAPv5-7.203              258          52               N

TUGAPv5-7.204                                            NT

TUGAPv5-7.221              288          52               P (2)

TUGAPv5-7.264F (c)                                       N T

TUGAPv5-7.266 (c)                                        NT

TUGAPv5-7.277 (c)                                        NT

TUGAPv5-7.284 (d,i)         28          52               P (8)

TUGAPv5-7.298F (c)                                       NT

TUGAPv5-7.309A (c)         299          52               P (7)

TUGAPv5-7.322              350          52               NA

TUGALv7-9.17                91          44               P (16)

TUGAPv7-9.28               390          52               P (3)

TUGAPv7-9.35               340          52               P (2)

TUGAPv7-9.35F (c)                                        NT

TUGAPv7-9.52               431          52               NA

TUGAPv7-9.59 (c)           353          ~2               P (4)

TUGAPv7-9.94               255          52               P (5)

TUGAPv7-9.94F              231          52               P (5)

TUGAPv7-9.95 (c)           282          52               P (4)

TUGAPv7-9.115              178          52               P (4)

TUGAPv7-9.117                                            NT

TUGAPv7-9.119              339          52               P (4)

TUGAPv7-9.132 (c)          137          52               P (2)

TUGAPv7-9.134              433          52               N

TUGAPv7-9.137              131          52               P (2)

TUGAPv7-9.142              229          52               M

TUGAPv7-9.154              400          52               NA

TUGAPv7-9.166              142          52               N

TUGAPv 7-9.179              52          52               P (11)

TUGAPv7-9.188              485          52               NA

TUGAPv7-9.202              268          52               NA

TUGAPv7-9.202F (c)                                       NT

TUGAPv7-9.226               33          52               P (4)

TUGAPv7-9.234              366          52               P (2)

TUGAPv7-9.247 (c)          234          52               P (4)

TUGAPv7-9.250              386          52               NA

                        Linkage
                        Group in         GenBank
Clone ID (a)            Shrimp Map     Accession #

TUGAPv 1-3.6                            AY376912

TUGAPv1-3.19F (c)                       AY376913

TUGAPv1-3.24F (c)                       AY376914

TUGAPv 1-3.49 (d)                       AY376915

TUGAPv 1-3.66 (d)                       AY376916

TUGAPv1-3.132 (d)       LG6             AY376917

TUGAPv1-3.184 (c,d)                     AY376918

TUGAPv 1-3.185 (c)                      AY376919

TUGAPv1-3.219                           AY376920

TUDGLv1-3.2244 (d)                      AF006629

TUGAPv1-3.254 (c,g)                     AY376921

TUGAPv1-3.267                           AY376922

TUGAPv 1-3.319                          AY376923

TUGAPv1-3.339                           AY376924

TUGAPv 1-3.371 (c)                      AY 376925

TUGAPv1-3.381                           AY376926

TUGAPv1-3 387F (c)                      AY376927

TUGAPv.3-5.1 B                          AY376928

TUGAPv3-5.34 (c,d)                      AY376929

TUGAPv3-5.82                            AY376930

TUGAPv3-5.147F (d,h)                    AY376931

TUGAPv3-5.175                           AY376932

TUGAPv3-5.200 (c,d)                     AY376933

TUGAPv3-5.213           LG5             AY376934

TUGAPv3-5.222 (c)                       AY376935

TUGAPv3-5.235 (d)                       AY376936

TUGAPv3-5 237F (c)                      AY376937

TUGAPv3-5.242 (c,d,h)                   AY376938

TUGAPv3-5.256F (c)                      AY376939

TUGAPv3-5.259 (c,d)                     AY376940

TUGAPv3-5.271           Unlinked        AY376941

TUGAPv3-5.273                           AY376942

TUGAPv3-5.289F (c)                      AY376943

TUGAPv3-5.292                           AY376944

TUGAPv3-5.312 (d)                       AY376945

TUGAPv3-5.337                           AY376946

TUGAPv3-5.342 (g)                       AY376947

TUGAPv3-5.350                           AY376948

TUGAPv3-5.356                           AY376949

TUGAPv3-5.378                           AY376950

TUGAPv3-5.384                           AY376951
TUGAPv3-5.391           Unlinked        AY376952

TUGAPv5-7.9A                            AY376954

TUGAPv5-7.33

 (TU5733R in GB)                        AF006630

TUGAPv5-7.36                            AY376955

TUGAPv5-7.41                            AY376956

TUGAPv5-7.74                            AY376958

TUGAPv5-7.166 (c)                       AY376959

TUGAPv5-7.167 (c)                       AY376960

TUGAPv5-7.178 (c)                       AY376961

TUGAPv5-7.203                           AY376963

TUGAPv5-7.204                           AY376964

TUGAPv5-7.221                           AY376965

TUGAPv5-7.264F (c)                      AY376966

TUGAPv5-7.266 (c)                       AY376967

TUGAPv5-7.277 (c)                       AY376968

TUGAPv5-7.284 (d,i)                     AY3766969

TUGAPv5-7.298F (c)                      AY376970

TUGAPv5-7.309A (c)                      AY376971

TUGAPv5-7.322                           AY376972

TUGALv7-9.17                            AF006631

TUGAPv7-9.28                            AY376973

TUGAPv7-9.35                            AY376974

TUGAPv7-9.35F (c)                       AY376975

TUGAPv7-9.52                            AY376976

TUGAPv7-9.59 (c)                        AY376977

TUGAPv7-9.94            Unlinked        AY376978

TUGAPv7-9.94F                           AY376979

TUGAPv7-9.95 (c)        LG14            AY376980

TUGAPv7-9.115                           AY376981

TUGAPv7-9.117                           AY376982

TUGAPv7-9.119                           AY376983

TUGAPv7-9.132 (c)                       AY376984

TUGAPv7-9.134                           AY376985

TUGAPv7-9.137                           AY376986

TUGAPv7-9.142                           AY376987

TUGAPv7-9.154                           AY376988

TUGAPv7-9.166                           AY376989

TUGAPv 7-9.179          LG13            AY376990

TUGAPv7-9.188                           AY376991

TUGAPv7-9.202                           AY376992

TUGAPv7-9.202F (c)                      AY376993

TUGAPv7-9.226           Unlinked        AY376994

TUGAPv7-9.234                           AY376995

TUGAPv7-9.247 (c)                       AY376996

TUGAPv7-9.250                           AY376997

(a) Nomenclature for microsatellites is as described in Meehan
et al. (2003). (b) Different microsatellites within a clone are
separated by (...). Motifs in bold indicate the repeats flanked by
the primers selected for analysis. The 86 sequences originated
from 83 clones isolated from genomic libraries cloned using ovary
DNA from an adult female of SPF Population 1 of the USMSFP.
Most clones were sequenced using the reverse M13 primers, clones
ending with F indicate that the forward primer was used for
sequencing.  (c) No enough flanking sequence on either side of
the repeat motifs, but primers may have been designed from
a single or combined motifs within the sequence. (d) First or
last microsagtellite repeat was included in the primer. (e)
P = Polymorphic, M = Monomorphic, NA = did not
amplify; N = need further optimization of annealing temperature;
NT = not tested. (f) Also amplified in broodstock of the USMSFP
breeding program. (g, h, i). Also tested other primer sets;
(i) Has another small microsatellite, both polymorphic. Markers
in bold are the eight polymorphic markers genotyped with the entire
mapping panel (IRMF) being used to construct the linkage map for
shrimp, ShrimpMap. (Linkage analysis performed using CRIMAP with
LOD score of 5.0).

TABLE 4.
The distribution and frequency of microsatellite repeat motifs
with three or more nucleotide repeats from 86 sequences isolated
from adult ovary genomic libraries of Litopenaeus vannamei.

                        Di-nucleotidesa (a)

                             Frequency
  Repeat of Motifs      #     (1/kb)

Three or more repeats   312   1/1.55
Five or more repeats    170   1/2.85
Ten or more repeats     101   1/4.80
L. vannameie (b,c,d)    433   1/1.43

                       Tri-nucleotides

                             Frequency
  Repeat of Motifs      #      (1/kb)

Three or more repeats   31   1/15.63
Five or more repeats     5   1/96.88
Ten or more repeats      1   1/484.40
L. vannameie (b,c,d)    40   1/15.46

                        Tetra-nucleotides

                             Frequency
  Repeat of Motifs      #   (1/kb)

Three or more repeats   19   1/25.49
Five or more repeats     2   1/242.20
Ten or more repeats      0     --
L. vannameie (b,c,d)    139  1/4.48

                        Penta-nucleotides

                            Frequency
  Repeat of Motifs      #    (1/kb)

Three or more repeats    4   1/121.10
Five or more repeats     0      --
Ten or more repeats      0      --
L. vannameie (b,c,d)    35    1/17.66

                        Hexa-nucleotides

                            Frequency
  Repeat of Motifs      #     (1/kb)

Three or more repeats    4   1/121.10
Five or more repeats     0      --
Ten or more repeats      0      --
L. vannameie (b,c,d)    10    1/61.82

                        Octa-nucleotides

                            Frequency
  Repeat of Motifs      #    (1/kb)

Three or more repeats    1   1/484.40
Five or more repeats     0      --
Ten or more repeats      0      --
L. vannameie (b,c,d)    --      --

                            Total

                           Frequency

  Repeat of Motifs      #         (1/kb)

Three or more repeats   371       1/1.31
Five or more repeats    177       1/2.74
Ten or more repeats     102       L/4.75
L. vannameie (b,c,d)    658 (c}   1/0.94 (c}

(a) The estimated frequency of microsatellites was obtained by
dividing the estimated total length of the P. vannamei genomic library
(484,400 base pairs = 1,400 x estimated average insert length of 346
bp) by the total number of repeats then divided by 1000.
(b) For comparison purposes. Taken from Meehan et al. (2003) for
three or more repeats. (c} Includes one nano-nucleotide microsatellite.
(d} Frequency estimated based on the total length (618,222 bp) of
sequenced clones (1,479 clones x estimated average insert length
of 418 bp).