Printer Friendly
The Free Library
5,060,680 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Bacteroides fragilis enterotoxin gene sequences in patients with inflammatory bowel disease.


We identified enterotoxigenic en·ter·o·tox·i·gen·ic
adj.
Of or being an organism containing or producing an enterotoxin.


Enterotoxigenic 
 Bacteroides fragilis in stool specimens of patients with inflammatory bowel disease inflammatory bowel disease
n. Abbr. IBD
Any of several incurable and debilitating diseases of the gastrointestinal tract characterized by inflammation and obstruction of parts of the intestine.
 and other gastrointestinal disorders. The organism was detected in 11 (13.2%) of 83 patients with inflammatory bowel disease. Of 57 patients with active disease, 19.3% were toxin positive; none of those with inactive disease had specimens positive for enterotoxigenic Bacteroides fragilis gene sequences.

Bacteroides fragilis, a gram-negative rod, constitutes 1% to 2% of the normal colonic bacterial microflora microflora /mi·cro·flo·ra/ (-flor´ah) the microscopic vegetable organisms of a special region.
Microflora
The bacterial population in the intestine.
 in humans (1,2). It is frequently associated with extraintestinal infections such as abscesses and soft tissue infections, as well as diarrheal diseases in animals and humans (3-6). Enterotoxigenic B. fragilis (ETBF ETBF Eastern Tuna and Billfish Fishery (Australia)
ETBF Enterotoxigenic Bacteroides Fragilis
) is an emerging enteric pathogen associated with diarrheal diseases in children, adults, and animals (4,7-9). The pathogen is unusual in children during the first year of life, but diarrhea associated with it is common in children 1 to 5 years of age, which suggests early acquisition of the organism and maternal protection. The pathogenicity of B. fragilis is related to its production of a potent enterotoxin enterotoxin /en·tero·tox·in/ (en´ter-o-tok?sin)
1. a toxin specific for the cells of the intestinal mucosa.

2. a toxin arising in the intestine.

3.
, a zinc-containing metalloprotease with a molecular weight of 20,000 (10). The enterotoxin is tight-junction specific; causes rounding, swelling, and pyknosis of cultured enterocytes; and induces a fluid response in ligated intestinal loops and a cytotoxic response in the HT-29 colon cell line (7).

Ulcerative colitis and Crohn disease are inflammatory diseases of the gastrointestinal tract characterized by spontaneous remissions and relapses. Many microbial microbial

pertaining to or emanating from a microbe.


microbial digestion
the breakdown of organic material, especially feedstuffs, by microbial organisms.
 pathogens, particularly Mycobacterium mycobacterium

Any of the rod-shaped bacteria that make up the genus Mycobacterium. The two most important species cause tuberculosis and leprosy in humans; another species causes tuberculosis in both cattle and humans.
 paratuberculosis, paramyxoviruses, and Listeria monocytogenes have been implicated in the etiology of inflammatory bowel disease (IBD IBD
abbr.
inflammatory bowel disease


Inflammatory bowel disease (IBD)
Disease in which the lining of the intestine becomes inflamed.

Mentioned in: Amebiasis


IBD

1.
) (11). In addition, enteric pathogens such as Campylobacter jejuni, Salmonella, Shigella shigella

Any of the rod-shaped bacteria that make up the genus Shigella, which are normal inhabitants of the human intestinal tract and can cause dysentery, or shigellosis. Shigellae are gram-negative (see gram stain), non-spore-forming, stationary bacteria. S.
, Yersinia Yersinia

A genus of bacteria in the Enterobacteriaceae family. The bacteria appear as gram-negative rods and share many physiological properties with related Escherichia coli. Of the 11 species of Yersinia, Y. pestis, Y. enterocolitica, and Y.
, and Escherichia coli have also been associated with relapses of IBD (12). We investigated the prevalence of ETBF in 83 patients with idiopathic IBD, in 18 patients with routine culture-negative diarrhea, and in a control population of 69 outpatients (Table 1).

Table 1. Demographic characteristics of patients with inflammatory bowel disease (IBD)
                                        Patient group
                                        Diarrhea
Patient                 IBD             patients          Controls
characteristics         (n = 83)        (n = 18)          (n=69)

Sex
  M                     38              4                 40
  F                     45              14                29
Age (yrs)               10-80           20-75             40-72
Mean =                  45.5            45.6              58.2
Duration of
    disease (yrs)
  UC                    1-13 (5.6)      1-6 (2.6)         NA
  CD                    1-20 (10.5)
Therapeutic
treatment
  5-ASA                 58              0                 0
  5-ASA+Steroids        35              0                 0
  6-MP/                 20              0                 0
    Azathioprine
  MTX                   1               0                 0
  Antibiotics           1               1                 0
  Antidiarrheals        1               3                 8


The Study

The study protocol was approved by the Human Subjects Research Review Committee of the University of California, Davis The University of California, Davis, commonly known as UC Davis, is one of the ten campuses of the University of California, and was established as the University Farm in 1905. . All samples were collected after informed consent was obtained. Of the 83 patients in the IBD group, 60 had Crohn disease, and 23 had ulcerative colitis (Table 2). Active disease was present in 68.6% of these patients on endoscopy (20 ulcerative colitis and 37 Crohn disease patients) in the form of mucosal erythema erythema (ĕr'əthē`mə), more or less diffuse redness of the skin due to concentration of an abnormally large amount of blood within the small vessels of the skin (hyperemia), as in burns.  and ulceration. In the miscellaneous diarrhea group, 10 patients had irritable bowel syndrome irritable bowel syndrome (IBS), condition characterized by frequently alternating constipation and diarrhea in the absence of any disease process. It is usually accompanied by abdominal pain, especially in the lower left quadrant, bloating, and flatulence. ; however, no mucosal erythema, edema edema (ĭdē`mə), abnormal accumulation of fluid in the body tissues or in the body cavities causing swelling or distention of the affected parts. , or ulceration was observed. None of the control patients had a history of diarrhea, and no erythema or ulceration was observed.

Table 2. Bacteroides fragilis enterotoxin gene amplification products in patients with inflammatory bowel disease.
(IBD)

Patient group (no.)       ETBF(a)    Gene (+)   p value(b)

IBD (83)                    11       (13.25%)     0.023
  Active (57)               11       (19.3%)      0.0026
  Inactive (26)              0
Crohn disease (60)           5
  Active (37)                5
  Inactive (23)              0
Ulcerative colitis (23)      6
  Active (20)                6
  Inactive (3)               0
Diarrhea (18)                5       (27.8%)      0.0005
Control (69)                 2       (2.89%)


(a) ETBF = enterotoxigenic Bacteroides fragilis

(b) p value in relation to control group

Fecal specimens from the IBD group were collected endoscopically from patients undergoing colonoscopy or flexible sigmoidoscopy for evaluation of symptoms of diarrhea or abdominal pain. The fecal specimens from the 18 diarrhea patients with negative routine stool cultures and the 69 controls were collected by endoscopy.

Fecal specimens were cultured for B. fragilis in the selective medium Bacteroides Bile Esculin agar Bile Esculin Agar (BEA) is a selective differential agar used to isolate and identify members of the genus Enterococcus. Bile salts are the selective ingredient, while esculin is the differential component. . Positive cultures were identified by using the Rapid ANA II Panel (REMEL, Inc, Lenexa, KS). Plates were incubated anaerobically at 37 [degrees] C for 48 hours. The presence of B. fragilis enterotoxin in the isolates was detected in the HT-29 colon cell line (13,14). HT-29 cells were grown and maintained in RPMI RPMI Rapid Prototyping & Manufacturing Institute
RPMI Roswell Park Memorial Institute
RPMI Royal Park Memorial Institute (culture medium) 
 medium with glutamine glutamine (gl`təmēn), organic compound, one of the 20 amino acids commonly found in animal proteins.  (Gibco, Life Technologies, Inc., Grand Island, NY) supplemented with penicillin (100 IU/ml), streptomycin streptomycin (strĕp'tōmī`sĭn), antibiotic produced by soil bacteria of the genus Streptomyces and active against both gram-positive and gram-negative bacteria (see Gram's stain), including species resistant to other  (100 [micro]g/ml) (Sigma, Saint Louis, MO), and heat-inactivated fetal bovine serum Fetal bovine serum ( or foetal bovine serum) is serum taken from the fetuses of cows. Fetal Bovine Serum (or FBS) is the most widely used serum in the culturing of cells. In some papers the expression foetal calf serum is used.  (Hyclone Laboratories, Inc., Logan, UT) at 12% in 25-ml flasks at 37 [degrees] C in 5% [CO.sub.2]. For the cytotoxicity assay, HT-29 cells were suspended in 20 ml of medium for each plate, and 180 [micro]l/well were placed into 96-well tissue culture plates (Coming Glass Works, Coming, NY). The cells were allowed to attach and grow for 2 to 3 days. Supernatants from B. fragilis isolates grown on Brain Heart Infusion Broth Brain heart infusion broth (or BHI broth) is a highly nutritious general-purpose growth medium for fastidious microorganisms, such as streptococci, pneumococci and meningococci.  were filtered through a 0.45-[micro]m Acrodisk syringe filter (Gelman Sciences, Ann Arbor, MI), and 20-[micro]l serial dilutions were placed into the wells in duplicate. The plates were incubated at 37 [degrees] C for 3 to 4 hours under 5% [CO.sub.2] and examined for typical cytopathic cytopathic /cy·to·path·ic/ (-path´ik) pertaining to or characterized by pathologic changes in cells.

cy·to·path·ic
adj.
Of or relating to degeneration or disease of cells.
 changes. Cultures were considered positive for B. fragilis enrerotoxin if a visible cytopathic effect was neutralized by specific antiserum antiserum /an·ti·se·rum/ (an´ti-se?rum) a serum containing antibody(ies), obtained from an animal immunized either by injection of antigen or by infection with microorganisms containing antigen. . The highest dilution of the culture supernatant producing cytopathic changes in at least 50% of the cells after 3 to 4 hours of incubation was considered the cytotoxic titer. For the neutralization neutralization, chemical reaction, according to the Arrhenius theory of acids and bases, in which a water solution of acid is mixed with a water solution of base to form a salt and water; this reaction is complete only if the resulting solution has neither acidic nor  assay, dilutions of 1:25 anti-enterotoxin rabbit antiserum in phosphate-buffered saline were mixed with culture supernatants positive for enteroxin. After incubation for 30 minutes at 37 [degrees] C, 20 [micro]l of each mixture was inoculated into HT-29 cells as in the cytotoxicity assay. Neutralization was indicated by the lack of cytotoxic effect.

DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 was extracted from the fecal specimens and amplified by using specific primers (14) to detect B. fragilis enterotoxin gene sequences.(1) Chi-square was used to determine statistical significance.

ETBF was cultured from four patients with IBD and two patients with diarrhea. However, B. fragilis enterotoxin gene sequences were detected in the stools of 11 (13.25%) of 83 patients with idiopathic IBD (five with Crohn disease and six with ulcerative colitis). All 11 patients positive for ETBF had active disease by endoscopic and histologic tests (Table 2). No ETBF was found in patients with inactive disease. The Crohn disease patients who were positive for enterotoxin gene sequences had superficial mucosal disease. In the control group, 2 (2.9%) of 69 patients were positive for B. fragilis enterotoxin gene sequences. Enterotoxin amplification products were also detected in the specimens of 5 (27.7%) of 18 patients with diarrhea due to miscellaneous causes (Table 2). All the specimens were positive when amplified with primers specific for the 16S rRNA gene of enteric bacteria.

Discussion

The normal colonic microflora of humans is a complex ecosystem of approximately 500 species of aerobic and anaerobic anaerobic /an·aer·o·bic/ (an?ah-ro´bik)
1. lacking molecular oxygen.

2. growing, living, or occurring in the absence of molecular oxygen; pertaining to an anaerobe.
 microorganisms. Although the gut of the newborn infant is sterile, Bacteroides species--the predominant anaerobic constituent of the colonic flora--appear at approximately 10 days, are established by 2 weeks, and usually remain constant lifelong (1,2). In breast-fed infants, Bifidobacterium are the predominant population, and Bacteroides group organisms remain undetectable. However, after weaning, the Bacteroides group organisms increase and Bifidobacterium organisms decrease substantially (16).

The exact etiology of idiopathic IBD is still unknown, although a potential role for infectious agents or toxins that may stimulate an inflammatory response has been suggested (16,17). For example, Peptostreptococcus, Coprococcus, and Bacteroides sp. have been reported in patients with Crohn disease (17). A role for these microorganisms in the disease process is also suggested by the clinical responses of some patients to antibiotics (18). Observations of B. thetaiotaomicron in patients with ulcerative colitis (16) and B. vulgatus in guinea pigs with experimentally induced ulcerative colitis (19) suggest that microorganisms may influence the development or maintenance of intestinal inflammation in IBD.

In this study, B. fragilis enterotoxin gene sequences were detected by nested polymerase chain reaction Nested polymerase chain reaction is a modification of polymerase chain reaction intended to reduce the contaminations in products due to the amplification of unexpected primer binding sites.  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) in the stools of 13.2% of patients with inflammatory bowel disease and 2.9% controls. The low recovery of ETBF in culture may be due to the length of time from specimen collection to processing in the laboratory (most specimens were kept frozen for at least 2 weeks before culturing). Similar results have been reported by Sack et al. (9), who found a marked reduction in the recovery of B. fragilis with time. Amplification of enterotoxin gene directly in the stools of these patients appears to be a more sensitive detection method. In a previous study (14), we found 100% correlation between PCR and enterotoxin production in isolates; we therefore did not routinely perform the HT-29 cell assay in specimens of these patients.

In the IBD group, all the patients positive for ETBF had active disease, which suggests an association with disease activation or flare-up. ETBF was also found in patients with ulcerative ulcerative /ul·cer·a·tive/ (ul´se-ra?tiv) (ul´ser-ah-tiv) pertaining to or characterized by ulceration.

ulcerative

pertaining to or characterized by ulceration.
 proctitis Proctitis Definition

Proctitis is an inflammation of the rectum.
Description

Proctitis affects mainly adolescents and adults. It is most common in men around age 30. Proctitis is caused by several different sexually transmitted diseases.
, collagenous colitis, and microscopic colitis. In patients with Crohn disease, ETBF was usually seen in the colonic superficial inflammatory disease type. The presence of ETBF in IBD patients may represent alterations of endogenous bacterial flora, which may be related to either the etiology or flare-up of the disease or both. Colonization with ETBF may be acquired early in life or may be a de novo infection related to flare-ups of the disease.

Acknowledgment

Dr. Prindiville is an Associate Professor of Medicine in the Division of Gastroenterology at the University of California, Davis.

The authors thank David M. Lyerly for providing the anti-enterotoxin rabbit antiserum.

(1) A 100-mg sample of stool was suspended in 400 [micro]l of TES TES Times Educational Supplement (publication)
TES The Elder Scrolls (series of computer games)
TES Thermal Emission Spectrometer
TES Teaching Every Student
TES Thermal Energy Storage
 buffer (50 mM Tris [pH 8], 5 mM EDTA EDTA: see chelating agents. , 50 mM NaCl) and centrifuged at 1,000 x g for 3 min to remove large particles. The supernatant was then centrifuged at 5,000 x g for 7 min. The pellet was washed once in 200 [micro]l of TES, and centrifuged at 5,000 x g for 3 min, and the supernatant was discarded. The pellet was suspended in 100 [micro]l of sterile [H.sub.2]O and boiled for 10 min, then centrifuged at 1,000 x g for 2 min and the supernatant containing the DNA extracted twice with phenol: chloroform: isoamyl alcohol (25:24:1) and precipitated with ethanol. The sequences of the primers and probes used and PCR conditions were as described (14). Amplification with the outer primers RS-3 (5' TGAAGTTAGTGCCCAGATGCAGG 3') and RS-4 (5' GCTCAGCGCCCAGTATA TGACC 3') yielded a 367-bp product. Amplification of this product with the inner primers RS-1 (5' TGCGGCGAACTCGGTTAATGC 3') and RS-2 (5'AGCTGGGTTGTAGACATCCCACTGG' 3') amplified a 290-bp product. The reaction mixtures were prepared in PCR buffer (50 mM KCl, 20 mM Tris HCl, 2.5 mM Mg[Cl.sub.2], 100 [micro]g bovine serum albumin per ml [pH 8.4]) and contained per reaction 20 pmol of the respective primers, 0.1 mM concentrations each of 2'-deoxynucleoside 5'-triphosphate, 2 U of recombinant DNA polymerase (rTaq) (Perkin Elmer, Norwalk, CT), and 10 [micro]l purified fecal DNA. The final reaction volume was adjusted to 100 [micro]l with sterile deonized water. The PCR profile included a denaturing step at 95 [degrees] C for 30 sec, followed by a 60 [degrees] C annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  step for 30 sec, with extension at 72 [degrees] C for 30 sec. The outer PCR was performed for 35 cycles in a thermal cycler (MJ Research). Amplification with the inner primers was done for 30 cycles. Negative controls included a blank containing all PCR reagents with no DNA. As control for amplifiable DNA in the stool specimens, primers targeting the 16S rRNA gene of enteric bacteria were used as described by Kato et al. (15).

References

(1.) Moore WE, Cato EP, Holdeman LV. Some current concepts in intestinal bacteriology bacteriology

Study of bacteria. Modern understanding of bacterial forms dates from Ferdinand Cohn's classifications. Other researchers, such as Louis Pasteur, established the connection between bacteria and fermentation and disease.
. Am J Clin Nutr 1978;31:S33-42.

(2.) Simon GL, Gorbach SL. Intestinal flora in health and disease. Gastroenterology 1984;86:174-93.

(3.) Gorbach SL, Barlett JG. Anaerobic Infections. N Engl J Med 1974;290:1177-84.

(4.) Myers LL, Firehammer BD, Shoop DS, Border MM. Bacteroides fragilis: a possible cause of acute diarrheal diseases in newborn lambs. Infect Immun 1984;44:241-4.

(5.) Sack RB, Myers LL, Almeido-Hill J, Shoop DS, Bradbury WC, Reid R, et al. Enterotoxigenic Bacteroides fragilis: epidemiologic studies of its role as a human diarrhoeal pathogen. J Diarrhoeal Dis Res 1992;10:4-9.

(6.) Pantosti A, Menozzi MG, Frate A, Sanfilippo L, D'Ambrosio F, Malpeli M. Detection of enterotoxigenic Bacteroides fragilis and its toxin in stool samples from adults and children in Italy. Clin Infect Dis 1997;24:12-6.

(7.) Weikel CS, Grieco FD, Reuben J, Myers LL, Sack RB. Human colonic epithelial cells, HT-.29/C1, treated with crude Bacteroides fragilis enterotoxin dramatically alter their morphology. Infect Immun 1992;60:321-7.

(8.) SanJoaquin VH, Griffis JC, Lee C, Sears CL. Association of Bacteroides fragilis with childhood diarrhea. Scand J Infect Dis 1995;27:211-5.

(9.) Sack RB, Albert MJ, Alam K, Neogi PK, Akbar MS. Isolation of enterotoxigenic Bacteroides fragilis from Bangladeshi children with diarrhea: a controlled study. J Clin Microbiol 1994;32:960-3.

(10.) VanTassell RL, Lyerly DM, Wilkins TD. Purification and characterization of an enterotoxin from Bacteroides fragilis. Infect Immun 1992;60:1343-50.

(11.) Sartor RB. Microbial factors in the pathogenesis of Crohn's disease, ulcerative colitis, and experimental intestinal inflammation. In: Kirsner JB, Shorter R J, editors. Inflammatory bowel disease. 4th ed. Baltimore: Williams and Wilkins; 1995. p. 96-124.

(12.) Hermens DJ, Miner PB Jr. Exacerbation of ulcerative colitis [clinical reference]. Gastroenterol 1991; 101:254-62.

(13.) Pantosti A, Cerquetti M, Colangeli R, D'Ambrosio F. Detection of intestinal and extraintestinal strains of enterotoxigenic Bacteroides fragilis by the HT-29 cytotoxicity assay. J Med Microbiol 1994;41:191-6.

(14.) Shetab R, Cohen cohen
 or kohen

(Hebrew: “priest”) Jewish priest descended from Zadok (a descendant of Aaron), priest at the First Temple of Jerusalem. The biblical priesthood was hereditary and male.
 SH, Prindiville TP, Tang YJ, Cantrell M, Rahmani D, et al. Detection of Bacteroides fragilis enterotoxin gene by PCR. J Clin Microbiol 1998;36:1729-32.

(15.) Kato N, Ou CY, Kato H, Bartley SL, Luo CC, Kilgore E, et al. Detection of toxigenic toxigenic /tox·i·gen·ic/ (tok?si-jen´ik)
1. producing or elaborating toxins.

2. derived from or containing toxins.


tox·i·gen·ic
adj.
Producing a poison; toxicogenic.
 Clostridium difficile in stool specimens by the polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is . J Infect Dis 1993;167:455-8.

(16.) Dore J, Sghir A, Hannequart-Gramet G, Corther G, Pochart P. Design and evaluation of a 16S rRNA-targeted oligonucleotide probe for specific detection and quantitation of human faecal Bacteroides populations. System Appl Microbiol 1998;21:65-71.

(17.) Van de Merwe JP, Schroder AM, Wensinck F, Hazenberg MP. The obligate obligate /ob·li·gate/ (ob´li-gat) pertaining to or characterized by the ability to survive only in a particular environment or to assume only a particular role, as an obligate anaerobe.  anaerobic faecal flora of patients with Crohn's disease and their first degree relatives. Scand J Gastroenterol 1988;23:1125-31.

(18.) Sartor RB. Current concepts of the etiology and pathogenesis of ulcerative colitis and Crohn's disease. Gastroenterol Clin North Am 1995;24:475-507.

(19.) Onderdonk AB, Cisneros RL, Bronson RT. Enhancement of experimental ulcerative colitis by immunization immunization: see immunity; vaccination.  with Bacteroides vulgatus. Infect Immun 1983;42:783-8.

Thomas P. Prindiville, Rafik A. Sheikh, Stuart H. Cohen, Yajarayma J. Tang, Mary C. Cantrell, and Joseph Silva, Jr.

University of California, Davis Medical Center, Sacramento, California, USA

Address for correspondence: Smart H. Cohen, Department of Internal Medicine, Division of Infectious Diseases, 4150 V Street, Patient Services and Support Building, Suite 500, Sacramento, CA 95817, USA; fax: 916734-7766; e-mail: stcohen@ucdavis.edu
COPYRIGHT 2000 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2000, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Silva, Joseph, Jr.
Publication:Emerging Infectious Diseases
Geographic Code:1USA
Date:Mar 1, 2000
Words:2542
Previous Article:Haemophilus influenzae type b and Streptococcus pneumoniae as causes of pneumonia among children in Beijing, China.
Next Article:Outbreak among drug users caused by a clonal strain of group A streptococcus.
Topics:



Related Articles
Gastrointestinal blues: research finds bugs that inflame the human gut. (Bacteroides linked to inflammatory bowel disease)
Foodborne Diseases.(Pamphlet)
Keeping antioxidants may spare gut.(potential treatments for inflammatory bowel diseases)(Brief Article)
Emergence of Metronidazole-Resistant Bacteroides fragilis, India.
Bacteroides peritonitis associated with colon cancer in a continuous ambulatory peritoneal dialysis patient. (CASE HISTORIES).(Statistical Data...
AMT GETS EUR 1.8 MILLION FOR EX VIVO GENE THERAPY FOR CROHN'S.
Black strap molasses for the treatment of inflammatory bowel disease-associated anemia.(Letters to the Editor)
Abdominal pain secondary to pylephlebitis: an uncommon disease of the portal venous system, treated with local thrombolytic therapy.(Section on...
Sugar coated: molecular dress-up may disguise gut bacteria.(This Week)
Anterior uveitis, inflammatory bowel disease, and ankylosing spondylitis in a HLA-B27-positive woman.(Case Report)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles