Printer Friendly
The Free Library
19,607,059 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Bacterial zoonoses and infective endocarditis, Algeria.


Blood culture--negative endocarditis endocarditis (ĕn'dōkärdī`tĭs), bacterial or fungal infection of the endocardium (inner lining of the heart) that can be either acute or subacute.  is common in Algeria. We describe the etiology of infective endocarditis infective endocarditis
n.
See infectious endocarditis.


infective endocarditis Acute endocarditis; bacterial endocarditis; subacute endocarditis Cardiology An infection of the endocardium which may involve the valves
 in this country. Samples from 110 cases in 108 patients were collected in Algiers. Blood cultures were performed in Algeria. Serologic se·rol·o·gy  
n. pl. se·rol·o·gies
1. The science that deals with the properties and reactions of serums, especially blood serum.

2.
 and molecular analysis of valves was performed in France. Infective endocarditis was classified as definite in 77 cases and possible in 33. Causative agents were detected by blood cultures in 48 cases. All 62 blood culture-negative endocarditis culture-negative endocarditis Cardiology Endocarditis in which a causative microorganism are not identified  cases were tested by serologic or molecular methods or both. Of these, 34 tested negative and 28 had an etiologic agent identified. A total of 18 infective endocarditis cases were caused by zoonotic Zoonotic
A disease which can be spread from animals to humans.

Mentioned in: Zoonosis
 and arthropodborne bacteria, including Bartonella quintana Bartonella quintana Rochalimaea quintana Infectious disease A slender, fastidious coccobacillary bacterium found in the normal flora of small rodents transmitted by body lice, which causes trench fever, bacillary splenitis, bacteremia, endocarditis,  (14 cases), Brucella melitensis Brucella mel·i·ten·sis
n.
A bacterium causing brucellosis in humans, abortion in goats, and a wasting disease in chickens.
 (2 cases), and Coxiella burnetii Coxiella burnetii Infectious disease The single species of genus Coxiella, family Rickettsiaceae, a short, rod-shaped bacterium; it is global in distribution, causes Q fever, spreads by aerosol, primarily infects cattle, sheep, goats, multiplies well in the  (2 cases). Our data underline the high prevalence of infective endocarditis caused by Bartonella quintana in northern Africa and the role of serologic and molecular tools for the diagnosis of blood culture--negative endocarditis.

**********

In Algeria, infective endocarditis is common. Vegetations graft primarily on lesions of rheumatic heart disease rheumatic heart disease
n.
Permanent damage to the valves of the heart usually caused by repeated attacks of rheumatic fever.


Rheumatic heart disease 
 (1,2). The rate of blood culture-negative endocarditis in Algeria is as high as 76% (2), which leads to difficulty in antimicrobial treatment. Most cases of blood culture--negative endocarditis have been thought to be caused by previous antimicrobial therapy. Infective endocarditis prognosis is often obscured by delayed diagnosis and a lack of specific treatment. In Algeria, poor socioeconomic level and lack of medical follow-up of patients are among the factors associated with endocarditis. The concentration of medical infrastructures in the northern part of the country leads to the referral of patients with serious illnesses, such as endocarditis, to northern hospitals, especially within Algiers (Figure 1). Algiers, the capital and largest city with [approximately equal to] 5 million inhabitants
:This article is about the video game. For Inhabitants of housing, see Residency
Inhabitants is an independently developed commercial puzzle game created by S+F Software. Details
The game is based loosely on the concepts from SameGame.
, has 7 hospitals, including 6 cardiology and 5 cardiac surgery wards. These wards receive patients with endocarditis, either for diagnosis and treatment or for corrective surgery of postendocarditis lesions. A retrospective analysis of Algerian infective endocarditis cases showed streptococci Streptococcus (plural, streptococci)
A genus of spherical-shaped anaerobic bacteria occurring in pairs or chains. Sydenham's chorea is considered a complication of a streptococcal throat infection.
 and staphylococci were the leading causes, followed by less frequent causes, such as enterobacteria en·ter·o·bac·te·ri·um  
n. pl. en·ter·o·bac·te·ri·a
Any of various gram-negative rod-shaped bacteria of the family Enterobacteriaceae that includes some pathogens of plants and animals, such as the colon bacillus and salmonella.
 and Haemophilus spp. (2). A high percentage of blood culture--negative endocarditis was noted. However, no study has evaluated the agents responsible for blood culture--negative endocarditis. New serologic and molecular tools, which have improved the etiologic diagnosis of infective endocarditis, have not been used to clarify the unknown role of fastidious fas·tid·i·ous
adj.
1. Possessing or displaying careful, meticulous attention to detail.

2. Difficult to please; exacting.

3. Having complex nutritional requirements. Used of microorganisms.
 bacteria (3-11). In our study, samples were collected from 110 patients with suspected cases of endocarditis. All samples were analyzed prospectively by using conventional microbiologic methods in Algiers. When available, cardiac valves and serum samples were stored to perform retrospective analysis at the Unite des Rickettsies (Marseille, France).

[FIGURE 1 OMITTED]

Material and Methods

Patients

Clinicians usually diagnose infective endocarditis by using the modified Duke criteria, which includes 3 major criteria (blood cultures typical of infective endocarditis, vegetations on echocardiography Echocardiography Definition

Echocardiography is a diagnostic test that uses ultrasound waves to create an image of the heart muscle. Ultrasound waves that rebound or echo off the heart can show the size, shape, and movement of the heart's valves and
, and Coxiella burnetii serologic testing with immunoglobulin [Ig] G phase 1 titer [greater than or equal to] 1:800) and 7 minor criteria (positive blood cultures, fever, previous heart disease, arterial embolism Arterial Embolism Definition

An embolus is a blood clot, bit of tissue or tumor, gas bubble, or other foreign body that circulates in the blood stream until it becomes stuck in a blood vessel.
, positive results on serologic examination for endocarditis bacterial pathogens, immunologic disorders, and atypical but compatible findings on echocardiography) (12). Definite infective endocarditis is diagnosed if any of the following conditions is met: 2 major criteria exist; 1 major criterion and 3 minor criteria; or 5 minor criteria. Possible infective endocarditis is considered if 1 major criterion and 1 minor criterion or 3 minor criteria exist. On the basis of these criteria, we could locate 110 cases in 108 patients with definite or possible infective endocarditis in 5 cardiology wards and 2 cardiac surgery wards in Algiers during a 42-month period (June 2000-December 2003). For each patient, an information sheet with epidemiologic, clinical, echocardiographic, and biologic data was filled out. A minimum of 3 blood cultures were sampled per patient. Thirty-eight cardiac valve specimens from 38 (35.4%) patients were sampled and stored at -80[degrees]C. Thirty-seven cardiac valve specimens from another 30 (27.3%) patients were formalin-fixed for pathologic testing. Sixty-one serum samples from 61 (55.5%) patients were available.

Blood Cultures

Either Castaneda Aer/Anaer (Bio-Rad, Marnes-La-Coquette, France) or broth for blood culture (Institut Pasteur d'Algerie, Algiers, Algeria) were used as blood-culture medium and were incubated at 37[degrees]C. If signs of culture appeared, a blood sample was taken from the culture bottle and Gram staining on Columbia blood agar blood agar
n.
A nutrient culture medium that is enriched with whole blood and used for the growth of certain strains of bacteria.
 (BioMerieux, Marcy L'Etoile, France) and chocolate agar (BioMerieux) was performed. Agar plates were incubated in 5% C[O.sub.2] at 37[degrees]C. In the event of culture, the microorganism microorganism /mi·cro·or·gan·ism/ (-or´gah-nizm) a microscopic organism; those of medical interest include bacteria, fungi, and protozoa.  was identified by API identification tests (BioMerieux). At day 15 of incubation, if cultures remained negative, an enrichment of each bottle was processed on Todd-Hewitt broth (Institut Pasteur d'Algerie) supplemented with 0.01% L-cysteine (Sigma-Aldrich, Lausanne, Switzerland) and 0.001% hypochloride pyridoxal pyridoxal /pyr·i·dox·al/ (pir?i-dok´sal) a form of vitamin B6.

pyridoxal phosphate  the prosthetic group of many enzymes involved in amino acid transformations.
 (Sigma-Aldrich). In cases of broth turbidity turbidity /tur·bid·i·ty/ (ter-bid´i-te) cloudiness; disturbance of solids (sediment) in a solution, so that it is not clear.tur´bid
Turbidity
The cloudiness or lack of transparency of a solution.
, microscopic examinations were performed as described above. If culture was positive, the strain was identified.

Valve Analysis

Axenic axenic /axen·ic/ (a-zen´ik) not contaminated by or associated with any foreign organisms; used in reference to pure cultures of microorganisms or to germ-free animals. Cf. gnotobiotic.  Culture

Thirty-eight excised cardiac valves were examined. If macroscopic macroscopic /mac·ro·scop·ic/ (mak?ro-skop´ik) gross (2).

mac·ro·scop·ic or mac·ro·scop·i·cal
adj.
1. Large enough to be perceived or examined by the unaided eye.

2.
 lesions of infective endocarditis were detected, we attempted to divide the valve into 3 parts to be used for bacteriologic bac·te·ri·ol·o·gy  
n.
The study of bacteria, especially in relation to medicine and agriculture.



bac·te
 analysis, storage at -80[degrees]C, and histologic analysis. Portions of valve tissue were ground with a mortar and pestle A mortar and pestle is a tool used to crush, grind, and mix substances. The pestle is a heavy stick whose end is used for pounding and grinding, and the mortar is a bowl. The substance is ground between the pestle and the mortar.  and cultured on Columbia blood agar and chocolate agar supplemented with Polyvitaminic Supplement (Bio-Rad) at 35[degrees]C for 15 days in 5% C[O.sub.2]. We performed direct Gram staining and identified colonies as described above.

Cell Culture

Cell cultures were performed in France. Specimens from 12 cardiac valves positive on polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) for Bartonella quintana or Brucella melitensis were spread onto cells grown within a shell vial as previously described (13,14). After 3 weeks of incubation at 37[degrees]C, the bacteria were detected by using Gimenez staining, a direct immunofluorescence Immunofluorescence

A technique that uses a fluorochrome to indicate the occurrence of a specific antigen-antibody reaction. The fluorochrome labels either an antigen or an antibody.
 test incorporating polyclonal antibodies directed against Bartonella, and by PCR targeting the 16S rRNA sequence.

Molecular Biology molecular biology, scientific study of the molecular basis of life processes, including cellular respiration, excretion, and reproduction. The term molecular biology was coined in 1938 by Warren Weaver, then director of the natural sciences program at the Rockefeller

For the 38 cardiac samples stored at -80[degrees]C, molecular analysis was performed in France. After 18 hours of proteinase proteinase /pro·tein·ase/ (pro´ten-as?) endopeptidase.

pro·tein·ase
n.
A protease that begins the hydrolytic breakdown of proteins usually by splitting them into polypeptide chains.
 K digestion at 55[degrees]C, DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 was extracted from tissue by using the MagNA Pure LC instrument (Roche Molecular Biochemicals, Manheim, Germany) and MagNA Pure LC DNA Isolation Kit III (Roche Molecular Biochemicals), as described by the manufacturer. A PCR-positive valve sample taken from a patient with Staphylococcus aureus Staphylococcus au·re·us
n.
A bacterium that causes furunculosis, pyemia, osteomyelitis, suppuration of wounds, and food poisoning.


Staphylococcus aureus Staphylococcus pyogenes
 endocarditis was used as a positive control. A mixture of all reagents used for DNA extraction and DNA extracted from normal heart tissue were processed as negative controls. One negative control was included for every 5 samples tested. PCR amplification and sequencing were performed, as previously described (15), by using primers in Table 1. PCR targeting the 16S rRNA sequence was systematically performed. When a negative result occurred, additional PCR was performed targeting the 18S and 28S rRNA internal transcribed spacer ITS (for internal transcribed spacer) refers to a piece of non-functional RNA situated between structural ribosomal RNAs (rRNA) on a common precursor transcript. Read from 5' to 3', this polycistronic rRNA precursor transcript contains the 5' external transcribed sequence (5' ETS),  to search for fungal infections. All positive PCR products were sequenced. The sequences were compared to those available in GenBank. Positive PCR results were considered as certain, when congruence existed between the results obtained with PCR and those obtained with other analyses. With a positive result interpreted as a possible case, we performed additional PCR, targeting a second gene with genus-specific primers (Table 1). When the PCR was positive and the sequence gave the same result, the case was reclassified as certain. When the second PCR was negative, we performed a PCR targeting a third gene. When both PCRs targeting the second and the third gene were negative, the result was classified as negative.

Histologic and Immunohistologic Analysis

Thirty-seven valve samples underwent fixation by formalin formalin /for·ma·lin/ (for´mah-lin) formaldehyde solution.

for·ma·lin
n.
An aqueous solution of formaldehyde that is 37 percent by weight.
 and were paraffin-embedded. Valve specimens were cut to 3-[micro]m thickness serial sections. Hematoxylin-eosinsaffron, periodic acid-Schiff per·i·od·ic acid-Schiff
adj. Abbr. PAS
Of, relating to, or being a reaction that tests for polysaccharides and related substances through the treatment of tissue sections with periodic acid stain and Schiff's reagent.
, Giemsa, Brown-Hopps/Brown-Brenn Gram, Grocott-Gomori methenamine methenamine /meth·en·amine/ (meth?en-am´in) an antibacterial used in urinary tract infections; administered as the hippurate and mandelate salts.

me·the·na·mine
n.
 silver, and Warthin-Starry stains were used (16). On the basis of the histologic findings, valve specimens were divided into 3 groups: A, B, and C. Group A samples showed histologic features of infective endocarditis consisting of vegetations or polymorphonuclear leukocyte polymorphonuclear leukocyte
n. Abbr. PMN
A white blood cell, usually neutrophilic, having a nucleus that is divided into lobes connected by strands of chromatin. Also called multinuclear leukocyte.
 rich valvular valvular /val·vu·lar/ (val´vu-ler) pertaining to, affecting, or of the nature of a valve.

val·vu·lar
adj.
Relating to, having, or operating by means of valves or valvelike parts.
 inflammation. Group B specimens showed valvular inflammation composed of mainly inflammatory mononuclear mononuclear /mono·nu·cle·ar/ (-noo´kle-er)
1. having but one nucleus.

2. a cell having a single nucleus, especially a monocyte of the blood or tissues.


mon·o·nu·cle·ar
adj.
 cells, macrophages Macrophages
White blood cells whose job is to destroy invading microorganisms. Listeria monocytogenes avoids being killed and can multiply within the macrophage.
, and lymphocytes without vegetations and microorganisms. Group C samples were devoid of inflammation, vegetations, or microorganisms. When Bartonella endocarditis was suspected, immunohistochemical analysis was performed on valve sections with an anti-Bartonella rabbit polyclonal antibody as previously described (17).

Serum Sample Analysis

Serologic Testing

Brucella Brucella /Bru·cel·la/ (broo-sel´ah) a genus of schizomycetes (family Brucellaceae). B. abor´tus causes infectious abortion in cattle and is the most common cause of brucellosis in humans. B.  serologic analysis was performed by Rose-Bengale agglutination agglutination, in biochemistry
agglutination, in biochemistry: see immunity.
agglutination, in linguistics
agglutination, in linguistics: see inflection.
 (Bio-Rad, Marnes-La-Coquette, France) for 61 serum samples from 61 patients in Algiers, and the samples were stored at -20[degrees]C for further study. The confirmation was observed by Wright Serology Serology

The division of biological science concerned with antigen-antibody reactions in serum. It properly encompasses any of these reactions, but is often used in a limited sense to denote laboratory diagnostic tests, especially for syphilis.
 (Bio-Rad). In the case of endocarditis, specific antibody titers exceeded 1:800. Bartonella and C. burnetii serologic testing was performed in France on all 61 samples. For Bartonella serologic testing, B. quintana and B. henselae were used as antigens in a microimmunofluorescence (MIF (1) (Maker Interchange Format) An alternate file format for a FrameMaker document. A MIF file is ASCII text, which can be created in another program and imported into FrameMaker. ) assay performed as previously described (18). A patient was considered to have Bartonella endocarditis when IgG titers [greater than or equal to] 1:800 were observed (18). The species identification was performed with Western blot Western blot
A technique developed in 1979 that is used to confirm ELISA results. HIV antigen is purified by electrophoresis and attached by blotting to a nylon or nitrocellulose filter.
 performed before and after serum cross-adsorption as previously described (19). For C. burnetii serologic testing, immunoglobulin (Ig) G, IgM, and IgA antibody titers were estimated by using an MIF test as previously described (20). A diagnosis of chronic endocarditis was made when a patient had an IgG phase I titer [greater than or equal to] 1:800 (20). A Light Cycler nested PCR was performed on positive serum samples for Bartonella and C. burnetii as previously described (21,22).

Results

Patient Characteristics

Our prospective study led to identification of 110 cases from 108 patients. The 110 episodes were classified as 77 (70%) definite infective endocarditis and 33 (30%) possible infective endocarditis (12). A second episode of infective endocarditis developed in 2 patients during our survey. The patients included 64 men and 40 women with a mean age of 35.3 years (range 17-72 years). The series included 4 children, 2 boys (6 and 8 years of age) and 2 girls (9 and 14 years of age). Among the patients, 34 came from rural areas, 61 lived in urban areas, 1 was in prison, and no information could be obtained for 12. Among 96 patients whose living conditions were known, 59 (61.5%) lived in poor and crowded families of at least 10 persons. Among the 110 cases, 87 (79%) episodes were diagnosed on native valve and 23 (21%) on prosthetic pros·thet·ic
adj.
1. Serving as or relating to a prosthesis.

2. Of or relating to prosthetics.



prosthetic

serving as a substitute; pertaining to prostheses or to prosthetics.
 valve. The mitral valve mitral valve
n.
A valve of the heart, composed of two triangular flaps, that is located between the left atrium and left ventricle and regulates blood flow between these chambers. Also called bicuspid valve, left atrioventricular valve.
 was affected in 31 (28.2%) cases, the aortic aortic

pertaining to or emanating from the aorta. See also aortic arch.


aortic aneurysm
occurs most often in dogs, where it is caused by Spirocerca lupi larvae, turkeys and primates, causing dyspnea, cyanosis and coughing.
 in 29 (26.3%), and both in 41 (37.2%). The tricuspid valve tricuspid valve
n.
The three-segmented valve of the heart that keeps blood in the right ventricle from flowing back into the right atrium. Also called right atrioventricular valve.
 was affected in 3 (2.7%) patients, and 4 (3.6%) had aortic, mitral mitral /mi·tral/ (mi´tril) shaped like a miter; pertaining to the mitral valve.

mi·tral
adj.
1. Relating to a mitral valve.

2. Shaped like a bishop's miter.
, and tricuspid tricuspid /tri·cus·pid/ (tri-kus´pid) having three points or cusps, as a valve of the heart.

tri·cus·pid
n.
An organ or a part, especially a tooth, having three cusps.

adj.
 involvement. We reported 1 case with mitral and pulmonary valves affected, with the persistence of an arterial canal arterial canal
n.
See ductus arteriosus.
, and 1 patient on a pacemaker.

Blood Cultures

Blood cultures identified 48 microorganisms (Table 2). Of the 22 Streptococcus streptococcus (strĕp'təkŏk`əs), any of a group of gram-positive bacteria, genus Streptococcus, some of which cause disease.  spp. cultures, 5 Streptococcus mitis, 6 Streptococcus sp., 3 S. agalactiae, 3 Granulicatella adiacens, 2 [alpha]-Streptococcus, 1 S. oralis, 1 S. intermedius, and 1 Gemella morbillorum were identified. Seven Staphylococcus aureus and 5 coagulase-negative Staphylococcus staphylococcus (stăf'ələkŏk`əs), any of the pathogenic bacteria, parasitic to humans, that belong to the genus Staphylococcus. The spherical bacterial cells (cocci) typically occur in irregular clusters [Gr.  were observed. One Haemophilus influenzae Haemophilus in·flu·en·zae
n.
A gram-negative, rod-shaped bacterium of the genus Haemophilus, especially Haemophilus influenzae type b, that occurs in the human respiratory tract and causes acute respiratory infections, acute conjunctivitis, and
, 1 H. aphrophilus, 1 Haemophilus sp., 1 Kingella kingae, and 1 Actinobacillus actinomycetemcomitans were identified among the HACEK HACEK Acronym for bacteria that cause infective endocarditis–Haemophilus, Actinobacillus, Cardiobacterium, Eikenella, Kingella spp. See Infective endocarditis.  group (Haemophilus, Actinobacillus, Cardiobacterium, Eikenella, Kingella.). One Brucella melitensis, a zoonotic agent, was isolated.

Serum Analysis

Using serologic testing, infective endocarditis could be diagnosed in 11 (18%) of 61 serum samples. A positive Brucella serologic result with titers of 1:3,200 was observed for 2 patients (1 sample was also culture positive). Two other patients had a typical profile of Q fever Q fever: see rickettsia.  endocarditis (Phase I: IgG 1:3,200; IgM 1:25; IgA 1:1,600/Phase II: IgG 1:6,400; IgM 1:25; IgA 1:1,600 for 1 patient and Phase I: IgG 1:6,400; IgM 1:800; IgA 1:50/Phase II: IgG 1:12,800; IgM 1:800; IgA 1:100 for the other patient). Among these 2 patients, C. burnetii Light Cycler nested-PCR performed on serum samples was positive for the sample from 1 patient. A positive Bartonella serologic result, with IgG [greater than or equal to] 1:800, was observed for 7 patients (Table 3). The Western-blot analysis of the 7 serum samples allowed the specific diagnosis of B. quintana (Figure 2). Of these 7 patients, B. quintana Light Cycler nested-PCR performed on serum samples was positive for 5 patients (Table 3).

[FIGURE 2 OMITTED]

Cardiac Valve Analysis

Axenic culture of cardiac valves was positive for 9 samples. The growth of 2 coagulase-negative Staphylococcus, 2 Streptococcus sp., 1 Staphylococcus aureus, 1 Streptococcus mitis, 1 S. intermedius, I Corynebacterium Corynebacterium /Co·ry·ne·bac·te·ri·um/ (-bak-ter´e-um) a genus of bacteria including C. ac´nes, a species present in acne lesions, C. diphthe´riae, the etiologic agent of diphtheria, C.  sp., and 1 Candida kruzei was observed. Another sample was polymicrobial. Cell culture allowed the growth of B. quintana, an arthropodborne disease agent, from 3 valve samples (Tables 2 and 3). The numbers of valve specimens classified into groups A, B, and C were 21, 5, and 11, respectively. With the exception of Bartonella endocarditis, the samples with histologic features of infective endocarditis had vegetations in most cases, moderate fibrosis, calcifications in some cases, and numerous inflammatory infiltrates composed predominantly of polymorphonuclear leukocytes polymorphonuclear leukocytes (pol´ēmôr´fōnoo´klēr loo´kō-sīts),
n.
 and abundant neovascularization. By using special stains, microorganisms were visualized in 16 samples from group A, gram-positive cocci cocci /coc·ci/ (kok´si) plural of coccus.

cocci

[L.] plural of coccus.
 and gram-negative bacilli bacilli /ba·cil·li/ (bah-sil´i) plural of bacillus.

bacilli

see bacillus.
 in 8 cases each. In samples from group B, the inflammatory infiltrates were rare and focal and consisted mainly of macrophages and lymphocytes with discrete neovascularization. The specimens from group C showed noninflammatory degenerative damage with extensive fibrosis and often calcifications. The histologic features of Bartonella endocarditis were different from the other infective endocarditis. Samples from 7 cases with Bartonella endocarditis were examined. The valve tissues showed degenerative damage with extensive fibrosis. The valve tissues were poorly inflamed with rare mononuclear inflammatory cell infiltrates composed of lymphocytes and macrophages and discrete neovascularization. Vegetations, present in all samples, were small in size. In all cases, the Warthin-Starry stain detected Bartonella, mainly in vegetations as small bacillary bacillary /bac·il·la·ry/ (bas´i-lar?e) pertaining to bacilli or to rodlike structures.

bac·il·lar·y or ba·cil·lar
adj.
1. Shaped like a rod.

2.
 organisms (Figure 3).

[FIGURE 3 OMITTED]

The 16S rRNA PCR was positive for 29 cardiac valves (Tables 2 and 4). B. quintana was detected on 10 specimens (Table 3). Among the Streptococcus spp. and related genera, 3 Streptococcus sp., 1 S. mitis, 1 S. mutans, 1 S. gordonii, 1 S. pneumoniae, and 1 Granulicatella adiacens were detected. Two Staphylococcus aureus and 1 coagulase-negative Staphylococcus were identified. Among the 2 bacteria from the HACEK group, 1 H. paraphrophilus and 1 Cardiobacterium hominis were identified. PCR performed with a second gene confirmed the previous PCR results with 1 exception. One Streptococcus sp. was not retrieved by PCR targeting a second or third gene and was considered as contamination. The PCR targeting the 18S-28S rRNA ITS allowed the detection of 1 Candida parapsilosis. Finally, Bartonella spp. were also specifically visualized in vegetations by immunohistochemistry in all the cases of B. quintana endocarditis (Figure 3).

Causative Microorganisms and Discordant Results

The overall distribution of causative microorganisms and their identification, depending on the diagnostic tools used, are displayed in Table 2. An etiologic agent could not be determined for 10 (13%) of definite cases and 28 (76%) of possible cases. For the 2 patients with recurring infective endocarditis, the cause for the first episode was different than that of the second episode. One patient had endocarditis caused by Streptococcus oralis, and 1 year later, endocarditis caused by K. kingae developed. For the other patient, no etiologic diagnosis was established for the first episode, during which a valve removal was necessary. Four months after cardiac surgery, the patient had endocarditis caused by Staphylococcus epidermidis Staphylococcus epidermidis Microbiology A coagulase-negative staphylococcus that comprises up to 80% of clinical isolates Infections by S epidermidis . Nine discrepant dis·crep·ant  
adj.
Marked by discrepancy; disagreeing.



[Middle English discrepaunt, from Latin discrep
 results were also observed and are summarized in Table 4.

Discussion

Endocarditis cases with fastidious agents escape microbiologic diagnosis classically applied in Algerian laboratories. For the first time, we established a profile of the microbiologic etiology of infective endocarditis in Algeria. Our conclusions concerning PCR results were submitted to a rigorous strategy of validation. All of the controls must be correct for validating each assay. The result was considered true if confirmation was obtained by successfully amplifying bacterial DNA when targeting another gene, the PCR result was congruent with the results of other diagnostic tools, or both.

Of the 77 cases of definite infective endocarditis, the cause was found for 67 (87%) cases. The diagnosis was performed on the basis of positive blood cultures for 44 cases. For 20 (26%) cases, no etiologic diagnosis was obtained in Algeria but was performed in France on the basis of cardiac valve PCR, and Bartonella and Coxiella burnetii serologic testing. These data show improvement in the etiologic diagnosis of endocarditis when molecular or serologic tools are used. The rate of remaining infective endocarditis without cause is comparable to the prevalence in western countries (16). As in other countries, the etiologic distribution is dominated by the bacteria responsible for infective endocarditis, such as Streptococcus spp. and related genera, Staphylococcus spp., and bacteria from the HACEK group. The difference in comparison to other countries is that blood culture-negative endocarditis is mainly linked to zoonotic and arthropodborne agents.

For the 33 cases of possible infective endocarditis, the number of etiologic diagnoses was fewer than those for definitive infective endocarditis However, in this group, some cases are infective endocarditis and others are not. If we consider a Bartonella serologic result [greater than or equal to] 1:800 as a major criterion (5), the 2 possible cases of B. quintana infective endocarditis will be classified as definite. Therefore, Bartonella serologic results should be taken into account in future revisions of the Duke criteria. Of the 48 case-patients with positive blood cultures, 19 had additional samples tested through a second analysis (serologic or molecular methods). Of the 19, 11 had negative results, 5 were concordant, and 3 were discordant. Of these 48 cultures, 1 corresponds to brucellosis brucellosis (br'səlō`sĭs) or Bang's disease, infectious disease of farm animals that is sometimes transmitted to humans. .

Of the 62 blood culture-negative endocarditis cases, samples from all were tested by serologic or molecular methods. Of these, 34 were negative, and 28 had an etiologic agent identified. Seventeen of those were due to zoonoses Zoonoses

Infections of humans caused by the transmission of disease agents that naturally live in animals. People become infected when they unwittingly intrude into the life cycle of the disease agent and become unnatural hosts.
 or arthropodborne bacterial diseases.

Discrepancies were observed between the results obtained by using the various techniques. Some discrepancies resulted from culture contamination with the cutaneous cutaneous /cu·ta·ne·ous/ (ku-ta´ne-us) pertaining to the skin.

cu·ta·ne·ous
adj.
Of, relating to, or affecting the skin.


Cutaneous
Pertaining to the skin.
 flora. A significant rate of contamination has been already reported, and the low specificity of valve culture that we observed confirms these results (23-25). One discrepancy was caused by identification problems at the species level for Streptococcus. This fact has been previously reported (7). Another discrepancy was linked to a Candida species misidentification by phenotypic analysis, which was corrected by using molecular tools. The last discordant case corresponded to a patient for whom blood cultures were positive for H. influenzae. When serum samples were analyzed, a diagnosis of B. quintana endocarditis has been established in the presence of positive Bartonella MIF, Western blot, and PCR. We do not know if B. quintana was misidentified as H. influenzae, which is possible as both are slow-growing, hemin-dependent, small, gram-negative bacteria (26). We believe that as fastidious, small, gram-negative bacteria growing in blood agar, the 2 organisms may be confused.

In Algeria, cases of infective endocarditis caused by zoonotic and arthropodborne disease agents, such as Coxiella burnetii, Brucella melitensis, and Bartonella quintana are frequently observed and correspond to one quarter of the performed diagnoses. B. quintana would be one of the most common agents of infective endocarditis in our Algiers series (15.6% of definite infective endocarditis). The prevalence of endocarditis caused by Bartonella varies depends on the country. In Canada, Bartonella causes 3% of endocarditis cases (27). In Sweden, no Bartonella endocarditis was identified in an analysis of 334 infective endocarditis cases (28). In the United Kingdom, Bartonella endocarditis accounts for 1.1% of infective endocarditis cases (29). In Germany and in France, Bartonella endocarditis accounts for 3% of all infective endocarditis (A. Sander et al. unpub. data) (27). The frequency of Bartonella endocarditis is <1% for Sweden and higher in France, Germany, the United Kingdom (3%), and North Africa (15%). Such differences may be linked to differences in living conditions.

Homeless people are at risk for B. quintana endocarditis (30,31). Indeed, B. quintana, like Rickettsia prowazekii Rickettsia pro·wa·zek·i·i
n.
A bacterium that causes epidemic typhus fever.
, the agent of epidemic typhus epidemic typhus
n.
A form of typhus characterized by high fever, mental and physical depression, and macular and papular eruptions; it is caused by Rickettsia prowazekii and transmitted by body lice.
, is transmitted by body lice body lice Vox populi Pediculosis humanis corporis. See Louse. . Those who live in extreme poverty are often the persons who are infested in·fest  
tr.v. in·fest·ed, in·fest·ing, in·fests
1. To inhabit or overrun in numbers or quantities large enough to be harmful, threatening, or obnoxious:
. The recent description of typhus typhus, any of a group of infectious diseases caused by microorganisms classified between bacteria and viruses, known as rickettsias. Typhus diseases are characterized by high fever and an early onset of rash and headache.  in Algeria confirms that poor socioeconomic conditions still exist in this country (32-34). In our studies, B. quintana endocarditis cases occurred in patients living in poor conditions. Although the only known reservoir for B. quintana is humans, the bacterium has recently been associated with fleas (35). Moreover, some cases of B. quintana infections have been linked to contact with cats and cat fleas in patients who were not homeless and did not have body lice (36).

Brucella melitensis, well known in northern Africa, where bucellosis is endemic in certain areas, accounts for 2.6% of all infective endocarditis cases for which an etiologic diagnosis has been performed (37). Be cause C. burnetii detection requires specialized tests not normally found in most laboratories, it is not often diagnosed in Algeria (38). Two cases were retrospectively detected.

Importance of infective endocarditis caused by zoonotic and arthropodborne agents in Algeria leads to 2 considerations. First, specific serologic tests need to be used for diagnosis. Indeed, 25% of our etiologic diagnoses correspond to microorganisms for which the diagnosis is usually based on serologic testing. Secondly, the therapeutic impact of Brucella and Coxiella diagnosis is important because the antimicrobial treatment of endocarditis caused by these agents must include doxycycline doxycycline /doxy·cy·cline/ (dok?se-si´klen) a semisynthetic broad-spectrum tetracycline antibiotic, active against a wide range of gram-positive and gram-negative organisms; used also as d. calcium and d. hyclate. . The 2 patients with Q fever endocarditis died during their hospitalization because of inadequate antimicrobial therapy. Finally, the high rate of blood culture-negative endocarditis was not linked to prior antimicrobial therapy but rather to fastidious microorganisms for which serologic testing (as for zoonotic and arthropodborne disease agents) or molecular analysis (as for Mycoplasma hominis Mycoplasma hom·i·nis
n.
A microorganism that is found in the genital tract and anal canal of humans.
 [39] and Corynebacterium spp.) are diagnostic tools.

Our study underlines the need to perform serologic analysis to determine for the etiology of infective endocarditis. Bartonella serologic testing is an important tool for diagnosis of blood culture negative endocarditis and should be taken into account in future revisions of the Duke criteria. This study made it possible to show that zoonotic and arthropodborne disease agents cause one quarter of infective endocarditis in Algeria; B. quintana caused 13% of our cases.
Table 1. Primers used for broad-range 16S rRNA polymerase chain
reaction (PCR) and, according to species identified by sequencing,
primers targeting a second gene for confirmation of positive 16S
rRNA PCR results and primers used for fungal PCR

Microorganisms           Gene               Forward primer

Eubacteria             16S rRNA       536f 5' CAGCAGCCGCGGTAATAC
Staphylococcus spp.      RpoB       StphF 5' AAACCIATACGCAATTGGTT
Streptococcus spp.       RpoB       StrpF 5' AARYTIGGMCCTGAAGAAAT
Enterococcus spp.        RpoB       StrpF 5' AARYTIGGMCCTGAAGAAAT
Streptococcus spp.        SOD      d1 5' CCITAYICITAYGAYGCIYTIGARCC
Enterobacteriaceae       RpoB       CM7 5' AACCAGTTCCGCGTTGGCCTGG
Mycoplasma hominis       FtsY         MH1F 5' GTGTTGTATCGACAACAG
Coxiella burnetii        IS111      Trans3 5' CAACTGTGTGGAATTGATGA
Bartonella spp.           ITS        ITSF1 5' GCGACTGGGGTGAAGTGG
Bacillus spp.            RpoB       Bc55F 5' TCTCGTATGGAACGTGTTGT
Corynebacterium spp.     RpoB       C2700F 5' GWATGAACATYGGBCAGGT
Fungi                 18S-28S ITS     FCU 5' TCCGTAGGTGAACCTGCGG

Microorganisms                 Reverse primer

Eubacteria              RP2 5' ACGGCTACCTTGTTACGACTT
Staphylococcus spp.     StphR 5' GTTTCATGACTTGGGACGG
Streptococcus spp.    StrpR 5' TGIARTTTRTCATCAACCATGTG
Enterococcus spp.     StrpR 5' TGIARTTTRTCATCAACCATGTG
Streptococcus spp.    d2 5' ARRTARTAIGCRTGYTCCCAIACRTC
Enterobacteriaceae      CM31b 5' CCTGAACAACACGCTCGGA
Mycoplasma hominis        MH1R 5' GTGTTGTATCGACAA
Coxiella burnetii      Trans5 5' TTTACATGACGCAATAGCGC
Bartonella spp.         ITSR1 5' AGGCTTGGGATCATCATC
Bacillus spp.          Bc260R 5' TGAACGTCACGYACTTCAAA
Corynebacterium spp.   C3130R 5' TCCATYTCRCCRAARCGCT
Fungi                   RCU 5' GCTGCGTTCTTCATCGATGC

Table 2. Distribution of 110 infective endocarditis cases * diagnosed
in Algeria using blood culture, cardiac valve culture, serologic
testing, cardiac valve polymerase chain reaction (PCR), and PCR on
serum samples

                                 Positive samples/tested samples

                                 Blood        Cardiac valve  Serologic
                                culture          culture      testing
Identified microorganisms      (N = 110)        (N = 38)     (N = 61)

Streptococcus spp. and           0/22              0/4          NP
related genera
Bartonella quintana               0/1              0/3          5/2
                           ([double dagger])
Staphylococcus spp.              2/10              0/3          NP
HACEK ([section])                 0/4              0/0          NP
Enterococcus spp.                 1/1              0/0          NP
Brucella melitensis               0/1              0/0          2/0
Coxiella burnetii                 0/0              0/0          2/0
Corynebacterium spp.              0/2              0/1          NP
Mycoplasma hominis                0/0              0/0          NP
Enterobacteria spp.               1/1              0/0          NP
Alcaligenes faecalis              0/1              0/0          NP
Pseudomonas aeruginosa            0/1              0/0          NP
Bacillus cereus                   0/0              0/0          NP
Candida spp.                      0/0              0/1          NP

                             Negative samples for definite infective
                            endocarditis/negative samples for possible
                                      infective endocarditis

No etiology                      10/25             2/7         8/20

                           Positive samples/tested samples

                            Cardiac   PCR on serum
                           valve PCR     sample
Identified microorganisms  (N = 38)     (N = 9)     Total

Streptococcus spp. and        7/0         NP        24/0
related genera                        ([dagger])
Bartonella quintana          10/0         3/2       12/2

Staphylococcus spp.           2/1          NP       11/3
HACEK ([section])             1/1          NP        5/1
Enterococcus spp.             1/0          NP        2/1
Brucella melitensis           2/0          NP        2/0
Coxiella burnetii             0/0         1/NP       2/0
Corynebacterium spp.          1/0          NP        2/0
Mycoplasma hominis            1/0          NP        1/0
Enterobacteria spp.           0/0          NP        1/1
Alcaligenes faecalis          0/0          NP        1/0
Pseudomonas aeruginosa        0/0          NP        1/0
Bacillus cereus               1/0          NP        1/0
Candida spp.                  1/0          NP        1/0

                            Negative samples for definite
                           infective endocarditis/negative
                            samples for possible infective
                                     endocarditis

No etiology                   2/7        NP/NP

* 77 definite and 33 possible.

([dagger]) NP, not performed.

([double dagger]) If we consider that Bartonella quintana was
misidentified as Haemophilus influenzae.

([section]) HACEK, Haemophilus, Actinobacillus, Cardiobacterium,
Eikenella, Kingella.

Table 3. Living conditions, involved cardiac valves, and diagnostic
tools for Bartonella quintana endocarditis cases in 14 patients *

                              Involved                    Bartonella
                               cardiac         Blood      serologic
Patient  Living conditions     valves         culture      testing

1        Poor rural area       Aortic            -          1:800
2        Poor rural area       Mitral            -         1:1,600
3        Poor urban area       Mitral            -          1:800
4        Poor rural area       Aortic            -            NP
5        Poor urban area      Tricuspid     + ([dagger])   1:1,600
6        Poor rural area   Aortic + mitral       -            NP
7            Unknown       Aortic + mitral       -            NP
8        Poor urban area       Aortic            -          1:800
9        Good urban area       Aortic            -            NP
10       Good rural area   Aortic + mitral       -            NP
11       Poor urban area       Mitral            -         1:3,200
12       Poor rural area       Aortic            -         1:3,200
13       Poor rural area       Aortic            -            NP
14       Poor rural area       Aortic            -            NP

                         Cardiac
         PCR on serum     valve       Cardiac    Histologic
Patient     sample       culture     valve PCR    analysis

1        B. quintana   B. quintana  B. quintana      NP
2             --           --       B. quintana   WS+/IC+
3        B. quintana       NP           NP        WS+/IC+
4             NP           --       B. quintana      NP
5        B. quintana       NP           NP           NP
6             NP           --       B. quintana   WS+/IC+
7             NP           --       B. quintana   WS+/IC+
8        B. quintana       --       B. quintana   WS+/IC+
9             NP       B. quintana  B. quintana   WS+/IC+
10            NP       B. quintana  B. quintana   WS+/IC+
11            --           NP           NP           NP
12       B. quintana       NP           NP           NP
13            NP           --       B. quintana      NP
14            NP           --       B. quintana      NP

* NP, not performed; WS+, Warthin-Starry positive; IC+,
immunochemistry positive; PCR, polymerase chain reaction.

([dagger]) If we consider that B. quintana was misidentified as
Haemophilus influenzae.

Table 4. Discrepant results between blood culture, cardiac valve
culture, cardiac valve PCR, and serologic testing for 9 patients *

                                      Cardiac valve
Patient              Blood culture    culture

1 ([dagger])         Negative         Candida krusei

2 ([double dagger])  Negative         Polymicrobial

3 ([double dagger])  Negative         CNS

4 ([double dagger])  Negative         CNS

5 ([double dagger])  S. mitis         Staphylococcus
                                      aureus
6 ([dagger])         H. influenzae    NP

7 ([dagger])         Streptococcus    Streptococcus
                     intermedius      intermedius

8 ([double dagger])  Negative         Corynebacterium
                                      spp.

9 ([double dagger])  Negative         S. mitis

                                      PCR targeting
Patient              16S rRNA PCR     another gene

1 ([dagger])         Streptococcus    RpoB: negative
                     spp.             SOD: negative
                                      18-28S ITS: C.
                                      parapsilosis

2 ([double dagger])  Streptococcus    S. mitis
                     mitis

3 ([double dagger])  Haemophilus      NP
                     paraphrophilus

4 ([double dagger])  Bartonella       B. quintana
                     quintana

5 ([double dagger])  Streptococcus    S. gordonii
                     gordonii

6 ([dagger])         NP               NP

7 ([dagger])         S. mutans        S. mutans

8 ([double dagger])  Bacillus cereus  B. cereus

9 ([double dagger])  Enterococcus     E. gallinarum
                     gallinarum

                     Histologic       Serologic
Patient              analysis         testing    Conclusions

1 ([dagger])         NP               Negative   C. parapsilosis

2 ([double dagger])  A                Negative   S. mitis

3 ([double dagger])  A/BGN            Negative   H. paraphrophilus

4 ([double dagger])  NP               NP         B. quintana

5 ([double dagger])  A/CGP            Negative   S. gordonii

6 ([dagger])         NP               1:1,600    B. quintana
                                      Positive
                                      PCR on
                                      serum
                                      samples

7 ([dagger])         A                NP         S. mutans

8 ([double dagger])  A                Negative   B. cereus

9 ([double dagger])  A /CGP           Negative   E. gallinarum

* PCR, polymerase chain reaction; NP, not performed;
CNS, coagulase-negative Staphylococcus; BGN, bacillus
gram negative; CGP, cocci gram positive.

([dagger]) The microorganisms detected in valve culture
were contaminants.

([double dagger]) The microorganisms were misidentified.


Acknowledgments

We thank Kelly Johnston for reviewing the manuscript.

Dr. Benslimani is a physician working at the E.H.S. Dr Maouche, Algiers, Algeria. Her research interests include the clinical features and diagnosis of endocarditis.

References

(1.) Moreillon P, Que YA. Infective endocarditis. Lancet. 2004;363:139-49.

(2.) Kezzal K. Importance of blood culture in septicemia septicemia (sĕptĭsē`mēə), invasion of the bloodstream by virulent bacteria that multiply and discharge their toxic products. The disorder, which is serious and sometimes fatal, is commonly known as blood poisoning. , particularly bacterial endocarditis bacterial endocarditis
n.
Infectious endocarditis caused by the direct invasion of bacteria and leading to deformity of the heart valves.


bacterial endocarditis
. Arch Inst Pasteur Alger. 1986;55:41-60.

(3.) Bentley S, Maiwald M, Murphy L, Pallen M, Yeats C, Dover L, et al. Sequencing and analysis of the genome of the Whipple's disease Whip·ple's disease
n.
A rare disease in which the intestinal wall is invaded by macrophages containing the remnants of bacteria and which is characterized by steatorrhea, generalized lymphadenopathy, arthritis, fever, and cough.
 bacterium Tropheryma whipplei. Lancet. 2003;361:637-44.

(4.) Gauduchon V, Chalabreysse L, Etienne J, Celard M, Benito Y, Lepidi H, et al. Molecular diagnosis of infective endocarditis by PCR amplification and direct sequencing of DNA from valves tissue. J Clin Microbiol. 2003;41:763-6.

(5.) Rolain JM, Lecam C, Raoult D. Simplified serological serological

pertaining to or emanating from serology.


serological test
one involving examination of blood serum usually for antibody.
 diagnosis of endocarditis due to Coxiella burnetii and Bartonella. Clin Diagn Lab Immunol. 2003;10:1147-8.

(6.) Watkin RA, Lang S, Lambert PA, Littler WA, Elliott TSJ TSJ Tribunal Superior de Justicia (Spain)
TSJ The Super Jesus (Australian band) 
. The microbial microbial

pertaining to or emanating from a microbe.


microbial digestion
the breakdown of organic material, especially feedstuffs, by microbial organisms.
 diagnosis of infective endocarditis. J Infect. 2003;47:1-11.

(7.) Podglajen I, Bellery F, Poyart C, Coudol P, Buu-Hoi A, Bruneval P, et al. Comparative molecular and microbiologic diagnosis of bacterial endocarditis. Emerg Infect Dis. 2003;9:1543-7.

(8.) Goldenberger D, Kunzli A, Vogt P, Zbinden R, Altwegg M. Molecular diagnosis of bacterial endocarditis by broad-range PCR amplification and direct sequencing. J Clin Microbiol. 1997;35:2733-9.

(9.) Mylonakis E, Calderwood S. Infective endocarditis in adults. N Engl J Med. 2001;345:1318-30.

(10.) Millar BC, Moore JE. Emerging issues in infective endocarditis. Emerg infect Dis. 2004; 10:1110-6.

(11.) Millar BC, Moore JE. Current trends in the molecular diagnosis of infective endocarditis. Eur J Clin Microbiol Infect Dis. 2004;23:353-65.

(12.) Li JS, Sexton DJ, Mick N, Nettles net·tle  
n.
1. Any of numerous plants of the genus Urtica, having toothed leaves, unisexual apetalous flowers, and stinging hairs that cause skin irritation on contact.

2. Any of various hairy, stinging, or prickly plants.
 R, Fowler VG Jr, Ryan T, et al. Proposed modifications to the Duke criteria for the diagnosis of infective endocarditis. Clin Infect Dis. 2000;30:633-8.

(13.) Raoult D, Vestris G, Enea M. Isolation of 16 strains of Coxiella burnetii from patients by using a sensitive centrifugation Centrifugation

A mechanical method of separating immiscible liquids or solids from liquids by the application of centrifugal force. This force can be very great, and separations which proceed slowly by gravity can be speeded up enormously in centrifugal
 cell culture system and establishment of the strains in HEL cells. J Clin Microbiol. 1990;28:2482-4.

(14.) La Scola B, Raoult D. Culture of Bartonella quintana and Bartonella henselae Bartonella henselae Rochalimaea henselae Infectious disease A slender, fastidious coccobacillary bacterium of the normal flora of cats associated with bacteremia, endocarditis, cat-scratch disease, bacillary angiomatosis, peliosis hepatis; it may affect  from human samples: a 5-year experience (1993 to 1998). J Clin Microbiol. 1999;37:1899-905.

(15.) La Scola B, Michel G, Raoult D. Use of amplification and sequencing of the 16S rRNA gene to diagnose Mycoplasma pneumoniae osteomyelitis osteomyelitis (ŏs'tēōmī'əlī`tĭs), infection of the bone and bone marrow. Direct infection of bone usually occurs through open fractures, penetrating wounds, or surgical operations.  in a patient with hypogammaglobulinemia. Clin Infect Dis. 1997;24:1161-3.

(16.) Lepidi H, Durack DT, Raoult D. Diagnostic methods current best practices and guidelines for histologic evaluation in infective endocarditis. Infect Dis Clin North Am. 2002;16:339-61.

(17.) Lepidi H, Fournier P, Raoult D. Quantitative analysis of valvular lesions during Bartonella endocarditis. A case control study. Am J Clin Pathol. 2000;114:880-9.

(18.) Fournier P, Mainardi J, Raoult D. Value of microimmunofluorescence for the diagnosis and follow-up of Bartonella endocarditis. Clin Diag Lab Immunol. 2002;9:795-801.

(19.) Houpikian P, Raoult D. Western Immunoblotting immunoblotting,
n the immunologic methods for isolating and quantitatively measuring immunoreactive substances. When used with immune reagents such as monoclonal antibodies, the process is known generically as
Western blot analysis.
 for Bartonella endocarditis. Clin Diag Lab Immunol. 2003;10:95-102.

(20.) Tissot-Dupont H, Thirion X, Raoult D. Q fever serology: cutoff determination for microimmunofluorescence. Clin Diag Lab Immunol. 1994;1:189-96.

(21.) Zeaiter Z, Fournier P, Greub G, Raoult D. Diagnosis of Bartonella endocarditis by a real-time nested-PCR assay using serum. J Clin Microbiol. 2003;41:919-25.

(22.) Fournier P, Raoult D. Comparison of PCR and serology for the diagnosis of acute Q lever. J Clin Microbiol. 2003;41:5094-8.

(23.) Giladi M, Szold O, Elami A, Bruckner D, Johnson BL Jr. Microbiological cultures of heart valves and valve tags are not valuable for patients without infective endocarditis who are undergoing valve replacement. Clin Infect Dis. 1997;24:884-8.

(24.) Chuard C, Antley CM, Reller LB. Clinical utility of cardiac valve Gram stain and culture in patients undergoing native valve replacement. Arch Pathol Lab Med. 1998;122:412-5.

(25.) Campbell WN, Tsai W, Mispireta LA. Evaluation of the practice of routine culturing of native valves during valve replacement surgery. Ann Thorac Surg. 2000;69:548-50.

(26.) Colson P, Lebrun L, Drancourt M, Boue F, Raoult D, Nordmann P. Multiple recurrent bacillary angiomatosis due to Bartonella quintana in an HIV-infected patient. Eur J Clin Microbiol Infect Dis. 1996;15:178-80.

(27.) Raoult D, Foumier P, Drancourt M, Marrie T, Etienne J, Cosserat P, et al. Diagnosis of 22 new cases of Bartonella endocarditis. Ann Intern Med. 1996;125:646-53.

(28.) Werner M, Fournier PE, Andersson R, Hogevik H, Raoult D. Bartonella and Coxiella antibodies in 334 prospectively studied episodes of infective endocarditis in Sweden. Scand J Infect Dis. 2003;35:724-7.

(29.) Lamas CC, Eykyn SJ. Blood culture negative endocarditis: analysis of 63 cases presenting over 25 years. Heart. 2003;89:258-62.

(30.) Klein JL, Nair SK, Harrison TG, Hunt I, Fry NK, Friedland JS. Prosthetic valve endocarditis prosthetic valve endocarditis,
n See endocarditis, infective.
 caused by Bartonella quintana. Emerg Infect Dis. 2002;8:202-3.

(31.) Posfay Barbe K, Jaeggi E, Ninet B, Liassine N, Donatiello C, Gervaix A, et al. Bartonella quintana endocarditis in a child. N Engl J Med. 2000;342:1841-2.

(32.) Niang M, Brouqui P, Raoult D. Epidemic typhus imported from Algeria. Emerg Infect Dis. 1999;5:716-8.

(33.) Birg ML, La Scola B, Roux Roux , Pierre Paul Émile 1853-1933.

French bacteriologist. His work with the diphtheria bacillus led to the development of antitoxins to neutralize pathogenic toxins.
 V, Brouqui P, Raoult D. Isolation of Rickettsia prowazekii from blood by shell vial cell culture. J Clin Microbiol. 1999;37:3722-4.

(34.) Mokrani K, Fournier PE, Dalichaouche M, Tebbal S, Aouati A, Raoult D. Epidemic typhus is a reemerging threat in Algeria. J Clin Microbiol. 2004:42:3898-900.

(35.) Rolain JM, Franc M, Davoust B, Raoult D. Molecular detection of Bartonella quintana, B. koehlerae, B. henselae, B. clarridgeiae, Rickettsia rickettsia (rĭkĕt`sēə), any of a group of very small microorganisms, many disease-causing, that live in vertebrates and are transmitted by bloodsucking parasitic arthropods such as fleas, lice (see louse), and ticks.  felis, and Wolbachia pipientis in cat fleas, France. Emerg Infect Dis. 2003;9:338-42.

(36.) Fournier P, Lelievre H, Eykyn S, Mainardi J. Marrie T, Bruneel F, et al. Epidemiologic and clinical characteristics of Bartonella quintana and Bartonella henselae endocarditis: a study of 48 patients. Medicine. 2001;80:245-51.

(37.) Memish ZA, Balkhy HH. Brucellosis and international travel. J Travel Med. 2004;11:49-55.

(38.) Maurin M, Raoult D. Q fever. Clin Microbiol Rev. 1999;12:518-53.

(39.) Fenollar F, Gauduchon V, Casalta JP, Lepidi H, Vandenesch F, Raoult D. Mycoplasma mycoplasma

Any of the bacteria that make up the genus Mycoplasma. They are among the smallest of bacterial organisms. The cell varies from a spherical or pear shape to that of a slender branched filament.
 endocarditis: two case reports and a review. Clin Infect Dis. 2004;38:e21-4.

Address for correspondence: Didier Raoult, CNRS CNRS Centre National de la Recherche Scientifique (National Center for Scientific Research, France)
CNRS Centro Nacional de Referencia Para El Sida (Argentinean National Reference Center for Aids) 
 UMR UMR Unite Mixte de Recherche (French: Mixed Unit of Research )
UMR University of Missouri - Rolla
UMR Upper Mississippi River
UMR Uniform Methods and Rules (US Department of Agriculture)
UMR Unit Manning Report
 6020, Unite des Rickettsies, IFR IFR
abbr.
instrument flight rules
, 48 Universite de la Mediterranee, Faculte de medecine, 27 Boulevard Jean Moulin, 13385 Marseille cedex 5, France; fax: 33-491-83-03 90; email: Didier.Raoult@medecine.univ-mrs.fr

Akila Benslimani, * (1) Florence Fenollar, ([dagger]) (1) Hubert Lepidi, ([dagger]) Didier Raoult ([dagger])

* Service de Biologie Clinique, Alger, Algerie; and ([dagger]) Universite de la Mediterranee, Marseille, France

(1) These 2 authors have contributed equally to the manuscript.
COPYRIGHT 2005 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2005, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research
Author:Raoult, Didier
Publication:Emerging Infectious Diseases
Geographic Code:6ALGE
Date:Feb 1, 2005
Words:5871
Previous Article:Lack of H5N1 avian influenza transmission to hospital employees, Hanoi, 2004.
Next Article:Novel flavivirus or new lineage of West Nile virus, Central Europe.
Topics:



Related Articles
Trans Liberation: Beyond Pink or Blue.
54th International Northwestern Conference on Diseases in Nature Communicable to Man.
Prosthetic valve endocarditis caused by pasteurella dagmatis.
Pulmonic valve endocarditis. (Case Report).
Endocarditis during pregnancy.
Comparative molecular and microbiologic diagnosis of bacterial endocarditis.
Emerging issues in infective endocarditis.
Infective endocarditis due to Providencia stuartii.
Bartonella clarridgeiae and B. henselae in dogs, Gabon.
Musculoskeletal manifestations as the initial presentation of infective endocarditis.

Terms of use | Copyright © 2012 Farlex, Inc. | Feedback | For webmasters | Submit articles