Printer Friendly
The Free Library
14,716,216 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Babesia sp. EU1 from roe deer and transmission within Ixodes ricinus.


We report in vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment.

in vi·tro
adj.
In an artificial environment outside a living organism.
 culture of zoonotic Zoonotic
A disease which can be spread from animals to humans.

Mentioned in: Zoonosis
 Babesia Babesia /Ba·be·sia/ (bah-be´ze-ah) a genus of protozoa found as parasites in red blood cells and transmitted by ticks; its numerous species include B. bige´mina, B. bo´vis, and B.  sp. EU1 from blood samples of roe deer in France. This study provides evidence of transovarial and transstadial transmission of the parasite within Ixodes ricinus, which suggests that this tick could be a vector and reservoir of EUI EUI European University Institute
EUI Escuela Universitaria de Informática (Spain)
EUI Extended Unique Identifier (networking devices)
EUI Energy Use Intensity (DoE, EIA) 
.

**********

Babesiosis babesiosis (bəbē'bēō`sĭs), tick-borne disease caused by a protozoan of the genus Babesia. Babesiosis most commonly affects domestic and wild animals and can be a serious problem in cattle.  is a zoonosis Zoonosis Definition

Zoonosis, also called zoonotic disease refers to diseases that can be passed from animals, whether wild or domesticated, to humans.
 caused by intraerythrocytic piroplasms of the genus Babesia, which are transmitted by ticks (1). In Europe, [approximately equal to] 30 human cases of babesiosis have been reported over the past 50 years and have been traditionally attributed to infection with the bovine parasite B. divergens transmitted by Ixodes ricinus (2,3). However, in 2003, Herwaldt et al. described the first molecular characterization of a new Babesia species, Babesia sp. EU1, isolated from 2 persons in Austria and Italy (4). Since this description, EU1 has been recovered from roe deer in Slovenia (5) and from I. ricinus in Slovenia (6) and Switzerland (7,8).

Babesia species EU1 merits increased attention as a potential agent of emerging tickborne disease in humans because its suspected vector, L ricinus, is the most prevalent and widely distributed tick in Europe and frequently bites humans. To evaluate the public health importance of EU1, its vector, animal reservoir hosts, and geographic distribution must be identified. We identified EU1 in roe deer and in I. ricinus in western France.

The Study

In January 2005 and January 2006, 89 roe deer at the Wild Fauna Reserve of Chize (Deux Sevres, France) were captured; blood was obtained through the jugular vein jugular vein
n.
Any of the three jugular veins: anterior, external, and internal.
 and analyzed for infection by Babesia spp. Parasites were isolated from autologous autologous /au·tol·o·gous/ (aw-tol´ah-gus) related to self; belonging to the same organism.

au·tol·o·gous
adj.
1.
 roe deer erythrocytes Erythrocytes
Red blood cells.

Mentioned in: Bartonellosis

erythrocytes (ē·rithˑ·rō·sīts),
n.pl red blood cells.
 as described (9), except that 20% fetal calf serum (FCS FCS - Frame Check Sequence ) was used. Cultures were monitored for parasitemia parasitemia /par·a·si·te·mia/ (par?ah-si-te´me-ah) the presence of parasites, especially malarial forms, in the blood.

par·a·si·te·mi·a
n.
The presence of parasites in the blood.
 by examination of Giemsa-stained thin blood smears. Parasites were then adapted to culture in blood from deer (Dama dama) from the Jardin des Plantes The Jardin des Plantes is the main botanical garden in France. It is situated in the 5ème arrondissement, Paris, on the left bank of the river Seine. It covers 28 hectares (280,000 m²).  of Nantes (Loire Atlantique, France) and from sheep reared in our laboratory. Adaptation was conducted as described (10), except that 20% FCS was also used.

A total of 150 [micro]L parasite genomic DNA was then prepared from 10-mL cultures (10% parasitemia, 2.5% hematocrit Hematocrit Definition

The hematocrit measures how much space in the blood is occupied by red blood cells. It is useful when evaluating a person for anemia.
Purpose

Blood is made up of red and white blood cells, and plasma.
) according to the protocol of a commercial extraction kit (Promega, Madison, WI, USA) on merozoite merozoite /mero·zo·ite/ (mer?o-zo´it) one of the organisms formed by multiple fission (schizogony) of a sporozoite within the body of the host.

mer·o·zo·ite
n.
 preparations obtained by Percoll gradient centrifugation Centrifugation

A mechanical method of separating immiscible liquids or solids from liquids by the application of centrifugal force. This force can be very great, and separations which proceed slowly by gravity can be speeded up enormously in centrifugal
 (Amersham, Uppsala, Sweden) with a density of 1.08 g/mL in 0.15 M NaC1. PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 amplifications were performed with 10 [micro]L DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 and BAB primers (Table 1) as described (11). For positive samples, 5 [micro]L DNA was subjected to a second amplification with EU1 primers (Table 1) as described by Hilpertshauser et al. (8), except that the annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  temperature was 63[degrees]C and uracil uracil (yr`əsĭl), organic base of the pyrimidine family. It was isolated from herring sperm and also produced in a laboratory in 1900–1901.  DNA glycosylase was not used.

During January 2005, 31 of 79 roe deer analyzed were infected with Babesia spp., as shown by parasite culture and PCR amplification with BAB primers. Of 29 cultures tested for EU1 with the corresponding primers, 59% were positive, which indicated an estimated global EU1 prevalence of 23% (Table 2). In January 2006, 5 of 10 cultures tested contained Babesia spp. parasites. Sequencing of the complete 18S rRNA gene from subcultures in autologous deer and sheep erythrocytes amplified with the primer set CRYPTO (Table 1) (4) showed that 2 of these cultures (C210 and C20I) had 100% identity with the EU1 human strain (GenBank accession no. AY046575) (4). The unique sequence obtained has been deposited in GenBank (accession no. EF185818).

In January 2005, a total of 106 engorged en·gorge  
v. en·gorged, en·gorg·ing, en·gorg·es

v.tr.
1. To devour greedily.

2. To gorge; glut.

3. To fill to excess, as with blood or other fluid.

v.intr.
 female adult I. ricinus were collected from the 31 roe deer harboring Babesia spp. Ticks were then reared in the laboratory at 22[degrees]C and a relative humidity of 80% 90%. Forty-two ticks (from 22 roe deer) laid eggs from which larvae Larvae, in Roman religion
Larvae: see lemures.
 were analyzed for parasites with BAB primers as described (11); 64% of larvae samples had a positive reaction. Amplification products from egg sample E177.3 and larva larva, in zoology
larva, independent, immature animal that undergoes a profound change, or metamorphosis, to assume the typical adult form. Larvae occur in almost all of the animal phyla; because most are tiny or microscopic, they are rarely seen.
 sample L177.3 that were sequenced showed 100% identity with the 18S rRNA gene of EU 1 (4). The sequence has been submitted to GenBank (accession no. EF185819). Among positive samples, 6 of 15 analyzed for EU 1 with specific primers showed a positive reaction (Table 2).

Conclusions

Isolation of EU1 from roe deer in France confirms that these animals are reservoir hosts of the parasite and that EU1 is not restricted to 1 geographic area in Europe. A survey conducted in Slovenia showed that 21.6% of 51 roe deer tested were infected with EU1 (5) and a similar prevalence (23%) was observed.

To our knowledge, this is the first isolation of EU 1 in culture in homologous erythrocytes and erythrocytes from other ruminants. Until now, Babesia sp. EU1 has only been detected in roe deer (5) and humans (4). It has also been detected in I. ricinus collected from sheep and goats in Switzerland (8); however, the ticks in that study may have acquired the infection at a preceding stage during a blood meal taken on another host.

In a study in Slovenia in 1997, 2.2% of 135 I. ricinus collected by flagging vegetation were positive by PCR for EU1 (6,12). PCR studies in Switzerland that examined ticks collected from domestic and wild ruminants with unknown parasitologic status showed that 1%-2% contained EU1 DNA (7,8). In our study, 40% of larvae samples from female ticks collected on Babesia-infected roe deer were infected with EU1. We assume that ticks do not necessarily become infected or transmit the parasite to the next generation after a blood meal on a EUl-infected host because 5 larval larval

1. pertaining to larvae.

2. larvate.


larval migrans
see cutaneous and visceral larva migrans.
 pools that originated from female ticks collected on EU 1-infected roe deer were not infected (Table 2).

DNA sequences of the 18S rRNA gene were identical in parasites isolated from roe deer (C201 and C210) or I. ricinus samples. This finding indicates that deer and ticks were infected with the same organism, which may be transmitted by the tick. In addition to I. ricinus, EU1 DNA has been isolated from Haemaphysalis punctata ticks in Switzerland (8). However, during this survey, entire ticks or the apical apical /ap·i·cal/ (ap´i-k'l) pertaining to an apex.

a·pi·cal
adj.
1. Relating to the apex of a pyramidal or pointed structure.

2.
 part of fully engorged females were tested. Positive results from such samples indicate infection status only, not proof of the vectorial capacity of the tick (11).

We report that EU1 is transmitted within I. ricinus and that transovarial transmission occurs in this tick, as shown by detection of parasite DNA in eggs and larvae from females collected on roe deer. Some EUl-positive eggs and larvae can originate from adults engorged on EUl-uninfected roe deer, as observed in 3 roe deer (L128.3, L177.3, and L179.1). This finding suggests that the parasite was acquired during a preceding blood meal and that transstadial transmission occurred, at least from nymph nymph, in Greek mythology
nymph (nĭmf), in Greek mythology, female divinity associated with various natural objects. It is uncertain whether they were immortal or merely long-lived. There was an infinite variety of nymphs.
 to adult. Further investigations are needed to clarify the ability of I. ricinus to acquire and transmit Babesia sp. EU1. This species, which has been isolated from 2 human cases of babesiosis, should be studied to determine other potential reservoir hosts because of its potential as an emerging zoonotic pathogen.

Acknowledgments

We thank Norman Pieniazek for permission to use primers BAB GF2 and BAB GR2, Guy van Laere and his group for technical assistance in collecting roe deer samples, Bernard Bouet and Emmanuel Risi for efficient help in collecting fallow deer blood, Nadine Brisseau for technical assistance, and Richard Paul and Albert Agoulon for their critical reading of the manuscript.

This study was supported by research funds from the Institut National de la Recherche Agronomique “INRA” redirects here. For other uses, see INRA (disambiguation).

The Institut National de la Recherche Agronomique (INRA) is a French public research institute dedicated to scientific studies surrounding the problems of agriculture.
 and the Ecole Nationale Veterinaire de Nantes.

References

(1.) Kjemtrup AM, Conrad PA. Human babesiosis: an emerging tick-borne disease, Int J Parasitol. 2000;30:1323 37.

(2.) Gorenflot A, Moubri K, Precigout E, Carcy B, Schetters TP. Human babesiosis. Ann Trop Med Parasitol. 1998;92:489-501.

(3.) Berry A, Morassin B, Kamar N, Magnaval JF. Clinical picture: human babesiosis. Lancet. 2001;357:341.

(4.) Herwaldt BL, Caccio S, Gherlinzoni F, Aspock H, Slemenda SB, Piccaluga P, et al. Molecular characterization of a non-Babesia divergens organism causing zoonotic babesiosis in Europe. Emerg Infect Dis. 2003;9:942-8.

(5.) Duh duh  
interj.
Used to express disdain for something deemed stupid or obvious, especially a self-evident remark.



[Imitative of an utterance attributed to slow-witted people.]
 D, Petrovec M, Bidovec A, Avsic-Zupanc T. Cervids as Babesiae hosts, Slovenia. Emerg Infect Dis. 2005; 11 : 1121-3.

(6.) Duh D, Petrovec M, Avsic-Zupanc T. Molecular characterization of human pathogen Babesia EU 1 in Ixodes ricinus ticks from Slovenia. J Parasitol. 2005;91:463 5.

(7.) Casati S, Sager H, Gem L, Piffaretti JC. Presence of potentially pathogenic Babesia sp. for human in Ixodes ricinus in Switzerland. Ann Agric Environ Med. 2006; 13:65-70.

(8.) Hilpertshauser H, Deplazes P, Schnyder M, Gern L, Mathis A. Babesia spp. identified by PCR in ticks collected from domestic and wild ruminants in southern Switzerland. Appl Environ Microbiol. 2006;72:6503-7.

(9.) Malandrin L, L'Hostis M, Chauvin A. Isolation of Babesia divergens from carrier cattle blood using in vitro culture. Vet Res. 2004;35:131-9.

(10.) Chauvin A, Valentin A, Malandrin L, L'Hostis M. Sheep as a new experimental host for Babesia divergens. Vet Res. 2002;33:429-33.

(11.) Bonnet S, Jouglin M, Malandrin L, Becker C, Agoulon A, L'Hostis M, et al. Transstadial and transovarial persistence of Babesia divergens DNA in Ixodes ricinus ticks fed on infected blood in a new skin-feeding technique. Parasitology Parasitology

The scientific study of parasites and of parasitism. Parasitism is a subdivision of symbiosis and is defined as an intimate association between an organism (parasite) and another, larger species of organism (host) upon which the parasite is
. 2007; 134:197-207.

(12.) Duh D, Petrovec M, Avsic-Zupanc T. Diversity of Babesia infecting European sheep ticks (Ixodes ricinus). J Clin Microbiol. 2001;39:3395-7.

Address for correspondence: Sarah Bonnet, UMR UMR Unite Mixte de Recherche (French: Mixed Unit of Research )
UMR University of Missouri - Rolla
UMR Upper Mississippi River
UMR Uniform Methods and Rules (US Department of Agriculture)
UMR Unit Manning Report
 1034 INRA INRA Institut National de la Recherché Agronomique (France; National Institute for Agronomic Research)
INRA Institute for Natural Resources in Africa
INRA Inland Northwest Research Alliance
, ENVN, Ecole Nationale Vdtdrinaire de Nantes, Atlanpole-La Chantrerie, BP 40706, 44307 Nantes CEDEX 03, France; email: bonnet@vet-nantes.fr

Dr Bonnet is a medical entomologist and a parasitologist parasitologist

a person skilled in parasitology.
 in the Department of Sante Animale, Institut National de la Recherche Agronomique, Nantes, France. Her research interests include analysis of pathogen transmission by ticks (including Babesia spp. and some bacteria species).

Sarah Bonnet,* Maggy Jouglin,* Monique L'Hostis, ([dagger]) and Alain Chauvin ([dagger])

* Institut National de la Recherche Agronomique, Nantes, France; ([dagger])Ecole Nationale Veterinaire de Nantes, Nantes, France
Table 1. Nucleotide sequences of PCR primers used for amplification
and sequencing of 18S rRNA genes of Babesia spp. *

Primer    Specificity        Sequence (5' [right           Annealing
                                  arrow] 3')             temperature,
                                                               oC
BAB        Babesial/                                          60
           Theileria
              spp.
GF2                          GYYTTGTAATTGGAATGATGG
GR2                          CCAAAGACTTTGATTTCTCTC
EU1         Babesia                                           63
            sp. EU1
Up                          GTTTCTGMCCCATCAGCTTGAC
Down                       AGACAAGAGTCAATAACTCGATAAC
CRYPTO    Apicomplexa                                         65
F                         AACCTGGTTGATCCTGCCAGTAGTCAT
R                         GAATGATCCTTCCGCAGGTTCACCTAC

Primer     Fragment                Reference
            size, bp

BAB           359                     -11

GF2
GR2
EU1           362                     -8

Up
Down
CRYPTO       1,727                    -4
F
R

* For parasites from tick samples, no sequence could be obtained with
primer set CRYPTO because such primers likely hybridize to the Nodes
ricinus 18S rRNA gene and preferentially amplified this gene,
probably because of its relative abundance.

Table 2. PCR detection of Babesia sp. EU1 in blood samples
from roe deer and in Ixodes ricinus larvae hatched from
engorged females collected from roe deer *

Roe deer               Primer BAB     Primer EU1
Identification         Cultures       Cultures       Larvae

C105                        +              +
C107                        +              +          L-107.1 (+)
                                                      L-107.2 (-)
C109                        +              +           L-109(+)
C110                        +              +          L-110.2 (-)
C112                        +              +          L-112.1 (-)
                                                      L-112.2 (-)
C115                        +              -
C117                        +              -
C123                        +              -
C128                        +              -          L-128.3(+)
C129                        +              +
C139                        +              +
C151                        +              +           L-151 (+)
C156                        +              +
C162                        +              +
C163                        +              +
C164                        +              -           L-164(-)
C167                        +              +
C171                        +              +          L-171.1 (-)
C172                        +              -
C176                        +              -          L-176.7(-)
C177                        +              -          L-177.1 (-)
                                                      L-177.2 (-)
                                                      L-177.3 (+)
C179                        +              -          L-179.1 (+)
C180                        +              +
C185                        +              -
C188                        +              -
C193                        +
C169                        +              +
C189                        +              +
C157                        +              +
Total positive (%)          29           17.00         6/15(40)

* +, positive amplification of a product of the expected size; -,
no amplification.
COPYRIGHT 2007 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2007, Gale Group. All rights reserved.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:DISPATCHES
Author:Bonnet, Sarah; Jouglin, Maggy; L'Hostis, Monique; Chauvin, Alain
Publication:Emerging Infectious Diseases
Geographic Code:4EUFR
Date:Aug 1, 2007
Words:1873
Previous Article:The Calf-Path.(ANOTHER DIMENSION)(Poem)
Next Article:Pathogenic hantaviruses, northeastern Argentina and eastern Paraguay.(DISPATCHES)
Topics:



Related Articles
Competence of American robins as reservoir hosts for Lyme disease spirochetes.
American Robins as Reservoir Hosts for Lyme Disease Spirochetes.(Brief Article)
Co-feeding transmission and its contribution to the perpetuation of the Lyme disease spirochete Borrelia afzelii. (Letters).
Cervids as Babesiae hosts, Slovenia.(DISPATCHES)
Human Babesia microti incidence and Ixodes scapularis distribution, Rhode Island, 1998-2004.(DISPATCHES)
Zoonotic pathogens in Ixodes scapularis, Michigan.(LETTERS)(Letter to the editor)
VALLEY MAN INFECTED WITH WEST NILE.(News)
Migrating birds and tickborne encephalitis virus.(DISPATCHES)
Dyella japonica bacteremia in hemodialysis patient.(LETTERS)(Letter to the editor)
Bush Freezes Assets Of Persons Undermining Beirut Govt.

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles