Association of genetic polymorphisms in CYP2E1, MPO, NQO1, GSTM1, and GSTT1 genes with benzene poisoning.Metabolic enzymes involved in benzene activation or detoxification Detoxification Definition Detoxification is one of the more widely used treatments and concepts in alternative medicine. It is based on the principle that illnesses can be caused by the accumulation of toxic substances (toxins) in the body. , including NAD NAD: see coenzyme. (P)H, quinone quinone Any member of a class of cyclic organic compounds comprising a six-membered unsaturated ring (see saturation) to which two oxygen atoms are bonded as carbonyl groups (−C=O; see functional group). oxidoreductase oxidoreductase /ox·i·do·re·duc·tase/ (ok?si-do-re-duk´tas) any of a class of enzymes that catalyze the reversible transfer of electrons from a substrate that becomes oxidized to one that becomes reduced (oxidation-reduction, or redox 1 (NQO1), cytochrome cytochrome (sī`təkrōm'), protein containing heme (see coenzyme) that participates in the phase of biochemical respiration called oxidative phosphorylation. P450 2E1 (CY2E1), myeloperoxidase (MPO MPO myeloperoxidase. MPO Myeloperoxidase, see there ), glutathione-S-transferase mu-1 (GSTM GSTM Gatespace Telematics (supplier of systems and components for telematics) GSTM General System Test Module 1), and glutathione-S-transferase theta-1 (GSTT GSTT Generation Skipping Transfer Tax GSTT Geological Society of Trinidad & Tobago 1), were studied for their roles in human susceptibility to benzene poisoning. The potential interactions of these metabolic enzymes with lifestyle factors such as cigarette smoking and alcohol consumption were also explored. We studied 156 benzene-poisoning patients and 152 workers occupationally exposed to benzene in South China. Sequencing, denaturing HPLC HPLC high-performance liquid chromatography. HPLC high performance liquid chromatography. HPLC High-performance liquid chromatography Lab instrumentation A highly sensitive analytic method in which analytes are placed , restriction fragment-length polymotphism, and polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is were used to detect polymorphisms on the promoters and complete coding regions of NQO1, CYP CYP In currencies, this is the abbreviation for the Cyprus Pound. Notes: The currency market, also known as the Foreign Exchange market, is the largest financial market in the world, with a daily average volume of over US $1 trillion. 2E1, MPO, and the null genotypes of GSTM1 and GSTT1. Seventeen single nucleotide polymorphisms Noun 1. single nucleotide polymorphism - (genetics) genetic variation in a DNA sequence that occurs when a single nucleotide in a genome is altered; SNPs are usually considered to be point mutations that have been evolutionarily successful enough to recur in a (SNPs) were identified in NQO1, CYP2E1, and MPO genes, including 6 novel SNPs in CFP 1. CFP - Constraint Functional Programming. 2. CFP - Communicating Functional Processes. 3. CFP - Call For Papers (for a conference). 2E1 and MPO. Of the subjects who smoked and drank alcohol, an 8.15-fold [95% confidence interval confidence interval, n a statistical device used to determine the range within which an acceptable datum would fall. Confidence intervals are usually expressed in percentages, typically 95% or 99%. (CI), 1.45-46.50] and a 21.50-fold (95% CI, 2.79-165,79) increased risk of benzene poisoning, respectively, were observed among the subjects with two copies of NQO1 with a C-to-T substitution in cDNA at nucleotide 609 (c.609 C>T variation; i.e., NQO1 c.609 T/T T/T Telegraphic Transfer )compared to those with the heterozygous het·er·o·zy·gous adj. 1. Having different alleles at one or more corresponding chromosomal loci. 2. Of or relating to a heterozygote. or wild (NQO1 c.609 C/T C/T Common To C/T Chief Technician (non-commissioned rank in HM Royal Air Force) C/T Command Transmitter C/T Carrier-to-Noise Temperature density ratio and c.609 C/C C/C Center to Center C/C Combustion Chamber C/C Command/Control C/C Crew Chief C/C cabin cruiser (US DoD) C/C chief complaint (medical) C/C Channel-to-Channel C/C Communication and Collaboration ) genotypes. Our data also indicated that individuals with CYP2E1 c.-1293 C/C and c.-1293 G/C G/C Gas-to-Cloth Ratio , and NQO1 c.609 T/T, and GSTT1 null genotypes tended to be more susceptible to benzene toxicity. Our results suggest that the combined affect of polymorphisms in NQO1, CYP2E1, and GSTT1 genes and lifestyle factors might contribute to benzene poisoning. Key words: benzene poisoning) polymorphisms, lifestyle, NQO1, CYP2E1, MPO, GSTM1, GSTT1. Environ Health Perspect 110:1213-1218 (2002). [Online 15 October 2002] http://ehpnet1.niehs.nih.gov/docs/2002/110p1213-1218wan/abstract.html ********** Benzene is commonly used to synthesize To create a whole or complete unit from parts or components. See synthesis. organic chemicals and is an important component of many organic solvents. Workers exposed to benzene may potentially suffer chronic benzene poisoning (BP). Clinical reports have shown that exposure to benzene can result in a variety of blood and bone marrow disorders, including leukopenia leukopenia /leu·ko·pe·nia/ (-pe´ne-ah) reduction of the number of leukocytes in the blood below about 5000 per cubic mm.leukope´nic basophilic leukopenia basophilopenia. , anemia, myelodysplastic syndrome Myelodysplastic Syndrome Definition Myelodysplastic syndrome (MDS) is a disease that is associated with decreased production of blood cells. Blood cells are produced in the bone marrow, and the blood cells of people with MDS do not mature normally. , aplastic anemia aplastic anemia or anemia of bone-marrow failure Inadequate blood-cell formation by bone marrow. Pancytopenia is the lack of all blood-cell types (erythrocytes, leukocytes, and platelets), but any combination may be missing. , acute myeloid leukemia myeloid leukemia n. See myelogenous leukemia. , and acute lymphocytic leukemia acute lymphocytic leukemia n. See acute lymphoblastic leukemia. acute lymphocytic leukemia Acute lymphoblastic leukemia, ALL A malignant lymphoproliferative process that commonly affects children and young adults (Aksoy et al. 1972; Linet et al. 1996; Yin et al. 1987). Previous studies have indicated that benzene toxicity mainly results from its intermediate reactive metabolites Metabolites Substances produced by metabolism or by a metabolic process. Mentioned in: Interactions (Irons and Stillman 1996; Kolachana et al. 1993). Benzene is initially oxidized oxidized having been modified by the process of oxidation. oxidized cellulose see absorbable cellulose. to benzene oxide by hepatic CYP2E1 in the liver (Keep et al. 1989; Valentine et al. 1996). Benzene oxide forms phenol phenol (fē`nōl), C6H5OH, a colorless, crystalline solid that melts at about 41°C;, boils at 182°C;, and is soluble in ethanol and ether and somewhat soluble in water. spontaneously or conjugates with glutathione glutathione: see coenzyme. to form less toxic or nontoxic derivates via glutathione-S-transferases (GSTs). Phenol is catalyzed by CYP2E1 to potentially toxic di- or trihydroxybenzenes such as hydroquinone hydroquinone /hy·dro·quin·one/ (hi?dro-kwi-non´) the reduced form of quinone, used topically as a skin depigmenting agent. hy·dro·qui·none n. , catechol catechol /cat·e·chol/ (kat´ah-kol) 1. catechin. 2. pyrocatechol. cat·e·chol n. See pyrocatechol. , and 1,2,4-benzentriol (Eastmond et al. 1987; Smith et al. 1989; Subrahmanyam et al. 1991). The di- or trihydroxy metabolites are further oxidized in the bone marrow by myeloperoxidase (MPO) to benzoquinones (Schattenberg et al. 1994), a potent hematotoxic and genetic agent, which can be detoxified by NAD(P)H:quinone oxidoreductase 1 (NQO1) to less harmful hydroxybenzenes (Joseph et al. 2000; Ross et al. 1996). Thus we hypothesized that the deficient or altered activity of enzymes involved in benzene metabolism such as CYP2E1, MPO, NQO1, and GSTs would significantly affect susceptibility to benzene toxicity. Genetic polymorphisms in genes encoding CYP2E1, MPO, NQO1, and GSTs (Hirvonen et al. 1993; Piedrafita et al. 1996; Puga et al. 1997; Traver et al. 1997) might be responsible for human susceptibility to BP because they might have an effect on enzyme activity Enzyme activity A measure of the ability of an enzyme to catalyze a specific reaction. Mentioned in: Glucose-6-Phosphate Dehydrogenase Deficiency . NQO1 with a C-to-T substitution in cDNA at nucleotide 609 (NQO1 c.609C>T variation) causes reduced or lost enzyme activity (Traver et al. 1992). A case-control study case-control study, n an investigation employing an epidemiologic approach in which previously existing incidents of a medical condition are used in lieu of gathering new information from a randomized population. revealed that workers exposed to benzene with both the higher CYP2E1 enzyme activity and the NQO1 c.609 T/T genotype genotype (jēn`ətīp'): see genetics. genotype Genetic makeup of an organism. The genotype determines the hereditary potentials and limitations of an individual. had a 7.6-fold increased risk of BP (Rothman et al. 1997). A single nucleotide polymorphism (SNP SNP Scottish National Party Noun 1. SNP - (genetics) genetic variation in a DNA sequence that occurs when a single nucleotide in a genome is altered; SNPs are usually considered to be point mutations that have been evolutionarily ) in an Alu repeat in the MPO gene promoter, c.-463G>A, could decrease the expression of MPO by destroying an SP1 transcriptional factor binding site (Piedrafita et al. 1996). It has been reported that the GSTT1 null genotype increased susceptibility to myelodysplastic syndrome [odds ratio (OR) = 4.3] (Chen et al. 1996), although confirmation of this finding is needed. Most chronic and complex diseases are caused by interactions among environment, genes, and lifestyle (Mucci et al. 2001). We conducted a case-control study to explore the effects of polymorphisms in genes involved in benzene metabolism on human susceptibility to BP and to explore the potential effect of lifestyle modification on BP. Our results indicated that NQO1 c.609C>T variation and lifestyle contributed to the risks of BP, and the combined effect of NQO1 c.609 T/T, CYP2E1 c.-1293 C/C and c.-1293 G/C, and the GSTT1 null genotype significantly increased the risk of BP. Materials and Methods Subjects. The workers with BP who enrolled in this study came from Shanghai, Hangzhou, Maanshan, and Guangzhou, China, where clusters of cases were reported. Benzene poisoning was diagnosed from 1980 to 1998 by the local authorized Occupational Disease Diagnostic Team, and patients were registered in the hospitals of prevention and treatment for occupational diseases, which cooperated with us. The diagnostic criteria for occupational BP, according to according to prep. 1. As stated or indicated by; on the authority of: according to historians. 2. In keeping with: according to instructions. 3. the Ministry of Health, China, include a) total white blood cell count white blood cell count, n a diagnostic clinical laboratory test to determine the number and types of leukocytes present in a measured sample of blood. Overall the normal number of leukocytes ranges from 5000 to 10,000/mm3. < 4,000/[micro]L or white blood cell count between 4,000 and 4,500/[micro]L and platelet count Platelet Count Definition A platelet count is a diagnostic test that determines the number of platelets in the patient's blood. Platelets, which are also called thrombocytes, are small disk-shaped blood cells produced in the bone marrow and involved in < 80,000/[micro]L, with repeated confirmation of this count in a few months in a peripheral blood peripheral blood Cardiology Blood circulating in the system/body examination; b) the individual with documented benzene exposure has been employed for at least 6 months in the factory; and c) exclusion of other causes of abnormal blood counts such as chloromycetin use and ionizing radiation i·on·i·zing radiation n. High-energy radiation capable of producing ionization in substances through which it passes. Ionizing radiation . The medical records of patients were independently reviewed, especially those with white blood cell counts > 3,500 to confirm the BP diagnosis. Of the 171 eligible patients, 156 (91%) agreed to participate in this study. About 72% of BP patients (112 patients) were from Shanghai Second Fabric Machine Factory (19 patients), Hangzhou Tool Machine Factory (13), Maanshan Iron & Steel Group (68), and Guangzhou Piano-Making Factory (12). Another 44 patients, who returned to the hospital periodically for health examinations, were from 12 other factories that had been dosed down. BP cases from the factories registered in the hospitals were also clustered (more than five reports). We chose 152 workers in the four major factories, who had been occupationally exposed to benzene, as controls. Control subjects were frequency-matched to cases by age within 5 years, exposure duration within 3 years, exposure level, and sex. All the eligible controls agreed to participate in this study. The subjects were interviewed by trained personnel, and a questionnaire was used to obtain general information including ethnic background, nutrition, cigarette smoking, alcohol consumption, protective measures, self-reported symptoms, medical history, and occupational history such as work unit (department), type of work, and exposure duration. Exposure estimation was based on monitoring data or industrial hygienists and long-term employees' evaluation considering historical changes (Dosemeci et al. 1996). The intensity of benzene exposure (milligrams per cubic meter Noun 1. cubic meter - a metric unit of volume or capacity equal to 1000 liters cubic metre, kiloliter, kilolitre metric capacity unit - a capacity unit defined in metric terms ) for the patients was taken as the benzene level of workplaces while diagnoses were made; the intensity of benzene exposure in controls was taken as the current level monitored by organic vapor passive dosimetry dosimetry /do·sim·e·try/ (do-sim´e-tre) scientific determination of amount, rate, and distribution of radiation emitted from a source of ionizing radiation, in biological d. badges during collection of the blood samples from controls. Those who smoked at least one cigarette per day for more than 1 year were considered regular smokers. Alcohol consumption was defined as drinking at least 7 standard units Standard units may refer to:
alanine aminotransferase n. Abbr. ALT See SGPT. level in serum was examined to indicate liver function. Collection of blood samples. Blood samples of the subjects enrolled in this study were collected only after informed consent was obtained. Blood was immediately frozen at -80[degrees] after collection and was sent to the laboratory later in dry ice. Amplification of DNA DNA: see nucleic acid. DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. samples. We extracted genomic DNA genomic DNA n. The full complement of DNA contained in the genome of a cell or organism. from blood samples by a routine phenol-chloroform method. We performed polymerase chain reaction (PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) ) using 50 ng of genomic DNA, 0.2 [micro]M of each primer, 100 [micro]M dNTPs, 20 mM Tris-Cl (pH 8.8), 10 mM KCl, 1.0-1.5 mM Mg[Cl.sub.2], and 2.5 U Pfu polymerase (Stratagene, La Jolla La Jolla (lə hoi`yə), on the Pacific Ocean, S Calif., an uninc. district within the confines of San Diego; founded 1869. The beautiful ocean beaches, in particular La Jolla shores and Black's Beach, and sea-washed caves attract visitors and , CA, USA) in a 25-[micro]L reaction volume. DNA samples were amplified for 35 cycles at 94[degrees]C for 45 sec, 63[degrees]C for 1 min, and 72[degrees]C for 2 min. The primer sequences are listed in Table 1. Detection of genetic polymorphisms. DNA sequencing DNA sequencing The determination of the sequence of nucleotides in a sample of DNA. was performed on an Automated DNA Sequencer A DNA sequencer is an instrument used to automate the DNA sequencing process. DNA sequencers have become more important due to large genomics projects and the need to increase productivity. ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother. (Application Binary Interface) A specification for a specific hardware platform combined with the operating system. 377 (PE Applied Biosystems Applied Biosystems, Inc. (formerly NASDAQ: ABIO) is the original name of a pioneer biotechnology company founded in 1981 in Foster City, California, among the Silicon Valley cities of the southern San Francisco Bay Area. , Foster City, CA, USA) according to the manufacturer's instructions. We used the PolyPhred computer program (PolyPhred, available online) to indicate possible SNP loci loci [L.] plural of locus. loci Plural of locus, see there . Verification of each candidate SNP was carried out by visual inspection. Denaturing HPLC (DHPLC DHPLC denaturing high-performance liquid chromatography ; Kuklin et al. 1997/1998) was carried out on an automated HPLC equipped with a DNA separation column (Transgenomic, San Jose San Jose, city, United States San Jose (sănəzā`, săn hōzā`), city (1990 pop. 782,248), seat of Santa Clara co., W central Calif.; founded 1777, inc. 1850. , CA, USA). For NQO1 exon Exon In split genes, a portion that is included in the ribonucleic acid (RNA) transcript of a gene and survives processing of the RNA in the cell nucleus to become part of a spliced messenger RNA (mRNA) or structural RNA in the cell cytoplasm. 4 and exon6, MPO promoter and exon 8, and CYP2E1 exon 6, the temperature of the DHPLC column was 63[degrees]C, 60[degrees]C, 60[degrees]C, 63[degrees]C, and 58[degrees]C; the acetonitrile acetonitrile /ac·e·to·ni·trile/ (as?e-to-ni´tril) a colorless liquid with an etherlike odor used as an extractant, solvent, and intermediate; ingestion or inhalation yields cyanide as a metabolic product. gradient was 53-61%, 54-62%, 63-69%, 58-68%, and 52-58%, respectively. CYP2E1 c.-1293 G>C was analyzed by PCR-restriction length polymorphism polymorphism, of minerals, property of crystallizing in two or more distinct forms. Calcium carbonate is dimorphous (two forms), crystallizing as calcite or aragonite. Titanium dioxide is trimorphous; its three forms are brookite, anatase (or octahedrite), and rutile. (RFLP RFLP abbr. restriction fragment length polymorphism RFLP restriction fragment length polymorphism. RFLP ). PCR products were digested by PstI (MBI MBI Management Buy-In MBI Moody Bible Institute MBI Mathematical Biosciences Institute MBI Modular Building Institute MBI Mechanical Breakdown Insurance MBI Molecular Biology Institute MBI Maslach Burnout Inventory (psychometrics) , Hanover, MD, USA) at 37[degrees]C for 2 hr. Different length fragments were separated by polyacrylamide gel electrophoresis polyacrylamide gel electrophoresis n. A technique for determining the molecular weight of proteins, in which proteins that have been coated in an anionic detergent undergo electrophoresis in a polyacrylamide gel. . The null genotype of GSTM1 and GSTT1 (Arand et al. 1996) and 96-bp insertion in the promoter of CYP2E1 (Fritsche et al. 2000) were detected by amplifying the target DNA regions and electrophoresis visualization on agarose agarose more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments. gel. We used albumin as the internal control. Statistical analyses. Our analysis was designed to examine the relationships of genotypes of NQO1, CYP2E1, MPO, GSTM1, and GSTT1 with the risks of BP controlling potential confounding confounding when the effects of two, or more, processes on results cannot be separated, the results are said to be confounded, a cause of bias in disease studies. confounding factor factors and evaluate whether lifestyle factors such as cigarette smoking and alcohol consumption modified the relationships of genotypes with risks of BP. SPSS A statistical package from SPSS, Inc., Chicago (www.spss.com) that runs on PCs, most mainframes and minis and is used extensively in marketing research. It provides over 50 statistical processes, including regression analysis, correlation and analysis of variance. 8.0 software (SPSS Inc., Chicago, IL, USA) was used to set up a database and analyze data. We used chi-square tests to examine the association between genetic polymorphisms and individual susceptibility to benzene hematotoxicity. If the value for a cell was < 5 in the chi-square test, we applied Fisher's exact test Fisher's exact test a statistical test for association in a two-by-two table based on the exact hypergeometric distribution of the frequencies within the table. . To evaluate whether the lifestyle modified the relationship between genetic polymorphisms and susceptibility to BP, we examined the associations by applying chi-square tests after stratification according to cigarette smoking or alcohol consumption. The test for homogeneity of ORs was examined by the Breslow-Day method. The heterogeneity of ORs indicated there could be interaction (p < 0.05). To control potential confounding factors such as sex, intensity of benzene exposure, and exposure duration, we applied unconditional logistic regression In statistics, logistic regression is a regression model for binomially distributed response/dependent variables. It is useful for modeling the probability of an event occurring as a function of other factors. to examine the relations of genetic polymorphisms with BP. Two-tailed p-values < 0.05 were considered statistically significant. ORs and 95% confidence intervals (95% CIs) were calculated to estimate the individual risk of BP. ORs adjusted for the potential confounding factors are also reported. We also used multiple-variables unconditional logistic regression analysis to analyze the data. We applied stepwise stepwise incremental; additional information is added at each step. stepwise multiple regression used when a large number of possible explanatory variables are available and there is difficulty interpreting the partial regression forward logistic regression selection to screen the covariates including sex, exposure duration, genetic polymorphisms, and interactions among them (criterion for acceptance: p [less than or equal to] 0.05; criterion for removal: p [greater than or equal to] 0.10). The screened covariates and intensity of benzene exposure were used to set up a saturated model In mathematical logic, and in particular model theory, a saturated model M is one which realizes as many complete types as may be "reasonably expected" given its size. . Results Demographics of cases and controls. The distribution of age, sex, exposure duration, intensity of benzene exposure, type of work, self-reported symptoms, cigarette smoking, and alcohol consumption in the cases and controls is shown in Table 2. The median age and exposure duration in 156 BP cases was 36.00 (range: 21.00-61.00) and 11.00 (range: 1.00-38.00); 38.50 (range: 19.00-57.00) and 9.00 (range: 1.00-36.00), respectively, in 152 controls. There was no significant difference in the distribution of age ([less than or equal to] 25, 26-35, 36-45, > 45 years), exposure duration ([less than or equal to] 5, 6-10, 11-15, 16-20, > 25 years), intensity of benzene exposure ([less than or equal to] 40 mg/[m.sup.3], 41-100 mg/[m.sup.3], > 100 mg/[m.sup.3]), and sex (p > 0.05). The percentage of female subjects was much higher than that of males (60.26% vs. 39.74% in BP cases and 62.50% vs. 37.50% in controls). The higher female ratio may also explain the relatively low frequency of cigarette smoking (17.67%) and alcohol consumption (11.59%) in the subjects. Exposure duration was highly correlated with age (Spearman spear·man n. A man, especially a soldier, armed with a spear. rank correlation In statistics, rank correlation is the study of relationships between different rankings on the same set of items. It deals with measuring correspondence between two rankings, and assessing the significance of this correspondence. , p < 0.05). Genetic polymorphisms of NQO1, CYP2E1, MPO, GSTM1, and GSTT1. We initially screened 24 cases and 24 controls randomly for possible genetic variations in NQO1, CYP2E1, and MPO genes by direct sequencing. More than 99% of SNPs with frequencies [greater than or equal to] 5% will be observed among the normal population [1 - [(1 - 5%).sup.48 individuals x 2 chromosomes] = 99.27%]. We identified 17 SNPs by sequencing in the screened regions of NQO1, CYP2E1, and MPO and 6 SNPs were genotyped by DHPLC in all subjects. Two SNPs in MPO promoter, MPO c.-581T>C and MPO c.-463G>A were completely linked; thus only the MPO c.-463G>A was analyzed. The SNPs on the CYP2E1 promoter region were too complicated (10 SNPs in 1,000 bp) to be detected by DHPLC (Table 3). We only determined 1 of 10 SNPs, CYP2E1 c.-1293G>C, because the G-to-C transition forms a PstI site. Table 3 shows the allele allele (əlēl`): see genetics. allele Any one of two or more alternative forms of a gene that may occur alternatively at a given site on a chromosome. and genotype frequencies of polymorphisms on NQO1, CYP2E1, MPO, GSTM1, and GSTT1 genes. Genotype frequencies of these genetic polymorphisms calculated from the control group were in Hardy-Weinberg equilibrium, making selection bias less likely (chi-square test, p > 0.05). Effect of genetic polymorphisms of NQO1, MPO, CYP2E1, GSTM1, and GSTT1 on the risks of BP. The distribution of eight independent polymorphisms of the studied genes was compared in cases and controls (Table 4). Due to their small number, some genotypes were grouped with other genotypes according to previous reported research on the function on these genes. No association of genetic polymorphisms and susceptibility to risks of BP was found between BP cases and benzene-exposed workers (p > 0.05). Although the frequency of the cases with two copies of NQO1 c.609C>T variation (NQO1 c.609 T/T genotype) was slightly higher than that of controls (25.71% vs 19.58%), there was no statistical difference between them. There was little variation in OR values when adjusted for sex, exposure duration, and intensity of benzene exposure. Relations of genetic polymorphisms of NQO1, MPO, CYP2E1, GSTM1, and GSTT1 with the risks of BP modified by lifestyle. The test for homogeneity (H) of ORs indicated a possible interaction between NQO1 c.609 C>T and cigarette smoking/alcohol consumption ([[chi].sub.H.sup.2] = 5.969, p = 0.015; [[chi].sub.H.sup.2] = 6.492, p = 0.011, respectively; [chi square chi square (kī), n a nonparametric statistic used with discrete data in the form of frequency count (nominal data) or percentages or proportions that can be reduced to frequencies. ] and p-values adjusted by sex, exposure duration, and intensity of benzene exposure). The subjects were stratified stratified /strat·i·fied/ (strat´i-fid) formed or arranged in layers. strat·i·fied adj. Arranged in the form of layers or strata. according to cigarette smoking. The frequency of regular smokers with NQO1 c.609 T/T genotypes in BP cases and benzene-exposed controls was 44.44% and 9.68%, respectively (Fisher's exact test, p = 0.01; Table 5). Our data showed a 7.73-fold increased risk of BP for smokers carrying NQO1 c.609 T/T compared with the those with the heterozygous or wild type gene (NQO1 c.609 C/T or C/C; OR = 7.73; 95% CI, 1.71-34.97; Table 5). Adjustment for sex, exposure duration, intensity of benzene exposure, and alcohol consumption had a minimal impact on the results (NQO1 c.609C>T; OR = 8.15; 95% CI, 1.43-46.50; Table 5). Compared with the individuals with the CYP2E1 c.-1293G>C wild genotype (CYP2E1 c.-1293 G/G G/G Gotta Go G/G Ground/Ground (air traffic management) G/G Ground-to-Ground ), the smokers carrying CYP2E1 c.-1293 G/C or C/C genotypes had a 3.30-fold increased risk of BP (OR = 3.30; 95% CI, 1.02-10.65; Table 5), but no significant difference was observed after adjustment for sex, exposure duration, and alcohol consumption (p = 0.07). Due to the small number of smokers in this study (19 cases and 34 controls), the association of the combined effect of CYP2E1 c.-1293G>C variation and cigarette smoking with BP should be explored in a larger sample size. Among the alcohol drinkers, the frequency of BP cases with NQO1 c.609 T/T was 61.11%, which was about five times as much as that of controls (Table 6). Compared with those of NQO1 c.609 C/T and C/C genotypes, the subjects with NQO1 c.609 T/T had an 11.00-fold increase for BP (OR = 11.00; 95% CI, 1.89-63.86; Fisher's exact test, p = 0.005), and this risk increased even higher, to 21.50-fold, after adjustment for sex, exposure duration, intensity of benzene exposure, and cigarette smoking (OR = 21.50; 95% CI, 2.79-165.79). The frequency of the BP cases with GSTM1 null genotype among the alcohol drinkers was higher than that of the controls (66.67% vs. 33.33%), but no significant difference between them was observed in this study. There was, however, a 4.21-fold increased risk of BP for the alcohol drinkers with GSTM1 null genotype compared with those with GSTMI non-null genotype (Table 6). Multiple-variables unconditional logistic regression analysis. The covariates and cross-product terms examined in the logistic regression model included intensity of exposure, alcohol, NQO1 c.609C>T, CYP2E1 c.-1293G>C, and GSTT1 genotypes (Table 7). The model suggested there was a joint action between alcohol consumption and NQO1 c.609 C>T variation (p = 0.007) and among NQO1 c.609 C>T, CYP2E1 c.-1293G>C, and GSTT1 null genotypes (p = 0.019). We examined the combined effects by stratification according to NQO1, CYP2E1, and GSTT1 genotypes. The result showed individuals with NQO1 c.609 T/T, CYP2E1 c.-1293 C/C or C/G, and GSTT1 null genotypes were more susceptible to BP with a 5.64-fold increased risk compared with individuals carrying NQO1 c.609 C/T or C/C, CYP2E1 c.-1293 G/G, and GSTT1 non-null genotypes. Discussion By examining the polymorphisms of the promoter and coding regions of NQO1, CYP2E1, and MPO and the null genotype of GSTM1 and GSTT1 genes, we studied the relationship between genetic polymorphism and the human susceptibility to risks of BP. The interaction of genetic diversities of these genes with lifestyle on BP was also explored. Though no association was suggested between genetic polymorphisms of these genes and risks of BP from our study, Rothman et al. (1997) reported a 2.6-fold increased risk of BP in the workers with NQO1 c.609 T/T genotype. There was, however, an 8.15-fold or 21.50-fold increased risk of BP in the individuals with NQO1 c.609 T/T genotype compared with NQO1 C/C or C/T genotypes after stratification by cigarette smoking and alcohol consumption, respectively (Tables 5 and 6). Cigarette smoking and alcohol consumption were considered risk factors contributing to many diseases such as lung cancer lung cancer, cancer that originates in the tissues of the lungs. Lung cancer is the leading cause of cancer death in the United States in both men and women. Like other cancers, lung cancer occurs after repeated insults to the genetic material of the cell. and bladder cancer bladder cancer Malignant tumour of the bladder. The most significant risk factor associated with bladder cancer is smoking. Exposure to chemicals called arylamines, which are used in the leather, rubber, printing, and textiles industries, is another risk factor. . Moreover, because benzene is a component of cigarette smoke, the cumulative exposures of regular smokers should be higher than those of nonsmokers who never smoked while exposed to benzene. Our results suggested that there might be an association between NQO1 c.609 T/T genotype and the risks of BP with modification by cigarette smoking and alcohol consumption. The C-to-T point variation of this SNP, which causes a proline proline (prō`lēn), organic compound, one of the 20 amino acids commonly found in animal proteins. Only the l-stereoisomer appears in mammalian protein. to serine serine (sĕr`ēn), organic compound, one of the 20 amino acids commonly found in animal proteins. Only the l-stereoisomer appears in mammalian protein. change, is associated with a loss activity of NQO1 (Traver et al. 1992). Moran et al. (1999) demonstrated that benzene metabolite metabolite, organic compound that is a starting material in, an intermediate in, or an end product of metabolism. Starting materials are substances, usually small and of simple structure, absorbed by the organism as food. hydroquinone induced high levels of NQO 1 activity in bone marrow CD[34.sup.+] cells with the wild genotype (NQO1 c.609 C/C), and noncytotoxic doses of hydroquinone induced intermediate levels of NQO1 activity in heterozygous (NQO1 c.609 C/T) cells but exerted no effect on cells with the NQO1 c.609 TIT tit Any of several woodland and garden songbird species in the genus Parus (family Paridae) having a rather stout, pointed bill. The great tit (P. major), found in Europe, North Africa, and Asia nearly to Java, is about 6 in. (14 cm) long. genotype. It is possible that failure to induce functional NQO1 enzyme activity in NQO1 c.609 T/T individuals might be responsible for BP. In addition to the interaction between genetic polymorphisms and lifestyle, different genetic polymorphisms could contribute to the risk of BP. We speculated that individuals with high-level activity of metabolic enzymes involved in oxidizing benzene to more toxic metabolites such as CYP2E1 and low-level activity of metabolic enzymes participated in detoxification pathway as GSTT1 and GSTM1 were less resistant to benzene toxicity. There was no detectable enzyme activity in the individuals with GSTT1 null genotypes. Using an in vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment. in vi·tro adj. In an artificial environment outside a living organism. transfection trans·fec·tion n. Infection of a bacterium or cell with DNA or RNA isolated from a bacteriophage or from an animal or a plant virus, resulting in replication of the complete virus. system with CAT as a reporter gene, it has been observed that the RasI polymorphism, which was completely linked with PstI in the 5'-flanking sequence of the CYP2E1 gene, caused a 10-fold increase in transcription activity compared with the wild type sequence (Hayashi et al. 1991). However, another study showed the decreased oral clearance of chlorzoxazone with RasI homozygous ho·mo·zy·gous adj. Having the same alleles at one or more gene loci on homologous chromosome segments. Homozygous Identical genes controlling a specified inherited trait. variants in Japanese residents of Hawaii (Marchand et al. 1999). The higher inducible enzyme in·duc·i·ble enzyme n. An enzyme that is normally present in minute quantities within a cell, but whose concentration increases dramatically when a substrate compound is added. activity was also observed in individuals with a 96 bp insertion ([Ins.sub.96]+/- and [Ins.sub.96]+/+) on the CYP2E1 promoter region (McCarver et al. 1998). Analysis of the combined effects of various genotype on risks of BP showed that the individuals with the NQO1 c.609 T/T, CYP2E1 c.-1293 G/C and C/C, and GSTT1 null genotype had an increased risk of I$P with exposure to benzene (Table 8). The results suggest that individuals with lower NQO1 and GSTT1 activity and higher CYP2E1 activity tend to be more susceptible to benzene toxicity. Joint action between genetic polymorphisms and environment on specific diseases is complicated. A more comprehensive, larger scale study should be warranted to confirm the gene-environment interaction Gene-environment interaction is a term used to describe any phenotypic effects that are due to interactions between the environment and genes. Naive nature versus nurture debates assume that variation in a given trait is primarily due to either genes, or the individual's on susceptibility to BP.
Table 1. PCR primer sequences.
Amplicon Primer sequences Length (bp)
NQO1
Promoter 5'GTAGCTGGGACTTACAGGCG3' and 484
5'GAGCAGAAAAAGAGCCGATG3'
Promoter 5'CAGGGAAGTGTGTTGTATGG3' and 380
5'AAGTCAAGAAAAGTCTCTCGG3'
Exon 1 5'TCTGTCACACACACCCCTACA3' and 474
5'AGGAACAAAATTCAGGCCAAG3'
Exon 2/3 5'CTGGTTGGTAATGGGTTTTC3' and 502
5'CACGCAAATGTCCCTGACAC3'
Exon 4 5'AAAGTGCTAACTCCCCA3' and 453
5'GGAAGCTCCATCTCAAACAA3'
Exon 5 5'CAGCAAATAGGACAGACTTGTG3' and 308
5'GTAGTGAACTAAGATGGTG3'
Exon 6 5'GAATTGGTTGACTTACCTC3' and 425
5'AACTAAAGCAAGTCAGGGA3'
CYP2E1
Promoter 5'AAGCCAAGGCTTCAATTTCA3' and 563
5'GATGAGAAATGAAGAAAATAAAAGTCA3'
Promoter 5'CAAGTGATTTGGCTGGATTG3' and 578
5'TCGGAATTCGATTCCACTTT3'
Promoter 5'TTGGTTGACTCACTCTTTCCTTT3' and 495
5'CCATCGTTTCAAAGGCTGAT3'
Exon 1 5'CAACCAGGGTGTGACACAG3' and 518
5'CCACAATTTGTCTGCAAATGA3'
Exon 2 5'ACTTCTAGCCACGGGTCTCC3' and 320
5'GATCTCATCCTTCGGATGCT3'
Exon 3 5'GCCCCCTCTGTCACTTCTTT3' and 295
5'CCCTGCTAGGCAGCAGATAC3'
Exon 4 5'CATCTTCTGGTTGCCCTGAC3' and 304
5'TGTTGTTTGGCTTTTGCAGT3'
Exon 5 5'AGCCACAAATTCAGGTTTGG3' and 305
5'GGAGAGCCCACATCATGG3'
Exon 6 5'CGGTCTGTCTCCGGTATCAC3' and 298
5'CAGCCATCTCACCACATCAC3'
Exon 7 5'AACTGGCCAGGAACCAATC3' and 300
5'GCAGGAAGGCGATTAGTGAT3'
Exon 8 5'ATTCTTCACTGGGGGTTTCC3' and 289
5'ACATGTGGAGGGGAGATGAG3'
Exon 9 5'CGCTTCCCCTAGTCTCACTG3' and 288
5'GTTCAGGGTGTCCTCCACAC3'
96 insertion 5'GTGATGGAAGCCTGAAGAACA3' and 586
5'CTTTGGTGGGGTGAGAACAG3'
Pstl 5'ACATTGTCAGTTCTCACCTC3' and 453
5'ATACCTATGGACTACCTTC3'
MPO
Promoter 5'ATTTCCTGTCCCCTFAGCC3' and 555
5'AGCCTCTAGCCACATCATCA3'
Promoter 5'GCTTCTTGCCTAAGGAAAAATACA3' and 513
5'AGAGGGCCCTGTCTATGGAT3'
Exon 1/2 5'CCTCAAGGAGGTCTGGCTTT3' and 534
5'GTGAAAGGCCTGGGACATC3'
Exon 3/4 5'CCTCACTTATGGCTCCAACG3' and 551
5'TCTCTGAGCCCGGTTCCT3'
Exon 5/6 5'GTGTCAGCGCCCTGTCCT3' and 494
5'ACAATCTCCCCTCTCCCAAC3'
Exon 7 5'GGTGAGCCAGTCTAGCCTCT3' and 404
5'TCCAACAGGGAACATCTCCT3'
Exon 8 5'GCAAATCTTTTCTGGGATGG3' and 309
5'CAGGAGCGTTAGGAACTTGC3'
Exon 9 5'AGGCCATTCCAATGACTTGT3' and 304
5'TCTGGCCTAGGTCCTGCTTA3'
Exon 10 5'GCCAGATACTTCCCCTGACC3' and 300
5'AGGGACCCTAGAGTGGGAAG3'
Exon 11 5'AGCAGAGAGACCTGCCCATA3' and 349
5'GGCTCCAAGAGAGTCAAGGA3'
Exon 12 5'CACAGTGTCCATGGGTGTTC3' and 448
5'TGAAACACTCCCCATGTTCA3'
Exon 12 5'CTGGGTGCAGCTGAGAAAAT3' and 484
5'CTGGTCCAGCTCTGCTAACC3'
Exon 12 5'GGCGTGAGAAGCATATAGAGG3' and 298
5'AGAGTGGAGGTCCCCATCAC3'
GSTM1 5'GAACTCCCTGAAAAGCTAAAGC3' and 215
5'GTTGGGCTCAAATATACGGTG3'
GSTT1 5'TTCCTTACTGGTCCTCACATCTC3' and 480
5'TCACCGGATCATGGCCAGCA3'
Albumin 5'GCCCTCTGCTAACAAGTCCTAC3' and 350
5'GCCCTAAAAAGATCGCCAATC3'
bp, base pair.
Table 2. Characteristics of cases and controls.
Cases Controls
No. Percent No. Percent
Total 156 100.0 152 100.0
Age (years)
[less than or equal to] 25 11 7.0 6 3.9
26-35 58 37.2 50 32.9
36-45 66 42.3 69 45.4
>45 21 13.5 27 17.8
Sex
Male 62 39.7 57 37.5
Female 94 60.3 95 62.5
Exposure duration (years)
[less than or equal to] 5 26 16.7 33 21.7
6-10 48 30.8 50 32.9
7-15 30 19.2 29 19.1
16-20 25 16.0 26 17.1
> 20 27 17.3 14 9.2
Intensity of exposure (mg/[m.sup.3])
[less than or equal to] 40 28 17.9 33 21.7
41-100 94 60.3 94 61.8
> 100 34 21.8 25 16.5
Smoking
Yes 19 12.2 34 22.4
No 130 83.3 117 77.0
No data 7 4.5 1 0.6
Alcohol consumption
Yes 18 11.5 17 11.2
No 133 85.3 134 88.2
No data 5 3.2 1 0.6
Type of work
Painting 63 40.4 58 38.2
Spraying 25 16.0 28 18.4
Painting and
spraying 20 12.8 16 10.5
Printing 4 2.6 7 4.6
Mechanic 14 9.0 10 6.6
Warehouseman 3 1.9 5 3.3
Other 27 17.3 28 18.4
Self-reported symptoms
Dizziness 135 86.5 73 48.0
Weariness 133 85.3 42 27.6
Dreaminess 80 51.3 28 18.4
Inappetence 46 29.5 8 5.3
Ecchymosis 86 55.1 19 12.5
Bleeding while
brushing teeth 96 61.5 28 18.4
Table 3. Allele and genotype frequencies of genetic
polymorphisms on NQO1, CYP2E1, MPO, GSTMI, and GSTT1.
Location Sequence variation Allele frequency (%)
NQO1
Exon 4 c.415C>T (a) C: 98.7; T: 1.3
Exon 6 c.609C>T (b) C: 50.4; T: 49.6
MPO
Promoter c.-581T>C (a) T: 90.8; C: 9.2
Promoter c.-463G>A G: 90.8; A: 9.2
5'UTR c.-25G>A (a) G: 98.9; A: 1.1
Intron 8 IVS8 + 19G>A (a) G: 90.4; A: 9.6
CYP2E1
Promoter c.-1563T>A (a) T: 70.7; A: 29.3
Promoter c.-1513T>G (a) T: 51.2; G: 48.8
Promoter c.-1412C>T (a) T: 97.6, C: 2.4
Promoter c.-1293G>C (a) G: 78.4, C: 21.6
Promoter c.-1053C>T C: 68.5; T: 31.5
Promoter c.-1025T>C T: 69.1; C: 30.9
Promoter c.-929A>G A: 80.9; G: 19.1
Promoter c.-806T>C T: 64.2; C: 35.8
Promoter c.-352A>G A: 78.9; G: 21.1
Promoter c.-333T>A T: 50.0; A: 50.0
Exon 8 c.1263C>T (a) C: 87.6; T: 12.4
Promoter 96-bp ins +: 19.8; -: 80.2 (d)
GSTM1 Null: 47.5
GSTT1 Null: 54.0
Location Genotype frequency (%)
NQO1
Exon 4 T/T: 0.3; C/T: 2.0; C/C: 97.7
Exon 6 T/T: 22.6; C/T: 54.1; C/C: 23.3
MPO
Promoter T/T: 81.7; T/C: 18.3
Promoter G/G: 81.7; G/A: 18.3
5'UTR G/G: 97.8; G/A: 2.2 (c)
Intron 8 G/G: 80.7; G/A: 19.3
CYP2E1
Promoter T/T: 46.3; T/A: 48.8; A/A: 4.9 (c)
Promoter T/T: 28.6; T/G: 45.2; G/G: 26.2 (c)
Promoter C/C: 95.2; C/T: 4.8 (c)
Promoter G/G: 59.2; G/C: 38.5; C/C: 2.3
Promoter C/C: 42.8; C/T: 51.4; T/T: 5.8 (c)
Promoter T/T: 44.1; T/C: 50.0; C/C: 5.9 (c)
Promoter A/A: 61.8; A/G: 38.2 (c)
Promoter T/T: 38.2; T/C: 52.0; C/C: 9.8 (c)
Promoter A/A: 57.8; A/G: 42.2 (c)
Promoter T/T: 27.3; T/A: 45.4; A/A: 27.3 (c)
Exon 8 C/T: 24.9; C/C: 75.1
Promoter +/+: 4.3; +/-:30.9;-/-: 64.8
GSTM1 Non-null: 52.5
GSTT1 Non-null: 46.0
Abbreviations: ins, insertion; UTR, untranslated region. Variation
nomenclature is based on the principle described by den Dunnen and
Antonarakis (2000).
(a) SNPs were deposited into HGVbase (Human Genome Variation database,
available online; Fredman et al. 2002); among the SNPs, MPO c.-581T>C,
MPO c.-25G>A, MPO IVS8 + 19G>A, CYP2E1 c.-1563T>A, CYP2E1 c.-1513T>G,
and CYP2E1 c.-1412C>T were novel. (b) NQO1 c.609C>T is located at the
559 position from the start codon of NQOI mRNA; we used NQO1 c.609C>T
in this study to be consistent with other papers. (c) Allele frequency
and genotype frequency were calculated in 48 subjects; others were
calculated in all subjects. (d) + indicates a 96-bp insertion in one
chromosome; - indicates no 96-bp insertion in the chromosome.
Table 4. Effect of NQO1, CYP2E1, MPO, GSTT1, and GSTM1 genotypes
on the risks of BP in benzene-exposed workers.
Case (a) Control (a)
No. Percent No. Percent
Total 156 100.00 152 100.00
NQO1
c.609C>T
T/T 36 25.71 28 19.58
C/T and C/C 104 74.29 115 80.42
CYP2E1
96 bp insertion
[Ins.sub.96]-/+ and +/+ 53 36.30 45 34.09
[Ins.sub.96]-/- 93 63.70 87 65.91
c.-1293G>C
G/C and C/C 65 41.67 59 39.33
G/G 91 58.33 91 60.67
c.1263C>T
C/T 31 24.80 37 25.00
C/C 94 75.20 111 75.00
MPO
c.-463G>A
G/A 28 18.67 27 18.00
G/G 122 81.33 123 82.00
IVS8 + 19G>A
G/A 29 20.42 26 18.18
G/G 113 79.58 117 81.82
GSTM1
Null 72 50.35 63 44.68
Non-null 71 49.65 78 55.32
GSTT1
Null 82 53.59 79 54.48
Non-null 71 46.41 66 45.52
O[R.sub.adj]
OR (95% CI) (95% CI) (b)
Total
NQO1
c.609C>T
T/T 1.42 (0.81-2.49) 1.43 (0.81-2.51)
C/T and C/C 1.00 1.00
CYP2E1
96 bp insertion
[Ins.sub.96]-/+ and +/+ 1.10 (0.67-1.80) 1.08 (0.66-1.79)
[Ins.sub.96]-/- 1.00 1.00
c.-1293G>C
G/C and C/C 1.10 (0.70-1.74) 1.12 (0.71-1.76)
G/G 1.00 1.00
c.1263C>T
C/T 0.99 (0.57-1.72) 0.99 (0.57-1.73)
C/C 1.00 1.00
MPO
c.-463G>A
G/A 1.05 (0.58-1.88) 1.09 (0.60-1.97)
G/G 1.00 1.00
IVS8 + 19G>A
G/A 1.15 (0.64-2.08) 1.11 (0.61-2.02)
G/G 1.00 1.00
GSTM1
Null 1.26 (0.79-2.00) 1.25 (0.78-2.00)
Non-null 1.00 1.00
GSTT1
Null 0.96 (0.61-1.52) 0.95 (0.60-1.50)
Non-null 1.00 1.00
(a) Data missing due to inability to amplify DNA. (b) ORs were
adjusted (adj) for potential confounding variables including
exposure duration, intensity of benzene exposure, and sex.
Table 5. Effects of genotypes of NQO1, CYP2E1, MPO, GSTT1, and GSTM1
modified by smoking on the risks of BP in benzene-exposed workers.
Smoking
Control
Case (%) (a) (%) (a)
Total 19 (100.00) 34 (100.00)
NQO1
c.609C>T
T/T 8 (44.44) 3 (9.68)
C/T and C/C 10 (55.56) 29 (90.32)
CYP2E1
96 bp insertion
Ins96-/+ and +/+ 7 (36.84) 12 (42.86)
Ins96-/- 12 (63.16) 16 (57.14)
c.-1293G>C
G/C and C/C 11 (57.89) 10 (29.41)
G/G 8 (42.11) 24 (70.59)
c.1263C>T
C/T 3 (18.75) 8 (23.53)
C/C 13 (81.25) 26 (76.47)
MPO
c.-463G>A
G/A 5 (26.32) 4 (12.12)
G/G 14 (73.68) 29 (87.88)
IVS8 + 19G>A
G/A 4 (21.05) 9 (30.00)
G/G 15 (78.95) 21 (70.00)
GSTM1
Null 10 (52.63) 12 (40.00)
Non-null 9 (47.37) 18 (60.00)
GSTT1
Null 10 (55.56) 17 (53.13)
Non-null 8 (44.44) 15 (46.87)
Smoking
O[R.sub.adj]
OR (95% CI) (95% CI) (b)
Total
NQO1
c.609C>T
T/T 7.73 (1.71-34.97) ** 8.15 (1.43-46.50) *
C/T and C/C 1.00 1.00
CYP2E1
96 bp insertion
Ins96-/+ and +/4 0.78 (0.24-2.57) 0.70 (0.18-2.66)
Ins96-/- 1.00 1.00
c.-1293G>C
G/C and C/C 3.30 (1.02-10.65) * 3.24 (0.90-11.71)
G/G 1.00 1.00
c.1263C>T
C/T 0.75 (0.17-3.31) 0.74 (0.15-3.79)
C/C 1.00 1.00
MPO
c.-463G>A
G/A 2.59 (0.60-11.16) 2.51 (0.49-13.02)
G/G 1.00 1.00
IVS8 + 19G>A
G/A 0.62 (0.1 6-2.40) 0.55 (0.13-2.34)
G/G 1.00 1.00
GSTM1
Null 1.67 (0.52-5.31) 1.33 (0.40-4.46)
Non-null 1.00 1.00
GSTT1
Null 1.10 (0.3-4.12) 1.13 (0.33-3.83)
Non-null 1.00 1.00
Nonsmoking
Control
Case (%) (a) (%) (a)
Total 130 (100.00) 117 (100.00)
NQO1
c.609C>T
T/T 27 (23.48) 25 (22.73)
C/T and C/C 88 (76.52) 85 (77.27)
CYP2E1
96 bp insertion
Ins96-/+ and +/4 44 (36.67) 32 (31.07)
Ins96-/- 76 (63.33) 71 (68.93)
c.-1293G>C
G/C and C/C 49 (37.69) 48 (41.74)
G/G 81 (62.31) 67 (58.26)
c.1263C>T
C/T 28 (27.45) 29 (25.66)
C/C 74 (72.55) 84 (74.34)
MPO
c.-463G>A
G/A 22 (17.74) 23 (19.83)
G/G 102 (82.26) 93 (80.17)
IVS8 + 19G>A
G/A 24 (20.69) 17 (15.18)
G/G 92 (79.31) 95 (84.82)
GSTM1
Null 59 (50.43) 51 (46.36)
Non-null 58 (49.57) 59 (53.64)
GSTT1
Null 68 (53.13) 62 (55.36)
Non-null 60 (46.87) 50 (44.64)
Nonsmoking
O[R.sub.adj]
OR (95%CI) (95% CI) (b)
Total
NQO1
c.609C>T
T/T 1.04 (0.56-1.94) 1.01 (0.54-1.89)
C/T and C/C 1.00 1.00
CYP2E1
96 bp insertion
Ins96-/+ and +/4 1.28 (0.73-2.25) 1.23 (0.70-2.17)
Ins96-/- 1.00 1.00
c.-1293G>C
G/C and C/C 0.84 (0.51-1.41) 0.87 (0.51-1.47)
G/G 1.00 1.00
c.1263C>T
C/T 1.10 (0.60-2.01) 1.07 (0.58-1.97)
C/C 1.00 1.00
MPO
c.-463G>A
G/A 0.87 (0.46-1.67) 0.93 (0.48-1.80)
G/G 1.00 1.00
IVS8 + 19G>A
G/A 1.46 (0.74-2.89) 1.36 (0.68-2.72)
G/G 1.00 1.00
GSTM1
Null 1.18 (0.70-1.98) 1.12 (0.66-1.92)
Non-null 1.00 1.00
GSTT1
Null 0.91 (0.55-1.52) 0.88 (0.53-1.48)
Non-null 1.00 1.00
(a) Data missing due to inability to amplify DNA. (b) ORs were
adjusted (adj) for potential confounding variables including sex,
exposure duration, intensity of benzene exposure, and alcohol
consumption. * p < 0.05, ** p < 0.01.
Table 6. Effects of genotypes of NQO1, CYP2E1, MPO, GSTT1, and GSTM1
modified by alcohol on the risks of BP in benzene-exposed workers.
Alcohol
Control
Case (%) (a) (%) (a)
Total 18 (100.00) 17 (100.00)
NQO1
c.609C>T
T/T 11 (61.11) 2 (12.50)
C/T and C/C 7 (38.89) 14 (87.50)
CYP2E1
96 bp insertion
Ins96-/+ and +/+ 9 (50.00) 6 (40.00)
Ins96-/- 9 (50.00) 9 (60.00)
c.-1293G>C
G/C and C/C 5 (27.78) 4 (23.53)
G/G 13 (72.22) 13 (76.47)
c. 1263C>T
C/T 6 (37.50) 5 (29.41)
C/C 10 (62.50) 12 (70.59)
MPO
c.-463G>A
G/A 5 (27.78) 2 (12.50)
G/G 13 (72.22) 14 (87.50)
IVS8 + 19G>A
G/A 6 (33.33) 3 (21.43)
G/G 12 (66.67) 11 (78.57)
GSTM1
Null 12 (66.67) 5 (33.33)
Non-null 6 (33.33) 10 (66.67)
GSTT1
Null 7 (41.18) 8 (53.33)
Non-null 10 (58.82) 7 (46.67)
Alcohol
O[R.sub.adj]
OR (95% CI) (95% CI) (b)
Total
NQO1
c.609C>T
T/T 11.00 (1.89-63.86) * 21.50 (2.79-165.79) *
C/T and C/C 1.00 1.00
CYP2E1
96 bp insertion
Ins96-/+ and +/+ 1.50 (0.38-6.00) 1.99 (0.44-8.95)
Ins96-/- 1.00 1.00
c.-1293G>C
G/C and C/C 1.25 (0.27-5.73) 3.43 (0.56-21.00)
G/G 1.00 1.00
c. 1263C>T
C/T 1.44 (0.37-6.16) 1.24 (0.23-6.74)
C/C 1.00 1.00
MPO
c.-463G>A
G/A 2.69 (0.44-16.37) 2.10 (0.30-14.87)
G/G 1.00 1.00
IVS8 + 19G>A
G/A 1.83 (0.37-9.17) 3.19 (0.40-25.19)
G/G 1.00 1.00
GSTM1
Null 4.00 (0.93-17.11) 4.21 (0.84-21.04)
Non-null 1.00 1.00
GSTT1
Null 0.61 (0.15-2.49) 0.54 (0.11-2.63)
Non-null 1.00 1.00
Non alcohol
Control
Case (%) (a) (%) (a)
Total 133 (100.00) 134 (100.00)
NQO1
c.609C>T
T/T 23 (19.66) 26 (20.63)
C/T and C/C 94 (80.34) 100 (79.37)
CYP2E1
96 bp insertion
Ins96-/+ and +/+ 42 (34.15) 38 (32.76)
Ins96-/- 81 (65.85) 78 (67.24)
c.-1293G>C
G/C and C/C 55 (41.35) 54 (40.91)
G/G 78 (58.65) 78 (59.09)
c. 1263C>T
C/T 25 (24.04) 32 (24.62)
C/C 79 (75.96) 98 (75.38)
MPO
c.-463G>A
G/A 22 (17.32) 25 (18.80)
G/G 105 (82.68) 108 (81.20)
IVS8 + 19G>A
G/A 23 (19.33) 23 (17.97)
G/G 96 (80.67) 105 (82.03)
GSTM1
Null 57 (47.50) 58 (46.40)
Non-null 63 (52.50) 67 (53.60)
GSTT1
Null 71 (54.20) 71 (55.04)
Non-null 60 (45.80) 58 (44.96)
Non alcohol
O[R.sub.adj]
OR (95%CI) (95% CI) (b)
Total
NQO1
c.609C>T
T/T 0.94 (0.50-1.76) 0.90 (0.47-1.72)
C/T and C/C 1.00 1.00
CYP2E1
96 bp insertion
Ins96-/+ and +/+ 1.06 (0.62-1.82) 1.06 (0.61-1.84)
Ins96-/- 1.00 1.00
c.-1293G>C
G/C and C/C 1.02 (0.62-1.66) 0.97 (0.58-1.60)
G/G 1.00 1.00
c. 1263C>T
C/T 0.97 (0.53-1.77) 0.99 (0.54-1.83)
C/C 1.00 1.00
MPO
c.-463G>A
G/A 0.91 (0.48-1.70) 0.97 (0.50-1.85)
G/G 1.00 1.00
IVS8 + 19G>A
G/A 1.09 (0.58-2.08) 0.97 (0.50-1.90)
G/G 1.00 1.00
GSTM1
Null 1.05 (0.63-1.73) 1.01 (0.61-1.70)
Non-null 1.00 1.00
GSTT1
Null 0.97 (0.59-1.58) 0.97 (0.58-1.59)
Non-null 1.00 1.00
(a) Data missing due to inability to amplify DNA. (b) ORs were
adjusted (adj) for potential confounding variables including sex,
exposure duration, intensity of benzene exposure, and smoking.
* p < 0.01.
Table 7. Multiple-variables unconditional logistic regression
analysis.
Variables [beta] p-Value OR (95% CI)
Intensity of benzene
exposure
40-100 mg/[m.sup.3] -0.341 0.312 0.711 (0.368-1.377)
> 100 mg/[m.sup.3] 0.099 0.762 1.104 (0.581-2.099)
Alcohol (yes vs. no) -0.735 0.146 0.4795 (0.178-1.292)
NQO1 (a) -0.150 0.791 0.8607 (0.283-2.620)
CYP2E1 (b) 0.094 0.820 1.0995 (0.485-2.493)
GSTT1 (c) -0.232 0.525 0.7928 (0.387-1.624)
NQO1 (a) x CYP2E1 (b) -0.906 0.328 0.4040 (0.065-2.490)
NQO18 x GSTT1 (c) -0.404 0.622 0.6673 (0.134-3.333)
CYP2E1 (b) x GSTT1 (c) -0.558 0.332 0.5723 (0.185-1.769)
Alcohol (yes vs. no) x 3.271 0.007 26.3425 (2.379-291.688)
NQO1 (a)
GSTTI (c) x NQO1 (a) x 3.281 0.019 26.6020 (1.703-415.478)
CYP2E1 (b)
Constant 0.262 0.456
(a) NQO1 c.609 T/T versus C/T and C/C. (b) CYP2E1 c.-1293 G/C and C/C
versus G/G. (c) GSTT1 null versus non-null.
Table 8. Combined effect of CYP2E1, GSTT1, and NQO1 genetic
polymorphisms on risks of benzene poisoning.
Case
CYP2E1 NQO1 (a) Control
c.-1293 G>C GSTT1 C.609 C>T (n) (a) (n)
G/C and C/C Null T/T 11 2
G/C and C/C Null C/T and C/C 19 28
G/C and C/C Non-null T/T 4 7
G/C and C/C Non-null C/T and C/C 23 19
G/G Null T/T 9 9
G/G Null C/T and C/C 32 35
G/G Non-null T/T 11 8
G/G Non-null C/T and C/C 30 29
CYP2E1 O[R.sub.adj]
c.-1293 G>C OR (95% CI) (95% CI) (b)
G/C and C/C 5.32 (0.97-38.19) 5.64 (1.22-26.10) *
G/C and C/C 0.66 (0.34-1.28) 0.65 (0.34-1.26)
G/C and C/C 0.50 (0.14-1.89) 0.51 (0.14-1.85)
G/C and C/C 1.17 (0.53-2.59) 1.19 (0.53-2.68)
G/G 0.99 (0.37-2.63) 0.99 (0.37-2.68)
G/G 0.80 (0.39-1.66) 0.88 (0.44-1.78)
G/G 1.33 (0.47-3.78) 1.35 (0.46-3.96)
G/G 1.00 1.00
(a) Date missing due to inability to amplify DNA. (b) ORs
were adjusted (adj) for potential confounding variables
including sex, exposure duration, and intensity of benzene
exposure. * p < 0.05.
REFERENCES Aksoy M, Dincol K, Akgun T, Erdem S, Oincol G. 1972. Details of blood changes in 32 patients with pancytopenia pancytopenia /pan·cy·to·pe·nia/ (-sit-ah-pe´ne-ah) abnormal depression of all the cellular elements of the blood. pan·cy·to·pe·ni·a n. associated with long-term exposure to benzene. Br J Ind Med 29:56-64. Arand M, Muhlbauer R, Hengstier J, Jager E, Fuchs J, Winkler Winkler may refer to:
Chen H, Sandler DP, Taylor JA, Shore DL, Liu E This article is about the Qing Dynasty official and wirter. For the Han Zhao empress, see Empress Liu E. Liu E (Traditional Chinese: 劉鶚; Simplified Chinese: , Bloomfield CD, et al. 1996. Increased risk for myelodysplastic syndromes in individuals with glutathione transferase transferase /trans·fer·ase/ (trans´fer-as) a class of enzymes that transfer a chemical group from one compound to another. trans·fer·ase n. theta Theta A measure of the rate of decline in the value of an option due to the passage of time. Theta can also be referred to as the time decay on the value of an option. If everything is held constant, then the option will lose value as time moves closer to the maturity of the option. 1(GSTT1) gene defect. Lancet 347:295-297. den Dunnen JT, Antonarakis SE. 2000. Mutation nomenclature extensions and suggestions to describe complex mutations: a discussion. Hum Mutat 15:7-12. Dosemeci M, Yin SN, Linet M, Wacholder S, Rothman N, Li GL, et al. 1996. Indirect validation of benzene exposure assessment by association with benzene poisoning. Environ Health Perspect 104(suppl 6):1343-1347. Eastmond DA, Smith MT, Irons RD. 1987. An interaction of benzene metabolites reproduces the myelotoxicity observed with benzene exposure. Toxicol Appl Pharmocol 91:85-95. Fredman D, Siegfried M, Yuan YP, Bork P, Levaslaiho H, Brookes AJ. 2002. HGVbase: a human sequence variation database emphasizing data quality and a broad spectrum of data sources. Nucleic Acids Nucleic acids The cellular molecules DNA and RNA that act as coded instructions for the production of proteins and are copied for transmission of inherited traits. Res 38:387-391. Fritsche E, Pittman GS, Bell DA. 2000. Localization Customizing software and documentation for a particular country. It includes the translation of menus and messages into the native spoken language as well as changes in the user interface to accommodate different alphabets and culture. See internationalization and l10n. , sequence analysis, and ethnic distribution of a 98-bp insertion in the promoter of the human CYP2E1 gene. Mutat Res/Mutat Res Genomics 432:1-5. Hayashi S, Watanabe J, Kawajiri K. 1991. Genetic polymorphisms in the 5'-flanking region change transcriptional regulation of the human cytochrome P45011E1 gene. J Biochem 110:559-565. HGVbase (Human Genome The human genome is the genome of Homo sapiens, which is composed of 24 distinct pairs of chromosomes (22 autosomal + X + Y) with a total of approximately 3 billion DNA base pairs containing an estimated 20,000–25,000 genes. Variation Database). Available: http://hgvbase.cgb.ki.se/[accessed 20 September 2002]. Hirvonen A, Husgefvel-Pursiainen K, Anttila S, Karjalainen A, Vainio H. 1993. The human CYP2EI gene and lung cancer: DraI and RsaI restriction fragment length polymorphisms restriction fragment length polymorphism n. Abbr. RFLP Intraspecies variations in the length of DNA fragments generated by the action of restriction enzymes and caused by mutations that alter the sites at which these enzymes act, changing in Finnish study population. Carcinogenesis car·ci·no·gen·e·sis n. The production of cancer. carcinogenesis production of cancer. biological carcinogenesis viruses and some parasites are capable of initiating neoplasia. 14:85-88. Irons RD, Stillman WS. 1996. Impact of benzene metabolites on differentiation of bone marrow progenitor cells. Environ Health Perspect 104(suppl 6):1247-1250. Joseph P, Long DJ, Klein-Szanto AJ, Jaiswal AK. 2000. Role of NAD(P)H:quinone oxidoreductase 1 (DT diaphorase) in protection against quinone toxicity. Biochem Pharmacol 60:207-214. Kolachana P, Subrahmanyam W, Meyer KB, Zhang L, Smith MT. 1993. Benzene and its phenolic phe·no·lic adj. Of, relating to, containing, or derived from phenol. n. Any of various synthetic thermosetting resins, obtained by the reaction of phenols with simple aldehydes and used as adhesives. metabolites produce oxidative DNA damage in HL60 cells in vitro and in the bone marrow in vivo in vivo /in vi·vo/ (ve´vo) [L.] within the living body. in vi·vo adj. Within a living organism. in vivo adv. . Cancer Res 53(5):1023-1026. Koop DR, Laethem CL, Schnier GG. 1989. Identification of ethanol-inducible P450 isozyme isozyme /iso·zyme/ (i´so-zim) one of the multiple forms in which an enzyme may exist in an organism or in different species, the various forms differing chemically, physically, or immunologically, but catalyzing the same reaction. 3a(P450IIE See Apple II. 1) as a benzene and phenol hydroxylase. Toxicol Appl Pharmacol 98:278-288. Kuklin A, Munson K, Gjerde M, Haefele R, Taylor P. 1997/98. Detection of single-nucleotide polymorphisms with the WAVE DNA fragment analysis system. Genet genet: see civet. Test 1:201-206. Linet MS, Yin SN, Travis LB, Li CY, Zhang ZN, Li DG, et al. 1996. Clinical features of hematopoietic hematopoietic /he·ma·to·poi·et·ic/ (-poi-et´ik) 1. pertaining to hematopoiesis. 2. an agent that promotes hematopoiesis. hematopoietic 1. pertaining to or affecting the formation of blood cells. malignancies and related disorders among benzene-exposed workers in China. Environ Health Perspect 104(suppl 6):1353-1364. Marchand LL, Wilkinson GR, Wilkens LR. 1999. Genetic and dietary predictors of CYP2E1 activity: a phenotyping study in Hawaii Japanese using chlorzoxazone. Cancer Epidemiol Biomark Prev 8:495-500. McCarver DG, Byun R, Hines RN, Hichme M, Wegenek W. 1998. A genetic polymorphism in the regulatory sequences of human CYP2E1: association with increased chlorzoxazone hydroxylation hydroxylation addition of -OH groups to a molecule. in the presence of obesity and ethanol intake. Toxicol Appl Pharmacol 152:276-281. Ministry of Health, China. 1982. Diagnostic criteria and principles of management of occupational benzene poisoning (GB 3230-82). In: National Diagnostic Criteria Compilation of Occupational Diseases. Beijing:Ministry of Health, China, 3-11 Moran JL, Siegel D, Ross D. 1999. A potential mechanism underlying the increased susceptibility of individuals with a polymorphism in NAD(P)H: quinone oxidoreductase 1 (NQO1)to benzene toxicity. Proc Natl Acad Sci USA 96:8150-8155. Mucci LA, Wedren S, Tamimi RM, Trichopoulos D, Adami HO. 2001. The role of gene-environment interaction in the aetiology aetiology see etiology. of human cancer: examples from cancers of the large bowel large bowel n. See large intestine. , lung and breast. J Intern intern /in·tern/ (in´tern) a medical graduate serving in a hospital preparatory to being licensed to practice medicine. in·tern or in·terne n. Med 249(6):477-493. Piedrafita FJ, Molander G, Vansant G, Orlova EA, Pfahl M, Reynolds WF. 1996. An Alu element in the myeloperoxidase promoter contains a composite SP1-thyroid hormone-retinoic acid response element. J Biol Chem 271:14412-14420. PolyPhred. Available: http://droog.gs.washington.edu/PolyPhred.html [accessed 20 September 2002]. Puga A, Nebert DW, Mckinnon RA, Menon AG. 1997. Genetic polymorphisms in human drug-metabolizing enzymes: potential uses of reverse genetics reverse genetics methods such as antisense nucleic acids and site-directed mutagenesis that are used to selectively study gene function. Contrasts with classical genetics which depends on the isolation and analysis of cells (animals) with random mutations that can be identified. to identify genes of toxicological relevance. Crit Rev Toxicol 27:199-222. Ross D, Siegel D, Schattenberg DG, Sun XM, Moran JL. 1996. Cell-specific activation and detoxification of benzene metabolites in mouse and human bone marrow: identification of target cells and a potential role for modulation of apoptosis in benzene toxicity. Environ Health Perspect 104(suppl 6):1177-1182. Rothman N, Smith MT, Hayes RB, Traver RD, Hoener B, Campleman S, et al. 1997. Benzene poisoning, a risk factor for hematological malignancy Although hematological malignancies are a form of cancer, they are generally treated by specialists in hematology, although in many hospitals oncology specialists also manage these diseases. , is associated with the NQO1 609C>T variation and rapid fractional excretion of chlorzoxazone. Cancer Res 57:2839-2842. Schattenberg DG, Stillman WS, Gruntmeir JJ, Helm KM, Irons RD, Ross D. 1994. Peroxidase peroxidase /per·ox·i·dase/ (per-ok´si-das) any of a group of iron-porphyrin enzymes that catalyze the oxidation of some organic substrates in the presence of hydrogen peroxide. per·ox·i·dase n. activity in murine murine /mu·rine/ (mur´en) pertaining to, derived from, or characteristic of mice or rats. mu·rine adj. and human hematopoietic progenitor cells: potential relevance to benzene-induced toxicity. Mol Pharmacol 46:346-351. Smith MT, Yager JW, Steinmetz KL, Eastmond DA. 1989. Peroxidase-dependent metabolism of benzene's phenolic metaboiltes and its potential role in benzene toxicity and carcinogenicity carcinogenicity /car·ci·no·ge·nic·i·ty/ (kahr?si-no-je-nis´i-te) the ability or tendency to produce cancer. carcinogenicity the ability or tendency to produce cancer. . Environ Health Perspect 82:23-29. Subrahmanyam VV, Kolachana P, Smith MT. 1991. Hydroxylation of phenol to hydroquinone catalyzed by a human myeloperoxidase-superoxide complex: possible implications in benzene-induced myelotoxicity. Free Radic Res Commun 15:285-296. Traver RD, Horidoshi T, Danenderg KD, Stadlbauer THW THW Technisches Hilfswerk (German government disaster relief organization) THW This House Would (debating) THW Turnverein Hassee-Winterbek (Kiel, Germany handball team) , Danenberg PV, Ross D, et al. 1982. NAD(P)H:quinone oxidoreductase gene expression in human colon carcinoma cells: characterization of a variation which modulates DT-diaphorase activity and mitomycin mitomycin /mi·to·my·cin/ (mi?to-mi´sin) 1. any of a group of antitumor antibiotics (e.g., mitomycin A, B, C) produced by Streptomyces caespitosus. 2. mitomycin C; used as a palliative antineoplastic. sensitivity. Cancer Res 52:797-802. Traver RD, Siegel D, Beall HD, Phillips RM, Gibson NW, Franklin WA, et al. 1997. Characterization of a polymorphism in NAD(P)H:quinone oxidoreductase (DT-diaphorase). Br J Cancer 75:69-75. Valentine JL, Lee SS, Seaton M J, Asgharian B, Farris G, Cotton JC, et al. 1996. Reduction of benzene metabolism and toxicity in mice that lack CYP2E1 expression. Toxicol Appl Pharmacol 141:205-213. Yin SN, Li GL, Tain FD, Fu NI, Jin C, Chen YJ, et al. 1987. Leukemia leukemia (l  kē`mēə), cancerous disorder of the blood-forming tissues (bone marrow, lymphatics, liver, spleen) characterized by excessive production of immature or mature in benzene workers, a retrospective cohort study A cohort study is a form of longitudinal study used in medicine and social science. It is one type of study design.In medicine, it is usually undertaken to obtain evidence to try to refute the existence of a suspected association between cause and disease; failure to refute . Br J Ind Med 44:124-128. Junxiang Wan, (1), * Jinxiu Shi, (2), * Lijian Hui, (2), * Dan Wu, (2) Xipeng Jin, (1) Naiqing Zhao, (3) Wei Huang, (4) Zhaolin Xia, (1) and Gengxi Hu (2) (1) Department of Occupational and Environmental Health, School of Public Health, Fudan University Fudan University (Simplified Chinese: 复旦大学; Traditional Chinese: 復旦大學; Pinyin: Fùdàn Dàxué , Shanghai, China; (2) Institute of Biochemistry and Cell Biology Cell biology The study of the activities, functions, properties, and structures of cells. Cells were discovered in the middle of the seventeenth century after the microscope was invented. , Shanghai Institute for Biological Sciences, Chinese Academy of Sciences The Chinese Academy of Sciences (CAS) (Simplified Chinese: 中国科学院; Pinyin: Zhōngguó Kēxuéyuàn), formerly known as Academia Sinica , Shanghai, China; (3) Department of Statistics, School of Public Health, Fudan University, Shanghai, China; (4) Shanghai Human Genome Center, Shanghai, China Address correspondence to G. Hu, Institute of Biochemistry and Cell Biology, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences, 320 Yue-yang Road, Shanghai 200031, China. Telephone: 86-21-64378218. Fax: 86-21-64378218. E-mail: xbshu@sunm.shcnc.ac.cn You may also address correspondence to Z. Xia, Department of Occupational and Environmental Health, School of Public Health, Fudan University, 138 Yi-xueyuan Road, Shanghai 200032, China. Telephone: 86-21-64041900-2196. Fax: 86-21-64037260. E-mail: zlxia@shmu.edu.cn * These authors contributed equally to this work. We thank D. Cao, J. Guan guan: see curassow. , X. Gao, and W. Liu. This study was supported by an institutional review board of the Chinese Academy of Sciences and Ministry of Health (grants 970231006 and 96Q030, respectively). This work was part of project 30271113 supported by the National Natural Science Foundation of China. Received 7 February 2002; accepted 26 April 2002. |
|
||||||||||||||||
Printer friendly
Cite/link
Email
Feedback
Reader Opinion