Arsenic exposure is associated with decreased DNA repair in vitro and in individuals exposed to drinking water arsenic.The mechanism(s) by which arsenic exposure contributes to human cancer risk is unknown; however, several indirect cocarcinogenesis mechanisms have been proposed. Many studies support the role of As in altering one or more DNA repair processes. In the present study we used individual-level exposure data and biologic samples to investigate the effects of As exposure on nucleotide excision repair Nucleotide excision repair is a DNA repair mechanism. DNA constantly requires repair due to damage that can occur to bases from a vast variety of sources including chemicals but also ultraviolet (UV) light from the sun. in two study populations, focusing on the excision repair cross-complement 1 (ERCC ERCC Excision-Repair Cross-ComplementingERCC Engine(s) Running Crew Change ERCC Electric Reliability Coordinating Council ERCC Excision-Repair, Complementing Defective, in Chinese Hamster 1) component. We measured drinking water, urinary, or toenail toenail /toe·nail/ (to´nal) the nail on any of the digits of the foot. ingrown toenail see under nail. toe·nail n. As levels and obtained cryopreserved lymphocytes of a subset of individuals enrolled in epidemiologic studies in New Hampshire (USA) and Sonora (Mexico). Additionally, in corroborative laboratory studies, we examined the effects of As on DNA repair in a cultured human cell model. Arsenic exposure was associated with decreased expression of ERCC1 in isolated lymphocytes at the mRNA and protein levels. In addition, lymphocytes from As-exposed individuals showed higher levels of DNA DNA: see nucleic acid. DNA or deoxyribonucleic acid One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes. damage, as measured by a comet assay, both at baseline and after a 2-acetoxyacetylaminofluorene (2-AAAF) challenge. In support of the in vivo data, As exposure decreased ERCC1 mRNA expression and enhanced levels of DNA damage after a 2-AAAF challenge in cell culture. These data provide further evidence to support the ability of As to inhibit the DNA repair machinery, which is likely to enhance the genotoxicity Genotoxic substances are a type of carcinogen, specifically those capable of causing genetic mutation and of contributing to the development of tumors. This includes both certain chemical compounds and certain types of radiation. and mutagenicity mutagenicity /mu·ta·ge·nic·i·ty/ (-je-nis´it-e) the property of being able to induce genetic mutation. mutagenicity the property of being able to induce genetic mutation. of other directly genotoxic genotoxic /ge·no·tox·ic/ (je´no-tok?sik) damaging to DNA: pertaining to agents known to damage DNA, thereby causing mutations, which can result in cancer. ge·no·tox·ic adj. compounds, as part of a cocarcinogenic mechanism of action. Key words: arsenic, arsenite, DNA repair, ERCC1, molecular epidemiology, nucleotide excision repair. Environ Health Perspect 114:1193-1198 (2006). doi:10.1289/ehp.9008 available via http://dx.doi.org/ [Online 10 May 2006] ********** Arsenic is an established lung, skin, and bladder carcinogen [International Agency for Research on Cancer The International Agency for Research on Cancer (IARC, or CIRC in its French acronym) is an intergovernmental agency forming part of the World Health Organisation of the United Nations. Its main offices are in Lyon, France. (IARC) 2004]; however, the carcinogenic mechanisms are currently under investigation. Based primarily on studies of highly exposed populations in Taiwan and elsewhere, the U.S. Environmental Protection Agency Environmental Protection Agency (EPA), independent agency of the U.S. government, with headquarters in Washington, D.C. It was established in 1970 to reduce and control air and water pollution, noise pollution, and radiation and to ensure the safe handling and (EPA EPA eicosapentaenoic acid. EPA abbr. eicosapentaenoic acid EPA, n.pr See acid, eicosapentaenoic. EPA, n. ) recently reduced the maximum contaminant level Maximum Contaminant Levels are standards that are set by the United States Environmental Protection Agency (EPA) for drinking water quality. A Maximum Contaminant Level (MCL) is the legal threshold limit on the amount of a hazardous substance that is allowed in drinking water under (MCL MCL - Macintosh Common LISP ) standard for arsenic in drinking water from 50 [micro]g/L to 10 [micro]g/L (U.S. EPA 2006). At the lower end of the dose-response curve, the biologic effects and magnitude of disease risk in the human population remain unknown (Abernathy et al. 1999). However, a growing number of laboratory studies, both in cell cultures and in experimental animals, have demonstrated biologic effects of As at very low levels equivalent to those below the new 10 [micro]g/L standard. These effects include endocrine disruption, altered cell signaling, altered cell cycle kinetics, alterations in proliferative response, and other effects that may be associated with carcinogenesis and other disease processes (reviewed by Rossman 2003). Thus, it is important to understand the potential adverse effects of such exposure in the human population. An estimated 2% of the drinking water serving U.S. households contains [greater than or equal to] 2 [micro]g/L As (National Research Council 2001). Approximately 40% of households in the state of New Hampshire are served by unregulated private wells, with homeowner-financed, optional contaminant testing. Moreover, until recent studies revealed the extent of geologic As contamination of drinking water in the state (Peters et al. 1999), As was not part of the standard laboratory water testing panel. Case-control studies of bladder and skin cancer conducted in the New Hampshire population have detected evidence of elevated cancer risks. For bladder cancer, an excess risk was observed primarily among smokers exposed to As in the drinking water, supporting hypotheses that these levels of As are cocarcinogenic (Karagas et al. 2001, 2004). Likewise, drinking water in the southwestern United States and northern Mexico contains As at concentrations above the new MCL of 10 [micro]g/L (Meza et al. 2004). The precise mechanism of As cocarcinogenesis is unknown. It has been difficult to detect genotoxic effects of As per se at environmental levels [Agency for Toxic Substances and Disease Registry The United States Agency for Toxic Substances and Disease Registry, (ATSDR) is an agency for the U.S. Department of Health and Human Services that is directed by a congressional mandate to perform specific functions concerning the effect on public health of hazardous (ATSDR ATSDR Agency for Toxic Substances & Disease Registry ) 1999; IARC 2004; Rossman 2003]. However, many studies support the role of As in altering one or more DNA repair processes [World Health Organization (WHO) 2001]. Arsenic has been shown to potentiate po·ten·ti·ate v. 1. To make potent or powerful. 2. To enhance or increase the effect of a drug. 3. To promote or strengthen a biochemical or physiological action or effect. the genotoxicity of other organic mutagen-carcinogens, particularly polycyclic aromatic hydrocarbons (PAHs), including benzo[a]pyrene (BAP BAP - 1. [Listed in CACM 2(5):16 (May 1959)]. UVR Unidad de Valor Real (Spanish) UVR Under-Voltage Relay UVR Ultraviolet Radiometer ) (ATSDR 1999; Rossman 2003). Rats treated with As and BAP sustained adduct adduct /ad·duct/ (ah-dukt´) to draw toward the median plane or (in the digits) toward the axial line of a limb. adduct /ad·duct/ (a´dukt) inclusion complex. burdens longer than did rats treated with BAP alone, suggesting impairment of DNA repair by As as a possible mechanism (Tran et al. 2002). A study using human fibroblasts Fibroblasts A type of cell found in connective tissue; produces collagen. Mentioned in: Skin Grafting found that low (2.5 [micro]M, ~180 [micro]g/L) concentrations of arsenite reduced nucleotide excision repair efficiency, and incision frequency in particular, after UVR exposure (Hartwig et al. 1997). Results of another study in cultured human fibroblasts indicated that As exposure reduced DNA repair capacity as measured by the comet assay (Curnow et al. 2001). The effects of As are strongly dose, time, and species dependent (Barchowsky et al. 1999; WHO 2001). In particular, several As-induced effects exhibit a biphasic bi·pha·sic adj. Having two distinct phases: a biphasic waveform; a biphasic response to a stimulus. characteristic. For example, low ([less than or equal to] 1-2 [micro]M) doses of As in cell culture increase cell proliferation and enhance endocrine signaling, whereas higher but still noncytotoxic doses (2-5 [micro]M) suppress these same pathways (Barchowsky et al. 1999). Likewise, patterns of altered gene expression, as detected by DNA microarray studies, demonstrated very different patterns at low versus higher doses (Andrew et al. 2003b). Thus, although animal and cell culture studies provide controlled model systems for mechanistic studies of As, it is critical to understand which of these findings translate into cellular, molecular, and clinical effects in actual human exposure situations, and the role of these in pathophysiologic processes such as carcinogenesis. In our preliminary study of human lymphocytes from individuals exposed to drinking water As, As exposure was correlated in a strongly dose-dependent manner to decreased expression of three nucleotide excision repair genes: ERCC1, XPB XPB Xeroderma Pigmentosum, Complementation Group b XPB Parksville, British Columbia, Canada - Parksville / via Rail Service (Airport Code) XPB Crosspoint Buffer , and XPF XPF The ISO 4217 currency code for the CFP Franc. (Andrew et al. 2003a). The objective of this investigation was to evaluate our preliminary observation of an association between As exposure, focusing on ERCC1 gene expression levels in a larger number of individuals with exposure data and biologic samples. In addition to gene expression, we investigated the effects of As exposure at both the protein and DNA repair functional levels. We then extended our investigation into another population exposed to similar levels of As in Mexico and also performed in vitro As experiments to validate our results in a controlled system. Materials and Methods Human populations. New Hampshire. We selected subjects from an ongoing epidemiologic study of bladder cancer in New Hampshire (Karagas et al. 1998, 2004). Selection was based on high or low As exposure from individuals on whom we had collected cryopreserved lymphocytes. Within this subset (n = 37), the drinking water As levels of the low-exposure group averaged 0.7 [micro]g/L (range, 0.007-5.3 [micro]g/L), whereas the high-exposure group averaged 32 [micro]g/L (range, 10.4-74.7 [micro]g/L). Data on subject's exposure history were available through a personal interview covering demographic information, history of tobacco use, and other lifestyle factors. Informed consent was obtained from each participant, and all procedures and study materials were approved by the Committee for the Protection of Human Subjects at Dartmouth College. Subjects agreed to provide a venous blood sample that was drawn into cell prep tubes (CPT CPT See: Carriage Paid To ) containing citrate and a lymphocyte isolation gradient. Blood tubes were maintained at 4[degrees]C and sent to the study laboratory for processing and analysis. No later than 24 hr after the blood draw, the lymphocytes collected in CPTs containing sodium citrate were isolated according to the manufacturer's instructions using standard buoyant density centrifugation methods. After centrifugation, first plasma was removed, aliquoted, and frozen at -80[degrees]C, and then the mononuclear cells were removed by pipette and cryopreserved (-120[degrees]C) using freezing media at a controlled rate of 1[degrees]C/min. This procedure has previously been demonstrated to ensure approximately 90% viability after thawing (Wei et al. 1994). Additionally, toenail clipping samples collected at the time of interview were analyzed for As and other trace elements by instrumental neutron activation analysis Neutron Activation Analysis (NAA) is a nuclear process used for determining certain concentrations of elements in a vast amount of materials. NAA allows discrete sampling of elements as it disregards the chemical form of a sample, and focuses solely on its nucleus. (INAA INAA Instrumental Neutron Activation Analysis INAA Islamic National Accord Association INAA Integrated Network Access Arrangement INAA Intelligent Network Access Arrangement ) at the University of Missouri research reactor using a standard comparison approach as described previously (Cheng et al. 1995). The detection limit for As measured by INAA is approximately 0.001 [micro]g/g. A water sample from the current household drawn into commercially washed (mineral-free) high-density polyethylene bottles (Fisher Scientific, Suwanee, GA, USA) that meet U.S. EPA standards for water collection (U.S. EPA 2002) were analyzed for As concentration using an Agilent 7500c Octopole inductively coupled plasma An inductively coupled plasma (ICP) is a type of plasma source in which the energy is supplied by electrical currents which are produced by electromagnetic induction, that is, by time-varying magnetic fields. mass spectrometer (Agilent Technologies Inc., Palo Alto, CA, USA) in the Dartmouth Trace Element Analysis Core Facility (Karagas et al. 2000). Sonora, Mexico. Subjects were recruited in 2004 from several towns in the Yaqui Valley of Sonora, Mexico, by contact through local health care officials after attending an informational meeting in their hometowns, as described previously (Meza et al. 2004). The present study involved a subset of subjects who provided biologic samples (n = 16). They ranged in age from 23 to 63 years and were in good health (self-reported and by physical examination). All subjects gave their informed consent, as approved by the Human Subjects Committee of the University of Arizona (body, education) University of Arizona - The University was founded in 1885 as a Land Grant institution with a three-fold mission of teaching, research and public service. and the Ministry of Public Health of Sonora State. Physical data and data on the health status, cigarette smoking, dietary habits, and other variables were collected by questionnaire and physical examination. Individuals from the town of Esperanza were exposed to drinking water As levels from two wells measured multiple times, with a combined mean of 43.3 [+ or -] 8.4 [micro]g As/L. A comparable group of individuals from another town, Colonia Allende, were exposed to lower levels of As from one well of 5.5 [+ or -] 0.20 [micro]g As/L. This well water was the sole source of drinking water for these subjects. Blood collection and processing were performed using similar methods to those described above for New Hampshire subjects. First-morning-void urine samples were obtained in 100 mL polypropylene bottles and kept on ice. Within 6 hr, cooled samples were taken to the Institute Technologic of Sonora and kept frozen at -40[degrees]C. The accumulated samples were then shipped on dry ice to the University of Arizona, where the samples were stored at -80[degrees]C until the analysis of total As, and As species was performed as described previously (Meza et al. 2005). The detection limits were 0.42-1.08 [micro]g/L for As compounds. Cell line. We used Jurkat lymphoblast lymphoblast /lym·pho·blast/ (lim´fo-blast) a morphologically immature lymphocyte, representing an activated lymphocyte that has been transformed in response to antigenic stimulation. cells as a controlled in vitro system to evaluate the effects of As on DNA damage and repair. Cells were grown in suspension in RPMI RPMI Rapid Prototyping & Manufacturing Institute RPMI Roswell Park Memorial Institute RPMI Royal Park Memorial Institute (culture medium) medium containing L-glutamine with 10% fetal bovine serum Fetal bovine serum ( or foetal bovine serum) is serum taken from the fetuses of cows. Fetal Bovine Serum (or FBS) is the most widely used serum in the culturing of cells. In some papers the expression foetal calf serum is used. (Atlanta Biologicals, Norcross, GA, USA) and 1% penicillin-streptomycin (Mediatech Inc., Herndon, VA, USA). Cells were exposed to 0.01-10 [micro]M sodium arsenite (Sigma, St. Louis, MO, USA), which is equivalent to 0.75-750 [micro]g/L, for a period of 24 hr before harvesting and RNA RNA: see nucleic acid. RNA in full ribonucleic acid One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic isolation for gene expression analysis. Cells were exposed in culture to 0 or 1 [micro]M (equivalent to 75 [micro]g/L) As as sodium arsenite for 24 hr before the comet assay was performed, as described below. Gene expression analysis. RNA was harvested using Trizol reagent (Gibco/BRL Life Technologies, Gaithersburg, MD, USA) followed by DNase digestion using DNAfree (Ambion Inc., Austin, TX, USA) according to the manufacturer's instructions and quantitated by spectrophotometric absorbance absorbance /ab·sor·bance/ (-sor´bans) 1. in analytical chemistry, a measure of the light that a solution does not transmit compared to a pure solution. Symbol . 2. at 260 nm. We performed real-time reverse-transcription polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is (RT-PCR RT-PCR reverse transcriptase-polymerase chain reaction. See PCR1. ) using gene-specific primers and reagents (Applied Biosystems, Foster City, CA, USA) and the ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother. (Application Binary Interface) A specification for a specific hardware platform combined with the operating system. PRISM sequence detection system and software (Applied Biosystems). Briefly, total RNA (0.5 [micro]g) was reverse transcribed using 100 U M-MLV (Maloney murine leukemia virus The murine leukemia virus belongs to the gammaretroviral genus of the Retroviridae family of viruses, their hosts are vertebrates. It is a Type VI: positive sense ssRNA viruses that replicates through a DNA intermediate, reverse transcriptase. ) reverse transcriptase in a mixture with oligo-dT and dNTPs (deoxyribonucleotide deoxyribonucleotide /de·oxy·ri·bo·nu·cleo·tide/ (-noo´kle-o-tid) a nucleotide having a purine or pyrimidine base bonded to deoxyribose, which in turn is bonded to a phosphate group. triphosphates) according to the instructions provided with the Qiagen Omniscript kit (Qiagen, Valencia, CA, USA). Samples were reverse transcribed in a PTC-100 thermocycler (MJ Research Inc., Watertown, MA, USA) for 60 min at 44[degrees]C, and the reaction was terminated by heating to 95[degrees]C for 10 min. Expression of ERCC1 [excision repair cross-complementing Excision repair cross-complementing (ERCC) is a set of proteins which are involved in DNA repair. The genes include: ERCC1, ERCC2, ERCC3, ERCC4, ERCC5, ERCC6, and ERCC8. rodent repair deficiency, complementation Complementation (genetics) The complementary action of different genetic factors. The term usually implies two homologous chromosomes or chromosome sets, each defective because of mutation and unable by itself to promote the normal development or metabolism of group 1; GenBank gene ID 2067 (GenBank 2006)] was assessed by real-time PCR PCR polymerase chain reaction. PCR abbr. polymerase chain reaction Polymerase chain reaction (PCR) using 10 ng total RNA, 400 nM primers, 200 nM probe, and TaqMan Universal PCR Master Mix (Applied Biosystems). The sequence for the ERCC1 primer probe set is as follows: forward, CAGGACTTCGTCTCCCGGT; probe, TCTGGAACAGCTCATCGCCGCA; reverse, GCATAAGGCCAGATCTTCTCTTG. Relative quantitation was performed using a standard curve consisting of serial dilutions of pooled sample cDNA from the same source as the test RNA with each plate. Relative expression levels of each gene were normalized to 18s rRNA or GAPDH GAPDH Glyceraldehyde-3-Phosphate Dehydrogenase (also seen as G3PDH) (Applied Biosystems). Protein levels. We assessed the level of ERCC1 protein by immunoblotting immunoblotting, n the immunologic methods for isolating and quantitatively measuring immunoreactive substances. When used with immune reagents such as monoclonal antibodies, the process is known generically as Western blot analysis. using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis. ) to resolve proteins from whole-cell lysates. Lymphocytes were rinsed with ice-cold stop buffer (10 mM Tris-HCl, pH 7.4, 10 mM EDTA EDTA: see chelating agents. , 5 mM EGTA EGTA egtazic acid; a chelator similar in structure and function to EDTA (ethylenediaminetetraacetic acid) but with a higher affinity for calcium than for magnesium. , 100 mM NaF, 200 mM sucrose, 100 [micro]M Na-orthovanadate, 5 mM pyrophosphate pyrophosphate /py·ro·phos·phate/ (-fos´fat) a salt of pyrophosphoric acid. py·ro·phos·phate n. Abbr. PP A salt or ester of pyrophosphoric acid. , 4 [micro]g/mL leupeptin, 4 [micro]g/mL soybean trypsin inhibitor, 1 mM benzamidine, 20 [micro]M calpain cal·pain n. A proteolytic enzyme that is regulated by the concentration of calcium ions. [Probably cal(cium) + p(rote)a(se) + -in.] inhibitor 1, 100 mU/mL aprotinin aprotinin /apro·ti·nin/ (ap?ro-ti´nin) an inhibitor of proteolytic enzymes used to reduce perioperative blood loss in patients undergoing cardiopulmonary bypass during coronary artery bypass graft. , and 100 [micro]M phenylmethylsulfonyl-fluoride). The stop buffer was then replaced with a minimal volume of 2x SDSPAGE buffer (62.5 mM Tris-HCl, pH 6.8, 10% glycerol glycerol, glycerin, glycerine, or 1,2,3-propanetriol (prō`pāntrī'ŏl), CH2OHCHOHCH2OH, colorless, odorless, sweet-tasting, syrupy liquid. , 2% SDS 1. (company) SDS - Scientific Data Systems. 2. (tool) SDS - Schema Definition Set. , 5% [beta]-mercaptoethanol, 0.05% wt/vol bromophenol blue). The lysates were boiled for 5 min and clarified by centrifugation at 13,000 rpm for 10 min. Equal amounts of cell lysate ly·sate n. The cellular debris and fluid produced by lysis. were resolved by electrophoresis on 8-12% SDS-polyacrylamide gels. Electrophoresis was performed at constant voltage (200 V), and then the resolved proteins were transferred from the polyacrylamide gel to polyvinylidene difluoride membrane (PVDF PVDF polyvinylidene difluoride ; Immobilon-P; Millipore, Bedford, MA, USA) by semidry sem·i·dry adj. 1. Partially dry. 2. Moderately dry. Used of wine. transfer (Hoeffer Semiphor, San Francisco, CA, USA) for 1 hr at constant current (32 mA/minigel) using transfer buffer (25 mM Tris, 192 mM glycine glycine (glī`sēn), organic compound, one of the 20 amino acids commonly found in animal proteins. Glycine is the only one of these amino acids that is not optically active, i.e. , 20% vol/vol methanol, 0.01% SDS). To eliminate nonspecific interactions of antibodies with the membrane, the PVDF membrane was blocked with TTBS TTBS Trinidad & Tobago Bureau of Standards TTBS Tris-Buffered Saline (used for Western blot processing) TTBS Tris-Tween Buffered Saline (used for Western blot processing) (10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.05% Tween-20) containing 5% milk (wt/vol) for 1 hr at room temperature or overnight at 4[degrees]C. The membrane was incubated with the primary ERCC1 antibody (Neomarkers; Lab Vision Co., Fremont, CA, USA) diluted 1:200 in TTBS overnight at 4[degrees]C. The membrane was washed three times with TTBS and incubated with horseradish peroxidase-linked sheep anti-mouse IgG (1:2,000 in TTBS) (Amersham Pharmacia Biotech, Piscataway, NJ, USA) for 0.5-1 hr at room temperature. After three washes with TTBS, protein bands were visualized by enhanced chemiluminescence chemiluminescence /chemi·lu·mi·nes·cence/ (kem?i-loo?mi-nes´ens) luminescence produced by direct transformation of chemical energy into light energy. using the Renaissance system (NEN Nen, river, China Nen (nŭn) or Nonni (nôn`nē), river, 740 mi (1,191 km) long, rising in the Yilehuli (Ilkuri) Mts., N Heilongjiang prov. Life Sciences, Boston, MA, USA) and film (Lumi-Film; Roche Molecular Biochemicals, Indianapolis, IN, USA). DNA damage and repair assessment. The single-cell gel electrophoresis or comet assay is widely used to measure DNA damage and repair in primary human lymphocytes by measuring strand breaks and apurinic sites (Baltaci et al. 2002; De Silva et al. 2000; Rajaee-Behbahani et al. 2001; Schmezer et al. 2001). We divided the lymphocyte sample from each individual into parts to assess damage at several time points. We assessed baseline DNA damage levels as well as the capacity of the lymphocytes to repair damage induced by an in vitro challenge with 2-acetoxyacetylaminofluorene (2-AAAF; Midwest Research Institute Midwest Research Institute (MRI) is an independent, not-for-profit, contract research organization based in Kansas City, Missouri. MRI was established in Kansas City in 1944 to provide research and development for industry. , Kansas City, MO, USA), the reactive and genotoxic metabolite of 2-acetylaminofluorene. Alkaline-labile 2-AAAF adducts are primarily repaired through the nucleotide excision repair pathway (van Steeg 2001). Aliquots of lymphocytes were challenged for 2 hr in vitro with 4 [micro]M 2-AAAF. A subset of 2-AAAF-challenged lymphocytes were incubated for an additional 4 hr to allow for DNA repair of the lesions. Comet analysis was performed using materials and protocols from Trevigen Inc. (Gaithersburg, MD, USA). Briefly, cells were mixed with agarose and spread over a warmed, precoated microscope slide. The agarose was allowed to solidify for 30 min at 4[degrees]C, followed by immersion in prechilled lysis solution for 45 min or overnight. Next, the slides were placed in freshly prepared alkaline solution, pH > 13, for 30 min at room temperature. The slides were then washed twice by immersion in 1 x Tris-Borate-EDTA buffer for 5 min. Electrophoresis was carried out in alkaline buffer for 20 min at 1 V/cm (measured electrode to electrode) in the dark. Last, the slides were dipped into 70% ethanol for 5 min, allowed to dry completely, and stained with SYBR green (Trevigen). Image analysis of each cell was performed to quantify the length of the comet and the intensity of staining. All cells were analyzed using a fluorescence microscope coupled to the MD Biotech comet assay image analysis system (Morgantown, WV, USA). The Olive tail moment is a unitless measure of DNA damage that was calculated as described previously (Olive et al. 1990) using the quantity of migrated DNA multiplied by the distance between the comet head and the center of gravity of the DNA in the comet tail. The quantity of migrated DNA is the fraction of the DNA that has migrated from the head. The quantity of DNA is assessed as the DNA staining intensity subtracted from the background intensity. We scored the tail moment of all cells in a given well. Each point represents an average of 50 lymphocytes per individual (for human studies) or culture (for in vitro studies) from at least three to nine individuals or six cultures. Statistical analysis. We performed statistical analysis for gene expression and immunoblotting using analysis of variance with Newman-Keuls posttest, unpaired t-test, or linear regression procedures in GraphPad PRISM software (GraphPad Software Inc., San Diego, CA, USA). We considered p-values < 0.05 to be statistically significant. Statistical computations and graphics for comet analysis were performed using the S-Plus statistical package (version 6.2; Insightful Corporation, Seattle, WA, USA). We plotted the mean Olive tail moment with 95% confidence interval (CI) for each treatment group as a function of time. We performed an unpaired two-sided t-test to compare the low- and high-As groups at each time point. Linear regression was used to assess the slopes of the lines. Corresponding p-values are indicated. Results Demographic characteristics of the study populations are shown in Table 1. A larger percentage of the subjects in Mexico were female. In addition, the Mexican population tended to be younger, with a mean age of 37 years, compared to a mean age of 64 years in New Hampshire subjects. Approximately one-third of each population consisted of smokers. As shown in Figure 1, analysis of both As-exposed populations combined indicated that individuals exposed to drinking water As concentrations [greater than or equal to] 6 [micro]g/L (n = 11) had lower ERCC1 gene expression levels than those with < 6 [micro]g/L As (n = 42; p < 0.05). The Mexican population alone had a lower ERCC1 level among individuals exposed to As [greater than or equal to] 6 [micro]g/L, although this was not statistically significant. Likewise, a lower ERCC1 level was observed in the New Hampshire individuals exposed to [greater than or equal to] 6 [micro]g/L As (statistically significant at p < 0.05). We further assessed As exposure using available internal biomarkers of As level. However, different biomarkers were used in the two populations, which prevented pooling. Measurements included toenail As for the New Hampshire population and urinary As for the Mexican population. These markers correlate with drinking water As concentration (Karagas et al. 2000). Linear regression analysis of the New Hampshire population indicated an inverse association between toenail As levels and ERCC1 expression ([r.sup.2] = 0.4; p < 0.05). ERCC1 expression decreased with increasing inorganic urinary As level [As(III) + As(V)] but not total urinary As (which may include organic As), although this was not statistically significant ([r.sup.2] = 0.08; p = 0.3). In the New Hampshire population, we found no difference in ERCC1 expression level according to cancer status (p = 0.8). For both populations, ERCC1 expression did not significantly differ by smoking status, age, or sex (data not shown). We went on to investigate whether the decreased gene expression levels that we observed in lymphocytes of subjects exposed to As in New Hampshire translated to changes in protein levels. Immunoblots using an ERCC1 antibody indicated lower levels of ERCC1 protein among individuals exposed to drinking water As levels > 5 [micro]g/L (p < 0.05), although there was some interindividual variation in expression (representative blot shown in Figure 2A, quantification shown in Figure 2B). Additionally, we hypothesized that As exposure would be associated with correspondingly higher DNA damage levels and reduced DNA repair function. We analyzed human lymphocytes from a subset of New Hampshire residents exposed to low (< 0.7 [micro]g/L) or high ([greater than or equal to] 13-93 [micro]g/L) levels of drinking water As using the comet assay (Figure 3). We detected higher levels of DNA damage, as indicated by larger Olive tail moments, for lymphocytes analyzed at baseline from individuals exposed to high levels of drinking water As in vivo compared with those from lower level exposures (time 0 hr; p < 0.05). Analysis of these cells at 2 hr after 2-AAAF challenge demonstrated a dramatic increase in DNA damage but did not reveal any statistically significant differences in the amount of damage at 2 hr by As exposure status (p = 0.25). However, at the 6-hr time point, after the 4-hr repair period, significantly higher levels of DNA damage remained in lymphocytes from individuals exposed to high compared with low levels of As in vivo (p < 0.05) (Figure 4). Control lymphocytes that did not receive in vitro challenge showed similar levels of DNA damage at the 6-hr time point (Figure 4). The difference in slopes of the low- and high-As lines was not statistically significant. To further confirm the hypothesis that As exposure inhibits ERCC1 expression, we repeated these experimental treatments using a human lymphoblast cell line. As shown in Figure 5, As suppressed ERCC1 expression in the treated cells in a dose-responsive manner, beginning at the 0.1 [micro]M (~7 [micro]g/L) dose, with statistically significant decreases at [greater than or equal to] 1 [micro]M (p < 0.05) compared with unexposed controls. We further investigated the hypothesis that As exposure in vitro would decrease DNA repair function using the lymphoblast cell line. Arsenic-exposed and -unexposed cells had similar levels of baseline DNA damage at time 0 hr (Figure 6). Arsenic-exposed cells challenged with 2-AAAF for 2 hr showed significantly higher levels of DNA damage than did 2-AAAF-challenged cells that had not been exposed to As (time = 2 hr; p < 0.05; Figure 6). DNA damage for both As-exposed and -unexposed, 2-AAAF-challenged cells decreased during the 4-hr repair period (Figure 6). Nevertheless, DNA damage for As-exposed cells remained significantly higher than the nonexposed cells at the 6-hr time point (p < 0.05; Figure 6). Discussion Elucidating the mechanism of As carcinogenicity has been challenging, in part due to the dose, time, and species specificity of its biologic effects (Barchowsky et al. 1999; WHO 2001). Our early study (Andrew et al. 2003a) supported previous in vitro work showing disruption of DNA repair gene expression by As. In the present study, we extended our findings to two different human populations at the gene expression, protein, and DNA repair functional levels. Thus, our data provide both human in vivo and in vitro support for the hypothesis that As inhibits DNA repair processes (ATSDR 1999; Hartwig 1998) and that this has the potential to affect subsequent exposure to other genotoxic and mutagenic mutagenic inducing genetic mutation. agents. The effects of As on DNA damage and repair have been evaluated almost exclusively in experimental systems. Previous in vitro studies demonstrated that As specifically interferes with the repair of DNA photolesions (Yang et al. 1992) and cross-linking agents (Yager and Wiencke 1993). In another study using human fibroblasts, Hartwig et al. (1997) found that low (2.5 [micro]M) concentrations of arsenite reduced nucleotide excision repair efficiency, and incision frequency in particular, after UVR exposure. Results of additional studies in cultured human fibroblasts indicated that As exposure reduced DNA repair capacity and specifically inhibited the repair of UV-induced pyrimidine dimer-related DNA damage in lymphoblastoid cells as measured by the comet assay (Curnow et al. 2001; Danaee et al. 2004; Yager and Wiencke 1993). Differences in gene expression results between these in vitro studies may be explained by differences in As dose because the effects of As are highly dose dependent. In the present study, treatment of lymphocytes with > 1 [micro]M sodium arsenite in vitro decreased ERCC1 gene expression. The circulating levels of As achieved in mice after intraperitoneally administering 0.625 nM As/kg body weight are approximately equivalent to the 5 [micro]M in vitro dose and do not cause overt signs of toxicity (Soucy et al. 2003). In contrast, acutely toxic doses of As induced stress-response-pathway genes as well as ERCC1 gene expression in the livers of mice injected with 100-300 [micro]M As/kg body weight (Liu et al. 2001). Low concentrations of As induce cell proliferation, angiogenesis, hormone signaling, and nuclear factor [kappa]B-dependent transcription and do not appear to activate mitogen-activated protein kinase Mitogen-activated protein (MAP) kinases (EC 2.7.11.24) are serine/threonine-specific protein kinases that respond to extracellular stimuli (mitogens) and regulate various cellular activities, such as gene expression, mitosis, differentiation, and cell survival/apoptosis. (MAPK MAPK Mitogen-Activated Protein Kinase MAPK Map Kinase ) signaling or other stress response pathways. In contrast, high doses of As induce apoptosis and activate MAPKs, extracellular signal-regulated kinase (ERK ERK Extracellular Signal-Regulated Kinase ERK Electronic Records Keeping ERK Externally Regulated Kinases ), and p-38, as well as stress-mimetic and heat-shock-mimetic responses, inhibition of proliferation, and apoptosis (Barchowsky et al. 1999). Although decreased expression of ERCC1 may be partly responsible for the decreased DNA repair function associated with As exposure, we recognize that other pathway members may be involved, and future investigation will be needed to elucidate all factors involved. Because other environmental and genetic factors can influence DNA repair, we would not expect complete concordance between As exposure and expression or function on an individual level. Nevertheless, our in vitro studies demonstrate the effects of As within a controlled experimental system. Further work is needed to identify genotypes that modify the influence of As exposure on DNA repair. In a human population, we previously found that drinking water As exposure at levels between 5 and 75 [micro]g/L was associated with decreased mRNA expression of nucleotide excision repair pathway genes in lymphocytes from exposed individuals (Andrew et al. 2003a). Based on those preliminary results, we then followed up with the present study, which uses a larger human population in New Hampshire. In addition to enlarging the sample size, examination of a second population in Mexico exposed to moderate levels of As, supported our New Hampshire population results. Although we observed decreased ERCC1 expression in both populations, the difference was not statistically significant in the Mexican population. The New Hampshire study had more extreme levels of exposure (Mexico, 5.5-43 [micro]g/L; New Hampshire, 0.007-75 [micro]g/L), but more likely the Mexico study had a smaller sample size and lacked statistical power. To our knowledge, no other studies have evaluated the association between As exposure and DNA repair gene expression or protein levels in human populations, particularly at As levels that are in the range that is routinely found in the United States. In addition, our comet analysis provides functional DNA repair data in an As-exposed human population. These data support previous observations of decreased DNA repair capacity after As exposure in vitro (Hartwig 1998). Arsenite has been shown to inhibit DNA repair and act as a cogenotoxin for the direct-acting alkylating agent methyl methane-sulfonate, the indirect-acting PAH BaP, and UV-induced pyrimidine dimers in white blood cells White blood cells A group of several cell types that occur in the bloodstream and are essential for a properly functioning immune system. Mentioned in: Abscess Incision & Drainage, Bone Marrow Transplantation, Complement Deficiencies and fibroblasts (Curnow et al. 2001; Danaee et al. 2004; Hartmann and Speit 1996; Okui and Fujiwara 1986). As observed by Danaee et al. (2004) in a previous study, our in vitro As exposure appeared to inhibit the fast component of DNA repair because the difference is observable after challenge (Figure 6, time = 2 hr). This difference in DNA migration remained significantly higher in the As-exposed group after the repair period (Figure 6, time = 6 hr). Thus, our study and others consistently report that As exacerbates DNA damage induced by other mutagens. Whether inorganic As can directly induce DNA damage by itself is more controversial, and previous studies of DNA damage and mutagenesis by physiologic levels of inorganic As have been inconsistent (Mass et al. 2001; Schwerdtle et al. 2003; Sordo et al. 2001; Yih and Lee 2000). Our in vitro comet data did not show an increase in DNA migration after 24 hr treatment with 1 [micro]M As alone (Figure 6, time = 0 hr), but we did observe higher DNA damage levels at baseline in cells harvested from individuals exposed to drinking water As at levels [greater than or equal to] 13 [micro]g/L compared to those with low levels of As (< 1 [micro]g/L). The basis for this increase remains to be determined; however, higher levels of DNA damage in these lymphocytes after 2-AAAF challenge, and the slower repair kinetics of this damage, suggest that the higher baseline levels may be a result of As-inhibited repair and exposure to other DNA-damaging agents. In summary, our in vitro studies of As exposure and our novel work using in vivo As exposure in two human populations support the hypothesis that As exposure decreases DNA repair capacity. Further, our data demonstrate decreased expression of the nucleotide excision repair pathway member ERCC1 and decreased repair after 2-AAAF challenge. These results support the theory that As can act through a cocarcinogenic mechanism of action, exacerbating the genotoxicity and mutagenicity of other compounds. REFERENCES Abernathy CO, Liu YP, Longfellow D, Aposhian HV, Beck B, Fowler B, et al. 1999. Arsenic: health effects, mechanisms of actions, and research issues. Environ Health Perspect 107:593-597. Andrew AS, Karagas MR, Hamilton JW. 2003a. Decreased DNA repair gene expression among individuals exposed to arsenic in United States drinking water. Int J Cancer 104:263-268. Andrew AS, Warren AJ, Barchowsky A, Temple KA, Klei L, Soucy NV, et al. 2003b. Genomic and proteomic profiling of responses to toxic metals in human lung cells. Environ Health Perspect 111:825-835. ATSDR. 1999. Toxicological Profile for Arsenic. Atlanta, GA:Agency for Toxic Substances and Disease Registry. Baltaci V, Kayikcioglu F, Alpas I, Zeyneloglu H, Haberal A. 2002. Sister chromatid exchange Sister chromatid exchange is the exchange of genetic material between two identical sister chromatids. It was firstly discovered by using giemsa staining method on one chromatid belonging to the sister chromatid complex before anaphase in mitosis. rate and alkaline comet assay scores in patients with ovarian cancer. Gynecol Oncol 84:62-66. Barchowsky A, Roussel RR, Klei LR, James PE, Ganju N, Smith KR, et al. 1999. Low levels of arsenic trioxide stimulate proliferative signals in primary vascular cells without activating stress effector effector /ef·fec·tor/ (e-fek´ter) 1. an agent that mediates a specific effect. 2. an organ that produces an effect in response to nerve stimulation. pathways. Toxicol Appl Pharmacol 159:65-75. Cheng T, Morris J, Koirtyohann S, Spate V, Baskett C. 1995. Study of the correlation of trace elements in carpenter's toenails. J Radioanal Cucl Chem 195:31-42. Curnow A, Salter L, Morley N, Gould D. 2001. A preliminary investigation of the effects of arsenate ar·se·nate n. A salt of arsenic acid. arsenate an uncommon garden pesticide, as lead arsenate, or as antifungal spray on fruit trees or cattle tick dip as sodium arsenate. on irradiation-induced DNA damage in cultured human lung fibroblasts. J Toxicol Environ Health A 63:605-616. Danaee H, Nelson HH, Liber H, Little JB, Kelsey KT. 2004. Low dose exposure to sodium arsenite synergistically syn·er·gis·tic adj. 1. Of or relating to synergy: a synergistic effect. 2. Producing or capable of producing synergy: synergistic drugs. 3. interacts with UV radiation to induce mutations and alter DNA repair in human cells. Mutagenesis 19:143-148. De Silva IU, McHugh PJ, Clingen PH, Hartley JA. 2000. Defining the roles of nucleotide excision repair and recombination in the repair of DNA interstrand cross-links in mammalian cells. Mol Cell Biol 20:7980-7990. GenBank. 2006. Entrez Gene. Available: http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene [accessed 5 June 2006]. Hartmann A, Speit G. 1996. Effect of arsenic and cadmium on the persistence of mutagen-induced DNA lesions in human cells. Environ Mol Mutagen mutagen: see mutation. mutagen Any agent capable of altering a cell's genetic makeup by changing the structure of the hereditary material, DNA. Many forms of electromagnetic radiation (e.g. 27:98-104. Hartwig A. 1998. Carcinogenicity of metal compounds: possible role of DNA repair inhibition. Toxicol Lett 102-103:235-239. Hartwig A, Groblinghoff UD, Beyersmann D, Natarajan AT, Filon R, Mullenders LH. 1997. Interaction of arsenic(III) with nucleotide excision repair in UV-irradiated human fibroblasts. Carcinogenesis 18:399-405. IARC (International Agency for Research on Cancer). 2004. Arsenic in drinking-water. IARC Monogr Eval Carcinog Risks Hum 84:39-267. Karagas MR, Stukel TA, Morris JS, Tosteson TD, Weiss JE, Spencer SK, et al. 2001. Skin cancer risk in relation to toenail arsenic concentrations in a US population-based case-control study. Am J Epidemiol 153:559-565. Karagas MR, Tosteson TD, Blum J, Klaue B, Weiss JE, Stannard V, et al. 2000. Measurement of low levels of arsenic exposure: a comparison of water and toenail concentrations. Am J Epidemiol 152:84-90. Karagas MR, Tosteson TD, Blum J, Morris JS, Baron JA, Klaue B. 1998. Design of an epidemiologic study of drinking water arsenic exposure and skin and bladder cancer risk in a U.S. population. Environ Health Perspect 106(suppl 4):1047-1050. Karagas MR, Tosteson TD, Morris JS, Demidenko E, Mott LA, Heaney J, et al. 2004. Incidence of transitional cell carcinoma tran·si·tion·al cell carcinoma n. A malignant neoplasm derived from transitional epithelium and occurring primarily in the urinary bladder, ureters, or renal pelvises. transitional cell carcinoma Bladder cancer, see there of the bladder and arsenic exposure in New Hampshire. Cancer Causes Control 15:465-472. Liu J, Kadiiska MB, Liu Y, Lu T, Qu W, Waalkes MP. 2001. Stress-related gene expression in mice treated with inorganic arsenicals. Toxicol Sci 61:314-320. Mass MJ, Tennant A, Roop BC, Cullen WR, Styblo M, Thomas DJ, et al. 2001. Methylated meth·yl·ate n. An organic compound in which the hydrogen of the hydroxyl group of methyl alcohol is replaced by a metal. tr.v. meth·yl·at·ed, meth·yl·at·ing, meth·yl·ates 1. trivalent trivalent /tri·va·lent/ (tri-va´lent) having a valence of three. tri·va·lent adj. Having valence 3. tri·va arsenic species are genotoxic. Chem Res Toxicol 14:355-361. Meza MM, Kopplin MJ, Burgess JL, Gandolfi AJ. 2004. Arsenic drinking water exposure and urinary excretion among adults in the Yaqui Valley, Sonora, Mexico. Environ Res 96:119-126. Meza MM, Yu L, Rodriguez YY, Guild M, Thompson D, Gandolfi AJ, et al. 2005. Developmentally restricted genetic determinants of human arsenic metabolism: association between urinary methylated arsenic and CYT19 polymorphisms in children. Environ Health Perspect 113:775-781. National Research Council. 2001. Arsenic in Drinking Water. Washington, DC:National Academy Press. Okui T, Fujiwara Y. 1986. Inhibition of human excision DNA repair by inorganic arsenic and the co-mutagenic effect in V79 Chinese hamster cells. Mutat Res 172:69-76. Olive PL, Banath JP, Durand RE. 1990. Heterogeneity in radiation-induced DNA damage and repair in tumor and normal cells measured using the "comet" assay. Radiat Res 122:86-94. Peters SC, Blum J, Klaue B, Karagas MR. 1999. Arsenic occurrence in New Hampshire groundwater. Environ Sci Technol 33:1328-1333. Rajaee-Behbahani N, Schmezer P, Risch A, Rittgen W, Kayser KW, Dienemann H, et al. 2001. Altered DNA repair capacity and bleomycin bleomycin /ble·o·my·cin/ (ble-o-mi´sin) a polypeptide antibiotic mixture obtained from cultures of Streptomyces verticellus; used as the sulfate salt as an antineoplastic. ble·o·my·cin n. sensitivity as risk markers for non-small cell lung cancer Lung Cancer, Non-Small Cell Definition Non-small cell lung cancer (NSCLC) is a disease in which the cells of the lung tissues grow uncontrollably and form tumors. Description There are two kinds of lung cancers, primary and secondary. . Int J Cancer 95:86-91. Rossman TG. 2003. Mechanism of arsenic carcinogenesis: an integrated approach. Mutat Res 533:37-65. Schmezer P, Rajaee-Behbahani N, Risch A, Thiel S, Rittgen W, Drings P, et al. 2001. Rapid screening assay for mutagen sensitivity and DNA repair capacity in human peripheral blood lymphocytes Peripheral Blood Lymphocytes (PBL): These are the mature lymphocytes (small white immune cells) that are found circulating in the blood, as opposed to organs, such as the lymph nodes, spleen, thymus, liver or bone marrow. These cells consist of T cells, NK cells and B cells. . Mutagenesis 16:25-30. Schwerdtle T, Walter I, Mackiw I, Hartwig A. 2003. Induction of oxidative DNA damage by arsenite and its trivalent and pentavalent pentavalent having a valence of five. pentavalent antimony compounds see antimony. pentavalent organic arsenicals includes the pharmaceuticals arsanilic acid, roxarsone, nitarsone. See also organic arsenical. methylated metabolites in cultured human cells and isolated DNA. Carcinogenesis 24:967-974. Sordo M, Herrera LA, Ostrosky-Wegman P, Rojas E. 2001. Cytotoxic and genotoxic effects of As, MMA (Microcomputer Managers Association, Inc.) A membership organization with chapters throughout the U.S. that was devoted to educating personnel responsible for personal computers. It disbanded in 1996. Mma - A fast Mathematica-like system, in Allegro CL by R. Fateman, 1991. , and DMA (1) (Digital Media Adapter) See digital media hub. (2) (Document Management Alliance) A specification that provides a common interface for accessing and searching document databases. on leukocytes and stimulated human lymphocytes. Teratog Carcinog Mutagen 21:249-260. Soucy NV, Ihnat MA, Kamat CD, Hess L, Post MJ, Klei LR, et al. 2003. Arsenic stimulates angiogenesis and tumorigenesis tumorigenesis /tu·mor·i·gen·e·sis/ (-jen´e-sis) oncogenesis. tu·mor·i·gen·e·sis n. Formation or production of tumors. in vivo. Toxicol Sci 76:271-279. Tran HP, Prakash AS, Barnard R, Chiswell B, Ng JC. 2002. Arsenic inhibits the repair of DNA damage induced by benzo(a)pyrene. Toxicol Lett 133:59-67. U.S. EPA (U.S. Environmental Protection Agency). 2001. National primary drinking water regulations; arsenic and clarifications to compliance and new source contaminants monitoring; final rule. Fed Reg 66(14):6975-7066. U.S. EPA (U.S. Environmental Protection Agency). 2002. National Primary Drinking Water Regulations: Inorganic Chemical Sampling and Analytical Requirements. 40CFR CFR See: Cost and Freight 141.23. van Steeg H. 2001. The role of nucleotide excision repair and loss of p53 in mutagenesis and carcinogenesis. Toxicol Lett 120:209-219. Wei Q, Matanoski GM, Farmer ER, Hedayati MA, Grossman L. 1994. DNA repair and susceptibility to basal cell carcinoma basal cell carcinoma n. A slow-growing, locally invasive, but rarely metastasizing neoplasm of the skin derived from basal cells of the epidermis or hair follicles. Also called basal cell epithelioma. : a case-control study. Am J Epidemiol 140:598-607. WHO. 2001. Arsenic and Arsenic Compounds. Environmental Health Criteria 224. 2nd ed. Geneva Geneva, canton and city, Switzerland Geneva (jənē`və), Fr. Genève, canton (1990 pop. 373,019), 109 sq mi (282 sq km), SW Switzerland, surrounding the southwest tip of the Lake of Geneva. :World Health Organization. Available: http://www.who.int/ipcs/publications/ehc/ehc_224/en/ [accessed 6 June 2006]. Yager JW, Wiencke JK. 1993. Enhancement of chromosomal damage by arsenic: implications for mechanism. Environ Health Perspect 101(suppl 3):79-82. Yang JL, Chen MF, Wu CW, Lee TC. 1992. Posttreatment with sodium arsenite alters the mutational spectrum induced by ultraviolet light irradiation in Chinese hamster ovary cells. Environ Mol Mutagen 20:156-164. Yih LH, Lee TC. 2000. Arsenite induces p53 accumulation through an ATM-dependent pathway in human fibroblasts. Cancer Res 60:6346-6352. Angeline S. Andrew, (1) Jefferey L. Burgess, (2) Maria M. Meza, (3) Eugene Demidenko, (1) Mary G. Waugh, (1) Joshua W. Hamilton, (4) and Margaret R. Karagas (1) (1) Department of Community and Family Medicine, Section of Biostatistics and Epidemiology, Dartmouth Medical School Dartmouth Medical School is the medical school of Dartmouth College, in Hanover, New Hampshire. The school is closely affiliated with Dartmouth-Hitchcock Medical Center (DHMC) in neighboring Lebanon, New Hampshire. , Lebanon, New Hampshire
Lebanon (pronounced by natives as IPA: /ˈlεbənɨn/ or , USA; (2) Department of Environmental and Community Health, University of Arizona, Tucson, Arizona, USA; (3) Department of Natural Resources Many sub-national governments have a Department of Natural Resources or similarly-named organization:
Address correspondence to A.S. Andrew, Dartmouth Medical School, Section of Biostatistics and Epidemiology, 7927 Rubin 860, One Medical Center Dr., Lebanon, NH 03756 USA. Telephone: (603) 653-9019. Fax: (603) 653-9093. E-mail: Angeline.Andrew@dartmouth.edu Funding was provided by the National Institutes of Health [NIH; CA099500, CA82354, and CA57494 from the National Cancer Institute and ES00002, ES05947, RR018787, ES06694, and ES07373 from the National Institute of Environmental Health Sciences The National Institute of Environmental Health Sciences (NIEHS) is one of 27 Institutes and Centers of the National Institutes of Health (NIH),which is a component of the Department of Health and Human Services (DHHS). The Director of the NIEHS is Dr. David A. Schwartz. (NIEHS NIEHS National Institute of Environmental Health Sciences (NIH, DHHS) )], the Dartmouth and Arizona Superfund Programs, and the American Society of Preventive Oncology (ASPO ASPO Association for the Study of Peak Oil&Gas ASPO American Society of Pediatric Otolaryngology ASPO American Society of Preventive Oncology ASPO Army Space Program Office ASPO Associatie Sociaal Psychologische Onderzoekers (Netherlands) ). The contents of this article are solely the responsibility of the authors and do not necessarily represent the official views of the NIEHS, NIH, or ASPO. The authors declare they have no competing financial interests. Received 12 January 2006; accepted 10 May 2006.
Table 1. Percentage of the New Hampshire and Mexican populations with
the selected characteristics.
New Hampshire Mexico Combined
(n = 37) (n = 16) (n = 53)
Sex
Male 73 44 64
Female 27 56 36
Age (years)
[less than or equal to] 50 8 81 30
> 50 92 19 70
Current smoking
Yes 32 38 34
No 68 62 66
Water As ([micro]g/L)
[less than or equal to] 6 89 56 79
> 6 11 44 21
|
|
||||||||||||||||||

Printer friendly
Cite/link
Email
Feedback
Reader Opinion