Printer Friendly
The Free Library
19,604,530 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Arcobacter butzleri: underestimated enteropathogen.


Molecular methods applied to 2,855 strains of Campylobacter-like organisms received from a surveillance network of Campylobacter Campylobacter

Genus of gram-negative spiral-shaped bacteria infecting mammals. Many species, especially C. fetus, cause miscarriage in sheep and cattle. C. jejuni is a common cause of food poisoning. Sources include meats (particularly chicken) and unpasteurized milk.
 infections in France identified 29 Arcobacter butzleri infections. This species ranks fourth for Campylobacteraceae isolation and appears to have the same pathogenic potential as the other species in the genus.

**********

Kiehlbauch et al. (1) originally described the species Arcobacter butzleri, previously named Campylobacter butzleri (1), after studying aerotolerant Campylobacter strains from human and veterinary sources. The genus Arcobacter was created in 1992 (2).

A. butzleri is found in environmental samples, and untreated water appears to be a potential source of infection. In industrialized in·dus·tri·al·ize  
v. in·dus·tri·al·ized, in·dus·tri·al·iz·ing, in·dus·tri·al·iz·es

v.tr.
1. To develop industry in (a country or society, for example).

2.
 countries, the most important source of human contamination may be food. Indeed, A. butzleri has been isolated in different breeding animals and is present in a great variety of retail meats, including chicken, beef, pork, and lamb, with a high prevalence in poultry (3).

Although the prevalence of this bacterium in animals and food specimens is well documented, including the first publication by Kiehlbauch et al. that implied this newly described species could be an important human pathogen, only a few reports of human infections are found, and most of them were published before 1995. In the Far East, Taylor et al. formally identified A. butzleri in 2.4% of diarrheal stool samples collected from Thai children (4), and more recently, 2 bacteremia bacteremia: see septicemia.
bacteremia

Presence of bacteria in the blood. Short-term bacteremia follows dental or surgical procedures, especially if local infection or very high-risk surgery releases bacteria from isolated sites.
 cases were reported in Taiwan and Hong Kong in patients with an underlying disease (liver cirrhosis liver cirrhosis
(sirō´sis),
n a degenerative disease of the liver in which hepatic tissue is replaced with connective tissue, commonly a result of chronic alcoholism. See jaundice.
 and gangrenous gangrenous

pertaining to, marked by, or of the nature of gangrene.


gangrenous cellulitis
gangrenous necrosis of the skin of the thorax and thighs of chickens of 1 to 4 months of age caused by Clostridium septicum
 appendicitis Appendicitis Definition

Appendicitis is an inflammation of the appendix, which is the worm-shaped pouch attached to the cecum, the beginning of the large intestine. The appendix has no known function in the body, but it can become diseased.
, respectively) (5, 6). In a South African study, 15 A. butzleri were identified among 3,877 Campylobacteraceae strains isolated from children's diarrheic stools (7). Reports from Europe are scarce: an outbreak of recurrent abdominal cramps in 10 patients in Italy (8), bacteremia in a newborn in the United Kingdom (9), and 2 cases of severe diarrhea in Germany (10). The recent publication of Vandenberg et al. from Belgium used an Arcobacter-selective medium for stool specimens and found that A. butzleri ranked fourth among Campylobacter spp. and Campylobacter-like organisms (11), which stimulated interest to revisit the role of Arcobacter spp. as an agent of enteric enteric /en·ter·ic/ (en-ter´ik) within or pertaining to the small intestine.

en·ter·ic
adj.
1. Of, relating to, or within the intestine.

2.
 infection.

In this study, our goal was to investigate the prevalence of A. butzleri with a different approach and to describe the clinical features of A. butzleri infection. We used molecular methods to identify Campylobacter-related organisms collected from a network of clinical laboratories that do not use specific Arcobacter-selective medium. The results nevertheless showed that this bacterium ranks fourth among these organisms.

The Study

The French surveillance network of human Campylobacter infections is composed of laboratories selected on a voluntary basis (12). The laboratories are randomly located throughout France; 93 are hospital laboratories, and 338 are private laboratories. They send their clinical Campylobacter isolates to the National Reference Center with a completed information sheet concerning the patient and epidemiologic data. The study period was from July 2002 to December 2003, and 2,855 Campylobacter-like strains were studied. In addition to standard phenotypic identification, specific polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) assays were carried out to identify C. jejuni, C. coli, or C. fetus (13); other isolates were identified by comparing 2 sequences of 400 bp located at both extremities of a 1,100-bp fragment of the beginning of the 16S rRNA gene amplified with primers F2-16S-CHPEC (ATCCTGGCTCAGAGTGAACG) and R2-16S-CHPEC (AAGGGCCATGATGACTTGAC) with those of DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 databases by using the BLAST program (http://www.ncbi.nlm.nih.gov/blast/). An identification at the species level was regarded as correct when >99% identity was seen with only 1 species. The species distribution from stool samples was as follows: 2,114 C. jejuni (78.9%), 486 C. coli (18.1%), 36 C. fetus (1.3%), 27 A. butzleri (1.0%), 8 C. lari la·ri  
n. pl. lari
See Table at currency.



[Georgian.]

Noun 1. lari - the basic unit of money in Georgia
Georgian monetary unit - monetary unit in Georgia
 (0.3%), 4 C. upsaliensis (0.1%), 2 C. hyointestinalis, and 1 Helicobacter canadensis. From 177 nonstool samples, we detected 2 A. butzleri.

Almost the entire 16S rRNA gene, 1,450 bp, was sequenced for 9 A. butzleri to study its homogeneity because only 5 sequences are in the databank (accession nos. AF314538, AY621116, L14626, U34386, U34388). The intraspecies in·tra·spe·cif·ic   also in·tra·spe·cies
adj.
Arising or occurring within a species: intraspecific competition.

Adj. 1.
 variability was only 0.4% (6/1,430 bp) among the 14 A. butzleri sequences. Comparison of these sequences with those of 4 A. cryaerophilus (AY314755, L14624, U34387, U25805), 1 A. skirrowii (L14625), and 1 A. nitrofigilis (L14627) showed that interspecies variability concerned 14 bp out of 1,430. The Arcobacter sequences differed considerably from those of Campylobacter spp., with only 86.2% identity with C. coli (AY621115) and 85.6% identity with C. fetus (AY621110), 2 species that can be phenotypically confounded with A. butzleri.

Twenty-seven of the 29 A. butzleri strains were isolated from feces of patients with gastroenteritis gastroenteritis: see enteritis.
gastroenteritis

Acute infectious syndrome of the stomach lining and intestines. Symptoms include diarrhea, vomiting, and abdominal cramps.
, whereas 1 strain was isolated from peritonitis peritonitis (pĕr'ĭtənī`tĭs), acute or chronic inflammation of the peritoneum, the membrane that lines the abdominal cavity and surrounds the internal organs.  pus pus, thick white or yellowish fluid that forms in areas of infection such as wounds and abscesses. It is constituted of decomposed body tissue, bacteria (or other micro-organisms that cause the infection), and certain white blood cells.  and another from a blood culture specimen. The 27 Arcobacter strains from stools were isolated in 23 different laboratories. Most of them (n = 15) used Campylosel (bioMerieux, Marcy l'Etoile, France) incubated at 37[degrees]C for 2 to 3 days. Six used Karmali agar incubated at 37[degrees]C for 3 to 4 days. The last 2 used Butzler medium and the filtration method, respectively. None of these infections was part of an outbreak. Of the 16 patients with travel information available, only 1 indicated a recent trip, to Turkey. An associated pathogenic organism was described in 1 of 15 cases, but the nature of the associated organism is unknown. Seventeen of the 29 patients were hospitalized. Their age range was 1-89 years, with an average of 54 years. Seventeen patients (59%) were male. Detailed clinical information was obtained for 19 patients and is shown in the Table. Eighteen of 19 patients had diarrhea, including the patient with bacteremia; 11 of 15 had abdominal pain; 4 of 15 had bloody stools, including the patient with A. butzleri bacteremia; 2 of 14 patients vomited; and 5 of 17 patients had fever. Acute renal failure acute renal failure Acute kidney failure Nephrology An abrupt decline in renal function, triggered by various processes–eg, sepsis, shock, trauma, kidney stones, drug toxicity-aspirin, lithium, substances of abuse, toxins, iodinated radiocontrast.  developed in 2 patients, 1 associated with pyelonephritis pyelonephritis: see nephritis.
pyelonephritis

Infection (usually bacterial) and inflammation of kidney tissue and the renal pelvis. Acute pyelonephritis is usually localized and may have no apparent cause.
. Concerning the 17 other cases for which information was available, severe clinical symptoms (anorexia, weight loss, asthenia asthenia /as·the·nia/ (as-the´ne-ah) lack or loss of strength and energy; weakness.

neurocirculatory asthenia
) were described for 10 patients.

The duration of symptoms without treatment was variable, from 2 days to several weeks. Antimicrobial drug therapy was administered in 5 cases, and infection was eradicated a few days later (Table). In all cases, the strains were susceptible to the antimicrobial agent used (amoxicillin amoxicillin /amox·i·cil·lin/ (ah-mok?si-sil´in) a semisynthetic derivative of ampicillin effective against a broad spectrum of gram-positive and gram-negative bacteria.

a·mox·i·cil·lin
n.
, ofloxacin, ciprofloxacin ciprofloxacin /cip·ro·flox·a·cin/ (sip?ro-flok´sah-sin) a synthetic antibacterial effective against many gram-positive and gram-negative bacteria; used as the hydrochloride salt.

cip·ro·flox·a·cin
n.
 [twice], amoxicillin-clavulanate).

Conclusions

During an 18-month period, 2,855 strains of Campylobacter-like organisms were identified at the species level by using phenotypic and molecular tools. Molecular methods permitted the identification of 29 A. butzleri, i.e., 1% of the strains studied and also 1% of the 2,678 isolates from stools, which makes this species the fourth most frequently isolated Campylobacteraceae in human clinical samples in France, before C. lari and C. upsaliensis but after C. jejuni, C. coli, and C. fetus. Our results agree with those of Vandenberg et al. (11) who also found A. butzleri in fourth position for Campylobacter-like isolates from stool specimens. However, their results were obtained in a different context: only 1 laboratory was involved for 8 years, and a specific Arcobacter-selective medium was used. A study conducted in Denmark by Engberg et al. (14), also to estimate the prevalence of Campylobacter spp. and related bacteria in human fecal samples, did not produce the same results; only 1 A. butzleri was isolated out of 1,376 samples, and no C. lari or C. upsaliensis was recovered. The differences between these 3 studies could be explained by differences in geographic distribution of the species, but the difference in isolation methods (selective agar in the Belgian study) or in identification methods (molecular methods in our study) is likely the critical point. While not optimal, Campylobacter-selective agars, especially Campylosel, appear to allow the growth of A. butzleri. For the other media, a longer incubation period incubation period
n.
1. See latent period.

2. See incubative stage.


Incubation period 
 seems necessary. The role of A. butzleri in enteric infections is not definitively proven, but its involvement is likely. In at least 14 of 15 cases, no other enteropathogen en·ter·o·path·o·gen
n.
An organism that is capable of producing intestinal disease.



enter·o·path
 was detected. In 1 case, a bacteremia with an enteric infection was found. These data are similar to those observed with C. jejuni infection. Isolation of A. butzleri is more frequent than well-known enteropathogenic enteropathogenic

having pathogenicity for the intestine.


enteropathogenic Escherichia coli
strains of E. coli which cause enteritis by close association with enteric cells. Includes attaching and effacing E. coli.
 Campylobacter spp., e.g., C. upsaliensis and C. lari, when adequate identification is carried out. The prevalence of A. butzleri may be underestimated because of false identification as C. coli or C. fetus. Indeed nearly all of the strains are able to grow at 25[degrees]C, like C. fetus, but are resistant to cephalothin cephalothin

a first generation cephalosporin antibiotic. Sensitive organisms include many penicillin-resistant staphylococci.

cephalothin Cefalotin® Infectious disease A parenteral semisynthetic derivative of cephalosporin C, and 3
 like C. coli. We found that nearly all of the strains were resistant to nalidixic acid nalidixic acid /nal·i·dix·ic ac·id/ (nal-i-dik´sik) a synthetic antibacterial agent used in the treatment of genitourinary infections caused by gram-negative organisms.

na·li·dix·ic acid
n.
 (4 had an intermediary resistance) and susceptible to ciprofloxacin with the disk diffusion method. The choice of a simple method for testing these drugs allows it to be used routinely in clinical laboratories to differentiate such strains phenotypically.

Nevertheless, molecular biology molecular biology, scientific study of the molecular basis of life processes, including cellular respiration, excretion, and reproduction. The term molecular biology was coined in 1938 by Warren Weaver, then director of the natural sciences program at the Rockefeller  is a powerful tool for diagnosis. We used a 16S rRNA gene sequencing as a global approach for strains that were not C. jejuni, C. coli, or C. fetus. We confirmed that the intraspecies variability of A. butzleri 16S rRNA gene sequences is low (0.4%), lower than that found for C. coli (1.5%) or C. lari (2.5%) (15), and that interspecies variability is high. This approach, which is expensive and difficult to implement, is not accessible to a routine laboratory, but simple phenotypic tests can be applied to detect these microorganisms. The combination of phenotypic tests and selective agar medium will determine the real incidence of A. butzleri infection, which will add evidence that A. butzleri is an etiologic agent of diarrhea. A determination of the prevalence of A. butzleri in normal stool will also help establish the prevalence of this organism in diarrheal stool.

Acknowledgments

We thank the laboratories participating in our network in France for sending their Campylobacter strains to the National Reference Center for Campylobacters and Helicobacters.

References

(1.) Kiehlbauch JA, Brenner DJ, Nicholson MA, Baker CN, Patton CM, Steigerwalt AG, et al. Campylobacter butzleri sp. nov. isolated from humans and animals with diarrheal illness. J Clin Microbiol. 1991;29:376-85.

(2.) Vandamme P, Vancanneyt M, Pot B, Mels L, Hoste B, Dewettinck D, et al. Polyphasic taxonomic study of the emended e·mend  
tr.v. e·mend·ed, e·mend·ing, e·mends
To improve by critical editing: emend a faulty text.
 genus Arcobacter with Arcobacter butzleri comb. nov. and Arcobacter skirrowii sp. nov., an aerotolerant bacterium isolated from veterinary specimens. Int J Syst Bacteriol. 1992;42:344-56.

(3.) Houf K, De Zutter L, Verbeke B, Van Hoof J, Vandamme P. Molecular characterization of Arcobacter isolates collected in a poultry slaughterhouse slaughterhouse: see abattoir; meatpacking. . J Food Prot. 2003;66:364-9.

(4.) Taylor DN, KiehIbauch JA, Tee W, Pitarangsi C, Echeverria P. isolation of group 2 aerotolerant Campylobacter species from Thai children with diarrhea. J Infect Dis. 1991; 163:1062-7.

(5.) Yan JJ, Ko WC, Huang AH, Chen HM, Jin YT, Wu JJ. Arcobacter butzleri bacteremia in a patient with liver cirrhosis. J Formos Med Assoc. 2000;99:166-9.

(6.) Lau SKP SKP Suomen Kommunistinen Puolue (Communist Party of Finland)
SKP Sveriges Kommunistiska Parti (Communist Party of Sweden)
SKP Sisemajanduse Koguproduktist (Estonian) 
, Woo PCY PCY Per Calendar Year
PCY Powel Crosley, Jr. YMCA (Cincinnati, Ohio)
PCY Pounds per Cubic Yard
PCY Paradise Canyon Elementary School (La Canada, CA)
PCY Pittsburgh, Chartiers, & Youghiogheny Railway Company
, Teng JLL JLL Jones Lang LaSalle (real estate service and investment management firm)
JLL Junior League of London
JLL Junior League of Louisville
JLL Joint Lessons Learned
JLL Junior League of Lincoln
JLL Junior League of Lynchburg
, Leung KW, Yuen KY. Identification by 16S ribosomal RNA ribosomal RNA
n.
See rRNA.


ribosomal RNA (rī´bōsō´m
 gene sequencing of Arcobacter butzleri bacteraemia bacteraemia

see bacteremia.
 in a patient with acute gangrenous appendicitis. Mol Pathol. 2002;55:182-5.

(7.) Lastovica AJ, Skirrow MB. Clinical significance of Campylobacter and related species other than Campylobacter jejuni Campylobacter jejuni Vibrio jejuni, Campylobacter fetus ssp jejuni A curved or spiral gram-negative bacillus with a single polar flagellum Epidemiology Linked to contact with domestic and farm animals, unpasteurized milk, primates, day care  and C. coli. In: Nachamkin I, Blaser MJ, editors. Campylobacter. 2nd ed. Washington: American Society for Microbiology The American Society for Microbiology (ASM) is a scientific organization, based in the United States although with over 43,000 members throughout the world. It is the largest single life science professional organization and its members include those whose interests encompass basic ; 2000. p. 89-120.

(8.) Vandamme P, Pugina P, Benzi G, van Etterijck R, Vlaes L, Kersters K, et al. Outbreak of recurrent abdominal cramps associated with Arcobacter butzleri in an Italian school. J Clin Microbiol. 1992;30:2335-7.

(9.) On SL, Stacey A, Smyth J. Isolation of Arcobacter butzleri from a neonate neonate /neo·nate/ (ne´o-nat) newborn infant.

ne·o·nate
n.
A neonatal infant.



neonate

a newborn animal.
 with bacteraemia. J Infect. 1995;31:225-7.

(10.) Lerner J, Brumberger V, Preac-Mursic V. Severe diarrhea associated with Arcobacter butzleri. Eur J Clin Microbiol Infect Dis. 1994;13:660-2.

(11.) Vandenberg O, Dediste A, HoufK, Ibekwem S, Souayah H, Cadranel S, et al. Arcobacter species in humans. Emerg Infect Dis. 2004;10: 1863-7.

(12.) Gallay A, Simon F, Megraud F. Surveillance of human Campylobacter infections in France--part 2--implementation of national surveillance. Euro Surveill. 2003;8:218.

(13.) Menard A, Dachet F, Prouzet-Mauleon V, Oleastro M, Megraud F. Development of a real-time fluorescence resonance energy transfer Fluorescence resonance energy transfer (FRET) describes an energy transfer mechanism between two chromophores.

A donor chromophore in its excited state can transfer energy by a nonradiative, long-range dipole-dipole coupling mechanism to an acceptor chromophore in close
 PCR to identify the main pathogenic Campylobacter spp. Clin Microbiol Infect. 2005; 11:281-7.

(14.) Engberg J, On SLW SLW Specific Leaf Weight
SLW Saltillo, Coahuila, Mexico - Saltillo (Airport Code)
SLW Super-Cooled Liquid Water
SLW Single Line Working
SLW Straight-Line Wavelength
SLW Surgical Licensed Ward
SLW Space-based Laser Weapon
, Harrington CS, Gerner Smidt P. Prevalence of Campylobacter, Arcobacter, Helicobacter, and Sutterella spp. in human fecal samples as estimated by a reevaluation of isolation methods for campylobacters. J Clin Microbiol. 2000;38:286-91.

(15.) Gorkiewicz G, Feierl G, Schober C, Dieber F, Kofer J, Zechner R, et al. Species-specific identification of campylobacters by partial 16S rRNA gene sequencing. J Clin Microbiol. 2003;41:2537-46.

Valdrie Prouzet-Mauleon, * Leila Labadi, * Nathalie Bouges, * Armelle Menard, ([dagger]) and Francis Megraud *

* Hopital Pellegrin, Bordeaux, France; and ([dagger]) Universite Victor Segalen Bordeaux 2, Bordeaux, France

Address for correspondence: Francis Megraud, Laboratoire de Bacteriologie, Hopital Pellegrin, Place Amdlie Raba Leon, 33076 Bordeaux, France; fax: 33-5-56-79-60-18; email: francis.megraud@chubordeaux.fr

Dr Prouzet-Mauleon is an engineer at the National Reference Center for Campylobacters and Helicobacters. She is responsible for the analyses and development of molecular methods applied to the diagnosis and characterization of Campylobacteraceae.
Table. Demographic and clinical characteristics of 19 patients infected
with Arcobacter butzleri

                                                    Blood
             Age                       Abdominal     in
Patient *    (y)    Sex    Diarrhea      pain       stool    Vomiting

 1            88     F        +            +          -
 2            75     M        +            +          -         -

 4            89     F        +            -          -         -

 7            76     M        +            +          +         -
 8             2     M        +            -          -         +
10            69     M        +            +          -         -
11             4     M        +            +          -         -
12            72     F        +            -          +         -
15            89     M        +                       -
18            53     M        +            +          -         -
19             6     M        +            +          +         +
20            30     F        -            +          -         -
21            68     M        +            +          +         -
23            77     M        +

25             1     F        +
26            41     M        +            -          -         -

27            44     F        +            +          -         -
28            70     F        +
29            83     F        +            +          -         -

                       General
                       symptoms            Duration of symptoms
Patient *    Fever    ([dagger])            and disease course

 1             +          +             Death linked to associated
                                                 neoplasia
 2             -          +             4 days. Acute renal failure
                                        (treated with amoxicillin)
 4             -          +          6 weeks. Favorable progress after
                                         treatment with ofloxacin
 7             -          -         5 days (treated with ciprofloxacin)
 8             -          +                       2 days
10             -          +
11             +          +           Several recurrences in 3 months
12             -                                  3 weeks
15                        -
18             -          +              Irritable bowel syndrome
19             +          +                       10 days
20             -
21             +          +
23             -          +          Several days. Acute renal failure
                                       (treated with ciprofloxacin)
25             +          +                       3 weeks
26             -          +             Several days (treated with
                                         amoxicillin-clavulanate)
27             -          -
28
29             -          +                    Several days

* All samples were from stool, except from patient 12, whose sample was
blood.

([dagger]) Anorexia, asthenia, weight loss.
COPYRIGHT 2006 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2006, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Megraud, Francis
Publication:Emerging Infectious Diseases
Geographic Code:4EUFR
Date:Feb 1, 2006
Words:2377
Previous Article:Rotavirus and severe childhood diarrhea.
Next Article:Evaluation of a direct, rapid immunohistochemical test for rabies diagnosis.
Topics:



Related Articles
Executives...FYI.
Human campylobacteriosis in developing countries. (Synopsis).
Arcobacter species in humans (1).
First impressions: your business card speaks volumes.
EDITORIAL PIERCE'S NEW PREZ.
Helicobacter pullorum in Chickens, Belgium.
Keep it simple, like a comic strip.
Cover the candy.

Terms of use | Copyright © 2012 Farlex, Inc. | Feedback | For webmasters | Submit articles