Printer Friendly
The Free Library
5,665,810 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Antigenic diversity of human sapoviruses.


Sapovirus (SaV) is a causative agent of gastroenteritis gastroenteritis: see enteritis.
gastroenteritis

Acute infectious syndrome of the stomach lining and intestines. Symptoms include diarrhea, vomiting, and abdominal cramps.
. On the basis of capsid capsid /cap·sid/ (kap´sid) the shell of protein that protects the nucleic acid of a virus; it is composed of structural units, or capsomers.

cap·sid
n.
 protein (VP1) nucleotide sequences, SaV can be divided into 5 genogroups (GI-GV), of which the GI, GII GII Global Information Infrastructure
GII Getty Information Institute
GII Gasherbrum II (26,360 ft. mountain near Pakistan-China)
GII Government Information Infrastructure
GII Ghana Integrity Initiative
, GIV GIV Gasherbrum IV (26,000 ft. mountain near Pakistan-China)
GIV Geological Information Visualization
, and GV strains infect humans. SaV is uncultivable, but expression of recombinant VP1 in insect cells results in formation of viruslike particles (VLPs) that are antigenically similar to native SaV. In this study, we newly expressed SaV GII and GIV VLPs to compare genetic and antigenic relationships among all human SaV genogroups. Hyperimmune hyperimmune /hy·per·im·mune/ (hi?per-i-mun´) possessing very large quantities of specific antibodies in the serum.

hyperimmune

possessing very large quantities of specific antibodies in the serum.
 antiserum antiserum /an·ti·se·rum/ (an´ti-se?rum) a serum containing antibody(ies), obtained from an animal immunized either by injection of antigen or by infection with microorganisms containing antigen.  samples against VLPs reacted strongly with homologous homologous /ho·mol·o·gous/ (ho-mol´ah-gus)
1. corresponding in structure, position, origin, etc.

2. allogeneic.


ho·mol·o·gous
adj.
1.
 VLPs. However, several antiserum samples weakly cross-reacted against heterologous heterologous /het·er·ol·o·gous/ (het?er-ol´ah-gus)
1. made up of tissue not normal to the part.

2. xenogeneic.


het·er·ol·o·gous
adj.
1.
 VLPs in an antibody ELISA ELISA (e-li´sah) Enzyme-Linked Immuno-Sorbent Assay; any enzyme immunoassay using an enzyme-labeled immunoreactant and an immunosorbent.

ELISA
n.
. Conversely, an antigen ELISA showed that VLPs of SaV in all human genogroups were antigenically distinct. These findings indicate a likely correspondence between SaV antigenicity and VP1 genogroupin and enot in.

**********

The family Caliciviridae contains 4 genera (Sapovirus, Norovirus, Lagovirus, and Vesivirus), which include Sapporo virus, Norwalk virus Nor·walk virus
n.
A norovirus.


Norwalk virus (nôr´wôlk),
n.
, Rabbit hemorrhagic disease rabbit hemorrhagic disease

a highly fatal, contagious disease of European rabbits (Oryctolagus cuniculus) but other rabbit species and other wildlife are not susceptible.
 virus, and Feline calicivirus Feline calicivirus (FCV) is a virus of the family Caliciviridae that causes disease in cats. It is one of the two important viral causes of respiratory infection in cats, the other being feline herpesvirus. , respectively. Sapoviruses (SaVs) and noroviruses (NoVs) are etiologic agents of human gastroenteritis. The prototype strain of human SaV, Sapporo virus, was originally discovered in an outbreak in an orphanage in Sapporo, Japan, in 1977 (1). SaV infects children and adults and has been found to cause outbreaks of gastroenteritis in daycare centers, healthcare facilities, and elementary schools. Detection methods include reverse transcription-PCR (RT-PCR RT-PCR

reverse transcriptase-polymerase chain reaction. See PCR1.
), real-time RT-PCR, enzyme immunoassays, and ELISAs (2-6). Recently, we detected SaV in untreated wastewater samples, treated wastewater samples, and river samples (7).

The SaV genomes are predicted to contain either 2 or 3 main open reading frames (ORF1-3). SaV ORF1 encodes for nonstructural proteins and the major capsid protein, and ORF2 (VP2) and ORF3 encode proteins of yet unknown functions. On the basis ofVP1 nucleotide sequences, SaVs have been divided into 5 genogroups (GI-GV), of which GI, GII, GIV, and GV strains infect humans and GIII GIII Gasherbrum III (26,089 ft. mountain near Pakistan-China)  strains infect porcine porcine /por·cine/ (por´sin) pertaining to swine.

porcine

pertaining to pig. See also hog (1), swine.


porcine circovirus 1
a nonpathogenic virus.
 species (8). SaV genogroups can be further subdivided into genotypes. Recently, we identified several recombinant SaV strains (8,9).

Human SaV and NoV strains are uncultivable, but expression of a recombinant subgenomic-like construct (i.e., VP1 to the end of the genome) or VP1 alone in insect or mammalian cells results in the formation of viruslike particles (VLPs) that are morphologically similar to native SaV (10-16). However, production of VLPs of SaV remains difficult, usually only resulting in low yields of VLPs compared with norovirus (10,12,16,17). Cryoelectron microscopy and x-ray crystallography X-ray crystallography, the study of crystal structures through X-ray diffraction techniques. When an X-ray beam bombards a crystalline lattice in a given orientation, the beam is scattered in a definite manner characterized by the atomic structure of the lattice.  analyses of NoV VLPs identified the shell (S) and protruding pro·trude  
v. pro·trud·ed, pro·trud·ing, pro·trudes

v.tr.
To push or thrust outward.

v.intr.
To jut out; project. See Synonyms at bulge.
 domains (subdomains P1-1, P1-2, and P2) (18). Also, Chen et al. described strictly and moderately conserved amino acid amino acid (əmē`nō), any one of a class of simple organic compounds containing carbon, hydrogen, oxygen, nitrogen, and in certain cases sulfur. These compounds are the building blocks of proteins.  residues in the capsid protein among the 4 genera in the family Caliciviridae (13).

Previously, we reported that SaV GI/1 (strain Mc114) and GV/1 (strain NK24) were antigenically distinct (5,10). More recently, we discovered that SaV GI/5 (strain Yokotel) VLPs were antigenically distinct from SaV GI/1 Mc114 and GV/1 NK24 VLPs (19). Other than these few studies, little is known about the genetic and antigenic relationships among the 4 human SaV genogroups. For classification of NoV, distinct genotypes have been defined as having bootstrap See boot.

(operating system, compiler) bootstrap - To load and initialise the operating system on a computer. Normally abbreviated to "boot". From the curious expression "to pull oneself up by one's bootstraps", one of the legendary feats of Baron von Munchhausen.
 values >950 (VP1 sequences); at least 14 GI and 17 GII genotypes have been identified (20). For SaV, genogroups have only been vaguely defined, mostly because 2 of them (GIV/1 and GV/1) were only recently identified, few sequences exist in the database, and antigenic relationships among all genogroups are unknown. In addition, genetic recombination Genetic recombination is the process by which a strand of DNA is broken and then joined to the end of a different DNA molecule. In eukaryotes recombination commonly occurs during meiosis as chromosomal crossover between paired chromosomes.  was only recently discovered and appears to be common within the genus Sapovirus.

The purpose of this study was to examine cross-reactivities among the 4 human SaV genogroups and compare results with those of genetic analysis. For this purpose, 2 other SaV strains, GII/3 Syd53 and GIV/I Syd3, were expressed and antisera were produced against their purified VLPs. A total of 5 SaV strains (GI/1 Mc114, GI/5 Yokotel, GII/3 Syd53, GIV/1 Syd3, and GV/1 NK24) that include all 4 human genogroups and 2 GI genotypes were compared. Our results show that SaV genogroups were antigenically distinct and corresponded with results of genetic classification on the basis of full-length VP 1 nucleotide sequences. Proper genetic classification of SaV strains is required, and a consensus of genogroups and genotypes that represent genetically and antigenically diverse strains, which include recombinant SaV strains, should be established to avoid conflicting grouping.

Materials and Methods

Specimens

Virus-positive stool specimens were collected from several sources. SaV strain Mc114 (GenBank accession no. AY237422) was isolated from an infant hospitalized with acute gastroenteritis in Chiang Mai Chiang Mai (jyäng` mī`) or Chiengmai (jyĕng`–), city (1990 pop. 164,902), capital of Chiang Mai prov., N Thailand, on the Ping River, near the Myanmar border. , Thailand, in 2001 (21). SaV strain NK24 (AY646856) was isolated from an infant with gastroenteritis in Nong Khai, Thailand, in 2003 (22). SaV strain Yokotel was isolated from an outbreak of gastroenteritis at a kindergarten in Yokote City, Japan, in 2006 (19). SaV strains Syd53 and Syd3 were isolated from infants hospitalized with acute gastroenteritis in Sydney, New South Wales New South Wales, state (1991 pop. 5,164,549), 309,443 sq mi (801,457 sq km), SE Australia. It is bounded on the E by the Pacific Ocean. Sydney is the capital. The other principal urban centers are Newcastle, Wagga Wagga, Lismore, Wollongong, and Broken Hill. , Australia, in 2001 (23). NoV strain Osaka659 was isolated from an outbreak of gastroenteritis in Japan, in 2006 (unpub. data). RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 extraction and RTPCR RTPCR Reverse Transcriptase Polymerase Chain Reaction  were performed as described (24).

Sequence Analysis

Nucleotide sequences were determined by using the Terminator Cycle Sequence Kit version 3.1 and an ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 3130 sequencer See MIDI sequencer.

(music) sequencer - Any system for recording and/or playback of music via a programmable memory which stores music not as audio data, but as some representation of notes.
 (both from Applied Biosytems, Boston, MA, USA). Nucleotide sequences were aligned with ClustalX (www.embl.de/~chenna/clustal/darwin) and the distances were calculated by the Kimura 2-parameter method (24). Phylogenetic trees with bootstrap analysis from 1,000 replicas were generated by the neighbor-joining method as described (20). Amino acid VP1 secondary structure predictions were made by using PSIPRED PSIPRED Protein Structure Prediction  secondary structural prediction software (25).

Expression of Viruslike Particles

For the expression of VP1 in insect cells, all SaV constructs were designed to begin from the predicted VP1 start AUG codon AUG codon

codon for methionine; usually, but not always the first AUG sequence encountered as the mRNA is read 5'?3' is the translational start signal; the methionine encoded is cleaved from the polypeptide.
 and included the ORF2 and poly(A) sequences. SaV strains Syd53 and Syd3 were cloned as described (10) for strains SaV Mc114, NK24, and Yokotel according to the protocol of the Baculovirus baculovirus

group of rod-shaped, double-stranded, DNA viruses which infect and kill a large number of different invertebrate species especially insects, including Lepidoptera, Hymenoptera, Diptera, Neuroplera, Trichoptera, Coleoptera and Homoptera, and also prawns; used as
 Expression System using Gateway Technology (Invitrogen, Carlsbad, CA, USA). Briefly, strains Syd53 and Syd3 were amplified with specific sense primers Syd53attbl (5'-GGGGACAAGTTTGTA CAAAAAAGCAGGCTTCGAAGGAGATAGAACCAT GGAGGGTGTGTCCCACCCAGA-3')and Syd3attb1(5'-G GGGACAAGTTTGTACAAAAAAGCAGG CTTCGAAGGAGATAGAACCATGGAGGGCAATGG CCTACCCCAGGCTG-3') and antisense antisense, DNA or RNA manipulated in a laboratory so that its components (nucleotides) form a complementary copy of normal, or "sense," messenger RNA (mRNA; see nucleic acid).  primer TX30SXN SXN Section  (5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCT TTTTTTTTTTTTTTTTTTTTTTTTTTTTT-3'). PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 fragments were purified after electrophoresis on a 1.0% agarose agarose

more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments.
 gel. Fragments were cloned into donor vector pDONR201 (Invitrogen) and transferred into a baculovirus transfer vector pDEST8 (Invitrogen).

The recombinant pDEST8 was purified and used to transform Escherichia coli Escherichia coli (ĕsh'ərĭk`ēə kō`lī), common bacterium that normally inhabits the intestinal tracts of humans and animals, but can cause infection in other parts of the body, especially the urinary tract.  DH 10Bac-competent cells (Invitrogen), which produced recombinant bacmids (baculovirus shuttle vectors) containing the VP1 gene. Recombinant bacmids were then transfected into Sf9 cells (Riken Cell Bank, Ibaraki, Japan), and recombinant baculoviruses were isolated. Recombinant baculoviruses were used to infect [approximately equal to] 3 x [10.sup.6] confluent con·flu·ent
adj.
1. Flowing together; blended into one.

2. Merging or running together so as to form a mass, as sores in a rash.
 Tn5 cells (Invitrogen) at a multiplicity of infection The multiplicity of infection or MOI is the ratio of infectious agents (e.g. phage or virus) to infection targets (e.g. cell). For example, when referring to a group of cells inoculated with infectious virus particles, the multiplicity of infection or MOI is the ratio  of 5-10 in 1.5 mL of Ex-Cell 405 medium (JRH JRH Journal of Rural Health  Biosciences, Lenexa, KS, USA), and the infected cells were incubated at 26[degrees]C. The culture medium was harvested 5-6 d postinfection, centrifuged for 10 min at 3,000 x g, and further centrifuged for 30 min at 10,000 x g. VLPs were concentrated by ultracentrifugation ultracentrifugation /ul·tra·cen·trif·u·ga·tion/ (ul?trah-sen-trif?u-ga´shun) subjection of material to an exceedingly high centrifugal force, which will separate and sediment the molecules of a substance.  for 2 h at 45,000 rpm at 4[degrees]C (Beckman TLA-55 rotor; Beckman Coulter, Fullerton, CA, USA), and resuspended in 30 pL of Grace's medium. Samples were examined for VLP VLP Virus-like particles, see there  formation by electron microscopy as described (10), and large-scale production of VLPs was performed as described (24).

Antibody Production

Hyperimmune sera to newly expressed VLPs of SaV (Syd53 and Syd3) were prepared in rabbits and guinea pigs. The first subcutaneous injection was performed with purified VLPs ([approximately equal to] 10 pg) in Freund complete adjuvant adjuvant /ad·ju·vant/ (aj?dbobr-vant) (a-joo´vant)
1. assisting or aiding.

2. a substance that aids another, such as an auxiliary remedy.

3.
. After 3 weeks, the animals received 1 booster injection (intravenously in rabbits and subcutaneously in guinea pigs) of 10 lag of VLPs without adjuvant. Blood was collected from the animals 1 week after their last booster injection.

Antibody ELISA

Cross-reactivities among antiserum samples against SaV were examined by using an antibody ELISA with hyperimmune rabbit antibodies against VLPs. Briefly, wells of 96-well microtiter plates (Maxisorp; Nunc, Roskilde, Denmark) were each coated with 100 [micro]L of purified VLPs ([approximately equal to] 1.0 [micro]g/ mL in carbonate-bicarbonate buffer, pH 9.6) (Sigma, St. Louis, MO, USA) and incubated overnight at 4[degrees]C. Wells were washed twice with phosphate-buffered saline (PBS PBS
 in full Public Broadcasting Service

Private, nonprofit U.S. corporation of public television stations. PBS provides its member stations, which are supported by public funds and private contributions rather than by commercials, with educational, cultural,
) containing 0.1% Tween tween  
n.
A child between middle childhood and adolesence, usually between 8 and 12 years old.



[Blend of teen1 and between.]
 20 (PBS-T) and blocked with PBS containing 5% skim milk skim milk
n.
The milk from which the cream has been removed.



skim milk

the residue from whole milk after the cream has been skimmed off. In today's usage it is the residue after the butterfat is removed.
 (PBS-SM) for 1 h at room temperature. Wells were then washed 4 times with PBS-T, 100 [micro]L of 2-fold-diluted hyperimmune rabbit antibodies from an initial concentration of 1:500 in PBS-T-SM was added to each well, and the plates were incubated for 1 h at 37[degrees]C. Wells were then washed 4 times with PBS-T, and 100 [micro]L of a 1:1,000 dilution of horseradish horseradish

Hardy perennial plant (Armoracia lapathifolia) of the mustard family, native to Mediterranean lands and grown throughout the temperate zones. Its hotly pungent, fleshy root is used as a condiment and is traditionally considered medicinal.
 peroxidase--conjugated goat antirabbit immunoglobulin G immunoglobulin G
n. Abbr. IgG
The most abundant class of antibodies found in blood serum and lymph and active against bacteria, fungi, viruses, and foreign particles. Immunoglobulin G antibodies trigger action of the complement system.
 diluted in PBS-T-SM was added to each well. Plates were incubated for 1 h at 37[degrees]C. Wells were then washed 4 times with PBS-T, and 100 [micro]L of substrate (o-phenylenediamine) and [H.sub.2][O.sub.2] were added to each well, and the plates were left in the dark for 30 min at room temperature. The reaction was stopped by the addition of 50 [micro]L of 2N [H.sub.2] S[O.sub.4] to each well, and the absorbance absorbance /ab·sor·bance/ (-sor´bans)
1. in analytical chemistry, a measure of the light that a solution does not transmit compared to a pure solution. Symbol .

2.
 was measured at 492 nm ([A.sub.492]). The optical density (OD) cutoff point Cutoff point

The lowest rate of return acceptable on investments.
 was determined to be 0.15, which was equal to 3 times the mean OD of preimmune serum (5).

Antigen ELISA

Cross-reactivities among VLPs were also examined by using an antigen ELISA. Briefly, wells were coated with I00 [micro]L of a 1:8,000 dilution of hyperimmune rabbit antiserum diluted in PBS (except for Syd3, for which a 1:3,000 dilution was used), and the plates were incubated overnight at 4[degrees]C. Wells were washed 4 times with PBS-T and blocked with PBS-SM for 1 h at room temperature. Wells were then washed 4 times with PBS-T, 100 [micro]L of VLPs ([approximately equal to] 1.0 [micro]g/mL in carbonate-bicarbonate buffer, pH 9.6) (Sigma) was added to duplicate hyperimmune rabbit wells, and the plates were incubated for 1 h at 37[degrees]C. Wells were then washed 4 times with PBS-T, 100 [micro]L of a 1:8,000 dilution of hyperimmune guinea pig antibody diluted in PBS-T-SM was added to each well (except for Syd3, which used a 1:3,000 dilution), and the plates were incubated for 1 h at 37[degrees]C. Wells were washed 4 times with PBS-T, and 100 [micro]L of a 1:1,000 dilution of horseradish peroxidase--conjugated rabbit antiguinea pig immunoglobulin G diluted in PBS-T-SM was added to each well. The plates were then processed as described above. On the basis of our previous study, a specimen with an [A.sub.492] (P - N) >0.1 and a P/N (Part/Number) Common shorthand for part number.  ratio >1.34 (where P is hyperimmune antiserum and N is preimmune antiserum) was considered significantly positive (4).

Results

Sequence Analysis

The sequence of the 3' end of the genome ([approximately equal to] 2,600 nt), i.e., VP1 to poly(A), for the newly expressed SaV strains (Syd53 and Syd3) was determined. Genetic analysis was performed with only complete VP1 sequences, which included sequences from our epidemiologic studies and other sequences available on the database (Figure 1). Five SaV GI and 6 GII genotypes were observed, but only 1 genotype for SaV GIV and 1 for GV was found. This result suggests that SaV GI and GII strains were more genetically diverse, prevalent, or more virulent than SaV GIV and GV strains. However, because the SaV GIV and GV strains were only recently detected (26,27), this result may reflect only the specificity and sensitivity of the detection methods used. On the basis of our previous classifications, SaV Mc114 and Yokotel sequences both belonged to GI, but to different genotypes, GI/1 and GI/5, respectively; Syd53 be longed to GII/3; Syd3 belonged to GIV/1; and NK24 belonged to GV/1. SaV GI/1 Mc114 and GI/5 Yokotel VP1 sequences shared 76.5% and 79% nucleotide similarity and amino acid identity, respectively (Table 1). The nucleotide similarity and amino acid identity among the genogroups was low, i.e., <60% (Table 1).

[FIGURE 1 OMITTED]

Expression of VP1

We previously expressed SaV GI/1 Mc114, GI/5 Yokotel, and GV/1 NK24 in insect cells, which resulted in the formation of VLPs morphologically similar to native SaV (5,10). In this study, we newly expressed SaV GII/3 Syd53 and GIV/1 Syd3 in insect cells to analyze the cross-reactivity among all human SaV genogroups. SaV GII/3 Syd53 and GIV/1 Syd3 successfully formed VLPs with a diameter of 41 to 46 nm and were morphologically similar to native SaV (Figure 2). Hyperimmune sera against these purified VLPs were prepared in rabbits and guinea pigs.

Antibody ELISA Analysis

Our previous antibody ELISA result showed that SaV GI/1 Mc114 and GV/1 NK24 antisera had no cross-reactivities against heterologous GV/1 NK24 and GI/1 Mc114 VLPs, respectively (5). In the current study, cross-reactivities among 5 VLPs of SaV (GI/1 Mc114, GI/5 Yokotel, GII/3 Syd53, GIV/1 Syd3, and GV/1 NK24) were analyzed by using the antibody ELISA with 2-fold serial dilutions (1:500-1:1,024,000) of hyperimmune antiserum (Figure 3). The OD cutoff point was 0.15, which was equal to 3 times the mean OD of preimmune serum (5). Hyperimmune rabbit antiserum reacted strongly against the homologous VLPs (Table 2, Figure 3). SaV GII/3 Syd53 and GIV/1 Syd3 antisera titers were 512,000 and 2,056,000, respectively (Table 2). Several antisera weakly cross-reacted with heterologous VLPs. SaV GI/1 Mc114 antiserum cross-reacted weakly with GI/5 Yokotel and GII/3 Syd53 VLPs, i.e., their cross-reactivities were 8- and 16-fold lower than that of the homologous VLP titer titer /ti·ter/ (ti´ter) the quantity of a substance required to react with or to correspond to a given amount of another substance. , respectively. SaV GI/5 Yokote 1 antiserum cross-reacted weakly with GI/1 Mc 114 and GII/3 Syd53 VLPs, i.e., its cross-reactivity was 16-fold lower than that of the homologous VLP titer. SaV GII/3 Syd53, GIV/1 Syd3, and GV/1 NK24 antisera appeared to have no cross-reactivities against any of the heterologous VLPs, i.e., their cross-reactivities were >32-fold lower than those of the homologous VLP titer. These results suggested that SaV GI/1 Mc114 and GI/5 Yokotel antiserum had weak 2-way cross-reactivities against GI/5 Yokotel and GI/1 Mc114 VLPs, respectively. The negative control NoV Osaka659 antiserum showed no cross-reactivities against VLPs of SaV at any dilution of antiserum, which indicates that the antiserum was specific for the VLPs and not the insect cell proteins.

[FIGURE 2 OMITTED]

Antigen ELISA Analysis

On the basis of a previous study, a specimen with an [A.sub.492] (P - N) >0.10 and a P/N ratio >1.34 was considered significantly positive (4). Our recent antigen ELISA results showed that SaV GI Mc114, GI/5 Yokotel, and GV/1 NK24 VLPs were antigenically distinct (19), i.e., GI/1 Mc114 P-N 0.41, P/N 9.19; GI/5 Yokotel P -N 0.93, P/N 19.59; and GV/1 NK24 P - N 1.03, P/N 21.58. In the current study, we examined the cross-reactivity among the newly expressed VLPs and those previously prepared by using the antigen ELISA. The antiserum samples reacted only with homologous VLPs, i.e., SaV GII/3 Syd53 P - N 1.02, P/N 21.33; and GIV/1 Syd3 P - N 1.44, P/N 29.74 (Table 3). Several antisera appeared to cross-react with heterologous VLPs, i.e., where the P - N was <0.10, but the P/N ratio was >1.34. SaV GI/5 Yokotel antisera appeared to cross-react with GII/3 Syd53 VLPs (P/N 1.97); GIV/1 Syd3 antisera appeared to cross-react with GI/5 Yokotel VLPs (P/N 1.42); and GV/1 NK24 antisera appeared to cross-react with GII/3 Syd53 VLPs (P/N 1.50). However, all of these cross-reactivity results were considered negative because P - N was <0.10.

[FIGURE 3 OMITTED]

Amino Acid Alignment and Secondary Structure Prediction

An amino acid alignment of the 5 SaV VP1 sequences (GI/1 Mc114, GI/5 Yokotel, GII/3 Syd53, GIV Syd3, and GV NK24) showed that the shell domain contained more conserved residues than the predicted P domains (Figure 4). However, SaV GI/1 Mc114 and GI/5 Yokotel shared more conserved continuous residues in the predicted P2 subdomain than other genogroups. The NoV P2 subdomain is thought to contain the determinants of strain specificity, cell binding, and antigenicity. For example, monoclonal antibodies that recognize regions in the P2 subdomain inhibit binding of NoV VLPs to cells (28,29). In a recent study, we analyzed cross-reactivities among 26 different NoV VLPs (6 GI and 12 GII genotypes) (30) and found broad-range cross-reactivities for several NoV antisera. Our results suggested that these cross-reactivities were due to conserved amino acid residues located outside the P2 domain. Conversely, secondary structure predictions made by using PSIPRED secondary structural prediction software showed that helix structures could also influence the cross-reactivity among the NoV VLPs. In the current study, we determined the secondary structure of the 5 SaV VP1 amino acid sequences. Overall, SaV VP1 structures appear to be similar (online Appendix Figure, available from www. cdc.gov/EID/content/13/10/1519-appG.htm). The location of 3 helix structures in the shell domain and 1 helix structure in the C-terminal region were nearly identical for the 5 SaV VP1 sequences. Only SaV GV/I NK24 was predicted to have a single helix structure in the P2 subdomain. These results suggested that the amino acid sequence, particularly the P2 subdomain, plays a major role in determining cross-reactivity among SaV strains. However, additional studies, including high-resolution VLP structural analysis, are needed.

[FIGURE 4 OMITTED]

Discussion

In this study, we analyzed genetic and antigenic relationships for 4 human SaV genogroups (GI, GII, GIV, and GV). We observed weak 2-way cross-reactivity with SaV GI/1 Mc114 and GI/5 Yokotel antisera against the heterologous GI/5 Yokotel and GI/1 Mc114 VLPs, respectively, by using an antibody ELISA. However, when we used an antigen ELISA, we found that GI/1 Mc114 and GI/5 Yokotel VLPs were antigenically distinct. These weak cross-reactivities identified by using the antibody ELISA may have been influenced by several factors, including unfolded VLPs on the microtiter plates at the high pH (carbonatebicarbonate buffer, pH 9.6) (31) or conserved continuous residues outside the predicted P2 domain. Therefore, these 2 SaV genotypes (GI/1 and GI/5) are for the most part antigenically distinct. Likewise, we found that the 4 human SaV genogroups were antigenically distinct in the antigen ELISA. To our knowledge, these new findings provide the first evidence that SaV antigenicity corresponded well with VP 1 genogrouping and genotyping.

This study was supported in part by a grant for Research on Emerging and Re-emerging Infectious Diseases from the Ministry of Health, Labor and Welfare of Japan, and a grant for Research on Health Science Focusing on Drug Innovation from The Japan Health Science Foundation.

References

(1.) Chiba S, Sakuma Y, Kogasaka R, Akihara M, Horino K, Nakao T, et al. An outbreak of gastroenteritis associated with calicivirus in an infant home. J Med Virol. 1979;4:24-54.

(2.) Oka T, Katayama K, Hansman GS, Kageyama T, Ogawa S, Wu FT, et al. Detection of human sapovirus by real-time reverse transcription-polymerase chain reaction. J Med Virol. 2006;78:1347-53.

(3.) Nakata S, Chiba S, Terashima H, Sakuma Y, Kogasaka R, Nakao T. Microtiter solid-phase radioimmunoassay for detection of human calicivirus in stools. J Clin Microbiol. 1983;17:198-01.

(4.) Hansman GS, Guntapong R, Pongsuwanna Y, Natori K, Katayama K, Takeda N. Development of an antigen ELISA to detect sapovirus in clinical stool specimens. Arch Virol. 2006;151:551-61.

(5.) Hansman GS, Natori K, Ushijima H, Katayama K, Takeda N. Characterization of polyclonal antibodies raised against sapovirus genogroup five virus-like particles. Arch Virol. 2005;150:1433-7.

(6.) Okada M, Yamashita Y, Oseto M, Shinozaki K. The detection of human sapoviruses with universal and genogroup-specific primers. Arch Virol. 2006;151:2503-9.

(7.) Hansman GS, Sano D, Ueki Y, Imai T, Oka T, Katayama K, et al. Sapovirus in water, Japan. Emerg Infect Dis. 2007;13:133-5.

(8.) Hansman GS, Takeda N, Oka T, Oseto M, Hedlund KO, Katayama K. Intergenogroup recombination recombination, process of "shuffling" of genes by which new combinations can be generated. In recombination through sexual reproduction, the offspring's complete set of genes differs from that of either parent, being rather a combination of genes from both parents.  in sapoviruses. Emerg Infect Dis. 2005;11:1916-20.

(9.) Katayama K, Miyoshi T, Uchino K, Oka T, Tanaka T, Takeda N, et al. Novel recombinant sapovims. Emerg Infect Dis. 2004;10: 1874-6.

(10.) Hansman GS, Natori K, Oka T, Ogawa S, Tanaka K, Nagata N, et al. Cross-reactivity among sapovirus recombinant capsid proteins. Arch Virol. 2005;150:21-36.

(11.) Guo M, Qian Y, Chang KO, Saif LJ. Expression and self-assembly in baculovirus of porcine enteric enteric /en·ter·ic/ (en-ter´ik) within or pertaining to the small intestine.

en·ter·ic
adj.
1. Of, relating to, or within the intestine.

2.
 calicivirus capsids into virus-like particles and their use in an enzyme-linked immunosorbent assay enzyme-linked immunosorbent assay
n.
ELISA.


Enzyme-linked immunosorbent assay (ELISA)
A diagnostic blood test used to screen patients for AIDS or other viruses.
 for antibody detection in swine. J Clin Microbiol. 2001;39:1487-93.

(12.) Hansman GS, Katayama K, Oka T, Natori K, Takeda N. Mutational study of sapovirus expression in insect cells. Virol J. 2005;2:13.

(13.) Chen R, Neill JD, Noel JS, Hutson AM, Glass RI, Estes MK, et al. Inter- and intragenus structural variations in caliciviruses and their functional implications. J Virol. 2004;78:6469-79.

(14.) Jiang X, Zhong W, Kaplan M, Pickering LK, Matson DO. Expression and characterization of Sapporo-like human calicivirus capsid proteins in baculovirus. J Virol Methods. 1999;78:81-91.

(15.) Numata K, Hardy ME, Nakata S, Chiba S, Estes MK. Molecular characterization of morphologically typical human calicivirus Sapporo. Arch Virol. 1997;142:1537-52.

(16.) Oka T, Hansman GS, Katayama K, Ogawa S, Nagata N, Miyamura T, et al. Expression of sapovirus virus-like particles in mammalian cells. Arch Virol. 2006;151:399-404.

(17.) Farkas T, Deng X, Ruiz-Palacios G, Morrow A, Jiang X. Development of an enzyme immunoassay Immunoassay

An assay that quantifies antigen or antibody by immunochemical means. The antigen can be a relatively simple substance such as a drug, or a complex one such as a protein or a virus.
 for detection of sapovirus-specific antibodies and its application in a study of seroprevalence seroprevalence Immunology The proportion of a population that is seropositive–ie, has been exposed to a particular pathogen or immunogen; the seropositivity of a population is calculated as the number of individuals who produce a particular antibody divided  in children. J Clin Microbiol. 2006;44:3674-9.

(18.) Prasad Prasāda (Sanskrit: प्रसाद), prasād/prashad (Hindi), Prasāda in (Kannada), prasādam (Tamil), or prasadam  BV, Hardy ME, Dokland T, Bella J, Rossmann MG, Estes MK. X-ray crystallographic crys·tal·log·ra·phy  
n.
The science of crystal structure and phenomena.



crystal·log
 structure of the Norwalk virus capsid. Science. 1999;286:287-90.

(19.) Hansman GS, Saito H, Shibata C, Ishizuka S, Oseto M, Oka T, et al. Outbreak of gastroenteritis due to sapovirus. J Clin Microbiol. 2007;45:1347-9.

(20.) Kageyama T, Shinohara M, Uchida K, Fukushi S, Hoshino FB, Kojima S, et al. Coexistence of multiple genotypes, including newly identified genotypes, in outbreaks of gastroenteritis due to norovirus in Japan. J Clin Microbiol. 2004;42:2988-95.

(21.) Hansman GS, Katayama K, Maneekarn N, Peerakome S, Khamrin P, Tonusin S, et al. Genetic diversity of norovirus and sapovirus in hospitalized infants with sporadic cases of acute gastroenteritis in Chiang Mai, Thailand. J Clin Microbiol. 2004;42:1305-7.

(22.) Guntapong R, Hansman GS, Oka T, Ogawa S, Kageyama T, Pongsuwanna Y, et al. Norovirus and sapovirus infections in Thailand. Jpn J Infect Dis. 2004;57:276-8.

(23.) Hansman GS, Takeda N, Katayama K, Tu ET, McIver C J, Rawlinson WD, et al. Genetic diversity of sapovirus in children, Australia. Emerg Infect Dis. 2006;12:141-3.

(24.) Katayama K, Shirato-Horikoshi H, Kojima S, Kageyama T, Oka T, Hoshino F, et al. Phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 analysis of the complete genome of 18 Norwalk-like viruses. Virology virology, study of viruses and their role in disease. Many viruses, such as animal RNA viruses and viruses that infect bacteria, or bacteriophages, have become useful laboratory tools in genetic studies and in work on the cellular metabolic control of gene expression . 2002;299:225-39.

(25.) McGuffin LJ, Bryson K, Jones DT. The PSIPRED protein structure prediction Protein structure prediction is one of the most important goals pursued by bioinformatics and theoretical chemistry. Its aim is the prediction of the three-dimensional structure of proteins from their amino acid sequences, sometimes including additional relevant information such as  server. Bioinformatics. 2000;16:404-5.

(26.) Farkas T, Zhong WM, Jing jing (jing) [Chinese] one of the basic substances that according to traditional Chinese medicine pervade the body, usually translated as "essence"; the body reserves or constitutional makeup, replenished by food and rest, that supports  Y, Huang PW, Espinosa SM, Martinez N, et al. Genetic diversity among sapoviruses. Arch Virol. 2004;149:1309-23.

(27.) Okada M, Shinozaki K, Ogawa T, Kaiho I. Molecular epidemiology molecular epidemiology Molecular medicine An evolving field that combines the tools of standard epidemiology–case studies, questionnaires and monitoring of exposure to external factors with the tools of molecular biology–eg, restriction endonucleases,  and phylogenetic analysis of Sapporo-like viruses. Arch Virol. 2002;147:1445-51.

(28.) Lochridge VP, Jutila KL, Graff JW, Hardy ME. Epitopes in the P2 domain of norovirus VP1 recognized by monoclonal antibodies that block cell interactions. J Gen Virol. 2005;86:2799-806.

(29.) White LJ, Ball JM, Hardy ME, Tanaka TN, Kitamoto N, Estes MK. Attachment and entry of recombinant Norwalk virus capsids to cultured human and animal cell lines. J Virol. 1996;70:6589-97.

(30.) Hansman GS, Natori K, Shirato-Horikoshi H, Ogawa S, Oka T, Katayama K, et al. Genetic and antigenic diversity among noroviruses. J Gen Virol. 2006;87:909-19.

(31.) White LJ, Hardy ME, Estes MK. Biochemical characterization of a smaller form of recombinant Norwalk virus capsids assembled in insect cells. J Virol. 1997;71:8066-72.

Use of trade names is for identification only and does not imply endorsement by the Public Health Service or by the U.S. Department of Health and Human Services Noun 1. Department of Health and Human Services - the United States federal department that administers all federal programs dealing with health and welfare; created in 1979
Health and Human Services, HHS
.

Grant S. Hansman, * Tomoichiro Oka, * Naomi Sakon, ([dagger]) and Naokazu Takeda *

* National Institute of Infectious Diseases, Tokyo, Japan; and [dagger] Osaka Prefectural pre·fec·ture  
n.
1. The district administered or governed by a prefect.

2. The office or authority of a prefect.

3. The residence or housing of a prefect.
 Institute of Public Health, Osaka, Japan

Address for correspondence: Grant S. Hansman, Department of Virology II, National Institute of Infectious Diseases, 4-7-1 Gakuen, Musashimurayama, Tokyo 208-0011, Japan; email: ghansman@nih.go.jp

Dr Hansman is a scientist at the National Institute of Infectious Diseases, Tokyo, Japan. His research interests include the epidemiology, expression, and cross-reactivity of viruses that cause gastroenteritis in humans, namely, sapovirus and norovirus.
Table 1. Nucleotide similarity (values below blank diagonal) and
amino acid identity (values above blank diagonal) of complete
capsid (VP1) sequences of sapovirus strains *

Strain           Mc114 (GI/1)   Yokote1 (GI/5)   Syd53 (GII/3)

Mc114 (GI/1)                          79              46
Yokote1 (GI/5)       76.5                            46.8
Syd53 (GII/3)        56.1            56.9
Syc13 (GIV/1)        58.1            57.4            55.9
NK24 (GV/1)          58.2            57.3            56.4

Strain           Syd3 (GIV/1)    NK24 (GV/1)

Mc114 (GI/1)          52              51
Yokote1 (GI/5)       50.3            50.9
Syd53 (GII/3)        48.3            48.6
Syc13 (GIV/1)                        54.2
NK24 (GV/1)          58.6

* Values are percentages.

Table 2. Titers of antisera to viruslike particles
of sapovirus strains in an antibody ELISA

Antisera          Mc114 (GI/1)    Yokote1 (GI/5)   Syd53 (GII/3)

Mc114(GI/1)         512,000           64,000           32,000
Yokote1 (GI/5)       32,000          512,000           32,000
Syd53 (GII/3)        4,000            8,000           512,000
Syd3 (GIV/1)         2,000            16,000           8,000
NK24 (GV/1)          2,000            2,000            4,000

Antisera          Syd3 (GIV/1)     NK24 (GV/1)

Mc114(GI/1)          1,000            <1,000
Yokote1 (GI/5)       2,000            4,000
Syd53 (GII/3)        4,000            <1,000
Syd3 (GIV/1)       2,056,000          1,000
NK24 (GV/1)          1,000          2,056,000

Table 3. Antigen ELISA absorbance values of
viruslike particles of sapovirus strains

                       Viruslike particles, P - N (P/N) *

Antisera         Mcl 14 (GI/1)    Yokote1 (GI/5)   Syd53 (GII/3)

Mc114 (GI/1)      0.41 (9.19)        0 (1.00)         0 (1.00)
Yokote1 (GI/5)    0.01 (1.13)      0.93 (19.59)     0.05 (1.97)
Syc153 (GII/3)      0 (1.00)       0.02 (l.42)      1.02 (21.33)
Syd3 (GIV/1)        0 (1.00)         0 (1.00)         0 (1.00)
NK24 (GV/1)         0 (1.00)         0 (1.00)         0 (1.00)

               Viruslike particles, P - N (P/N) *

Antisera          Syd3 (GIV/1)     NK24 (GV/1)

Mc114 (GI/1)        0 (1.00)         0 (1.00)
Yokote1 (GI/5)      0 (1.00)         0 (1.00)
Syc153 (GII/3)    0.01 (1.14)      0.03 (1.50)
Syd3 (GIV/1)      1.44 (29.74)       0 (1.00)
NK24 (GV/1)       0.01 (1.11)      1.03 (21.58)

* Measured at 492 nm. P, hyperimmune serum. N, preimmune serum.
COPYRIGHT 2007 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2007, Gale Group. All rights reserved.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:RESEARCH
Author:Hansman, Grant S.; Oka, Tomoichiro; Sakon, Naomi; Takeda, Naokazu
Publication:Emerging Infectious Diseases
Date:Oct 1, 2007
Words:4613
Previous Article:Confronting potential influenza A (H5N1) pandemic with better vaccines.(PERSPECTIVE)
Next Article:Evolutionary relationships between bat coronaviruses and their hosts.(RESEARCH)
Topics:



Related Articles
Human sapovirus in clams, Japan.(DISPATCHES)
Green power lunch.(Environment)(Community leaders attend an EWEB panel to address energy goals)
INSPIRATIONAL CLIMB JOIN STARS IN HIKE FOR BREAST-CANCER RESEARCH.(LA.COM)
German Memories in Asia - Exploring the Human Evolution
An Exploration into Early Human Migration
An Exploration into Indo - European Migration Towards South Asia
Medical anti Aging - anti Aging Medicine
Alternative Hair Loss Treatment - Alternative Therapies for Hair Loss

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles