Printer Friendly
The Free Library
19,595,263 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Anaplasma platys in dogs, Chile.


We conducted a 16S rRNA nested PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
 for the genus Ehrlichia and Ehrlichia spp. with blood samples from 30 ill dogs in Chile. Phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 analysis was performed by using groESL gene amplification Gene amplification

The process by which a cell specifically increases the copy number of a particular gene to a greater extent than it increases the copy number of genes composing the remainder of the genome (all the genes which make up the genetic machinery
. We identified Anaplasma platys platys

see platyfishes.
 as 1 of the etiologic agents of canine ehrlichiosis.

**********

Ehrlichioses are recognized as important emerging tickborne diseases in humans and wild and domestic animals. The brown dog tick brown dog tick

see rhipicephalussanguineus.
, Rhipicephalus sanguineus, is the main tick that infests dogs in Chile (1). This tick species is a vector of Ehrlichia canis and has been implicated im·pli·cate  
tr.v. im·pli·cat·ed, im·pli·cat·ing, im·pli·cates
1. To involve or connect intimately or incriminatingly: evidence that implicates others in the plot.

2.
, but not confirmed, as a vector of Anaplasma platys (2). Serologic se·rol·o·gy  
n. pl. se·rol·o·gies
1. The science that deals with the properties and reactions of serums, especially blood serum.

2.
 and clinical evidence of canine ehrlichiosis and serologic evidence of human ehrlichiosis have been reported in Chile (3,4). The purpose of this study was to identify the etiologic agent of canine ehrlichiosis in Chile.

The Study

Blood samples were obtained from 30 pet dogs seen in a private veterinary clinic in Santiago, Chile Santiago, officially Santiago de Chile (Spanish: ), is the capital of Chile, and the center of its largest conurbation (Greater Santiago). , with tick infestation infestation /in·fes·ta·tion/ (-fes-ta´shun) parasitic attack or subsistence on the skin and/or its appendages, as by insects, mites, or ticks; sometimes used to denote parasitic invasion of the organs and tissues, as by helminths.  and clinical signs compatible with ehrlichiosis (hemorrhagic Hemorrhagic
A condition resulting in massive, difficult-to-control bleeding.

Mentioned in: Hantavirus Infections


hemorrhagic

pertaining to or characterized by hemorrhage.
 manifestations and thrombocytopenia Thrombocytopenia Definition

Thrombocytopenia is an abnormal drop in the number of blood cells involved in forming blood clots. These cells are called platelets.
). We performed a nested PCR to amplify a portion of the 16S rRNA gene by using specific primers for the genus Ehrlichia and for Ehrlichia spp. DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 was extracted from 300 [micro]L of whole blood by using the Wizard Genomic DNA genomic DNA
n.
The full complement of DNA contained in the genome of a cell or organism.
 Purification kit (Promega, Madison, WI, USA). For Ehrlichia genus-specific PCR, 2.5 [micro]L of DNA was amplified by using outer primers EHR-OUT1 and EHR-OUT2 and inner primers GE2F and EHRL3-IP2 in 1 reaction with a final volume of 25 [micro]L (5) (Table 1).

The first-round amplification included 20 cycles of denaturation denaturation, term used to describe the loss of native, higher-order structure of protein molecules in solution. Most globular proteins exhibit complicated three-dimensional folding described as secondary, tertiary, and quarternary structures.  at 94[degrees]C for 45 s, annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  at 72[degrees]C for 1.5 min, and chain extension at 72[degrees]C for 1.5 min. The second-round amplification included 50 cycles of denaturation at 94[degrees]C for 45 s, annealing at 50[degrees]C for 1 min, and chain extension at 72[degrees]C for 1 min, followed by a final extension at 72[degrees]C for 5 min. Amplification products were analyzed by agarose gel electrophoresis Agarose gel electrophoresis is a method used in biochemistry and molecular biology to separate DNA, RNA, or protein molecules by size. This is achieved by moving negatively charged nucleic acid molecules through an agarose matrix with an electric field (electrophoresis). . The expected size of the amplification product was 120 bp. A. phagocytophilum DNA was used as a positive control (provided by Didier Raoult). For Ehrlichia spp.--specific amplification, we used the same set of outer primers for Anaplasmataceae and specific inner primers for A. phagocytophilum (6), E. chaffeensis, E. ewingii, and E. canis (5) (Table 1). For A. platys amplification, we used inner primers developed by Kordick et al. (EHRL3-IP2-E. platys) (7) (Table 1). Expected sizes of amplification products were 546, 395, 395, 389, and 151 bp, respectively.

The Ehrlichia genus PCR resulted in the expected DNA band in 6 of 30 dogs (dogs 7, 12, 17, 19, 23, and 25). These 6 samples were positive only for A. platys, showing the expected 151-bp product, and negative for other species tested (Figure 1, panel A). A. platys PCR was also conducted on the remaining 24 Ehrlichia-negative samples; none were positive.

[FIGURE 1 OMITTED]

DNA obtained from 3 16S rRNA PCR products (dogs 7, 17, and 25) was purified by using a commercial kit (Rapid Gel Extraction System; Marligen Biosciences, Ljamsville, Germany) and sequenced twice with an ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 3100 genetic analyzer (Model 3100; Applied Biosystems, Foster City, CA, USA). The 16S rRNA sequences obtained were compared by using BLAST (www.ncbi.nlm.nih.gov/blast) with sequences available at GenBank. Sequences obtained were similar to that of A. platys strain Okinawa 1 (GenBank accession no. AF536828), with similarities of 98%, 95%, and 98%, respectively. GenBank accession nos. for 16S rRNA sequences of A. platys strains obtained in this study are DQ125260 and DQ125261, which correspond to strains from dogs 7 and 17, respectively.

For phylogenetic analysis, the groESL gene of A. platys was amplified from samples positive for A. platys 16S rRNA that had sufficient amounts of DNA (dogs 17, 23, and 25) and from 1 negative sample (dog 13). Reactions contained 2 [micro]L of purified DNA as template in a total volume of 25 [micro]L. Amplifications contained 1.25 U Taq DNA polymerase DNA polymerase /DNA po·lym·er·ase/ (pah-lim´er-as) any of various enzymes catalyzing the template-directed incorporation of deoxyribonucleotides into a DNA chain, particularly one using a DNA template.  (Invitrogen, Carlsbad, CA, USA), 3 mmol/L [MgCl.sub.2], 2.5 mmol/L deoxynucleotide triphosphates (Invitrogen), and 0.2 pmol/L of primers EEgrolF and EEgro2R (8) (Table 1). DNA was denatured de·na·ture  
tr.v. de·na·tured, de·na·tur·ing, de·na·tures
1. To change the nature or natural qualities of.

2.
 by heating at 95[degrees]C for 10 min. PCR amplification included 40 cycles of denaturation at 95[degrees]C for 1.5 min, annealing at 52[degrees]C for 2 min, and extension at 72[degrees]C for 1.5 min, followed by a final extension at 72[degrees]C for 10 min. For nested amplifications, 1 [micro]L of primary PCR products was used as the template in a total volume of 25 [micro]L. Reaction conditions were the same as for primary amplifications. The primers used were SQ3F, SQ5F, SQ4R, and SQ6R (9) (Table 1). PCR products were analyzed by 1.5% agarose gel electrophoresis.

We amplified 3 overlapping fragments (790, 1,170, and 360 bp) in 3 16S rRNA--positive samples (Figure 1, panel B). These DNAs were purified by using a commercial kit (Rapid Gel Extraction System; Marligen), sequenced, and analyzed for phylogenetic relationships. Multiple alignment analysis was performed with the ClustalW program (www. ebi.ac.uk/clustalw). Calculation of distance matrices and construction of a phylogenetic tree were made with MEGA 3.1 software (www.megasoftware.net). A phylogenetic tree was constructed by the neighbor-joining method and distance matrices for the aligned sequences were calculated by using the Kimura 2-parameter method. Stability of the tree was estimated by bootstrap See boot.

(operating system, compiler) bootstrap - To load and initialise the operating system on a computer. Normally abbreviated to "boot". From the curious expression "to pull oneself up by one's bootstraps", one of the legendary feats of Baron von Munchhausen.
 analysis of 1,000 replications. A final sequence of 686 bp obtained from the overlapping fragments was used for comparison and showed 100% identity between the 3 Chilean sequences and 99.8% similarity with sequences of the A. platys groESL gene deposited in GenBank (Table 2). Phylogenetic relationships of Chilean A. platys strains with other Anaplasmataceae species are shown in Figure 2. GenBank accession no. for the groESL gene sequence of A. platys is EF201806 (corresponding to dogs 17, 23, and 25).

[FIGURE 2 OMITTED]

Conclusions

We identified A. platys DNA in the blood of 6 dogs with clinical signs indicative of ehrlichiosis. These findings support the conclusion that A. platys is an etiologic agent of canine ehrlichiosis in Chile.

Since its first report in the United States in 1978 (10), A. platys has been described in several countries as the etiologic agent of cyclic thrombocytopenia in dogs. A tick vector of A. platys has not been determined, although R. sanguineus is the most suspected species (2). Because R. sanguineus is the only tick species that infests dogs in Santiago (1), our results support the conclusion that this species is the vector of A. platys in Chile.

A wide range of clinical manifestations of canine cyclic thrombocytopenia has been described. Cases from the United States have been described as mild or asymptomatic (10), and cases from Spain have more severe symptoms (11), which also seems to be the case in Chile. This variability in clinical symptoms of infection has not been clearly associated with strain variations (11-13).

Low diversity was observed when groESL gene sequences of Chilean strains were compared with other A. platys strains available in GenBank. This finding has also been observed in strains from different geographic origins (13). Recent studies have shown more genetic variability when sequences of the gltA gene were used (11,12).

Evidence of the zoonotic potential zoonotic potential
n.
The potential for animal infections to be transmissible to humans.
 of A.platys is scarce. In Venezuela, a few symptomatic human cases have been diagnosed since 1992 by the presence of platelet morulae in blood smears (14). Monocytic and platelet morulae were reported in a 17-month-old girl with fever and rash (15). However, none of these cases have been confined by molecular assays. Further studies that investigate the pathogenic and zoonotic Zoonotic
A disease which can be spread from animals to humans.

Mentioned in: Zoonosis
 role of A. platys should be conducted.

Acknowledgments

We thank Marcelo Labruna for critical comments on the manuscript.

This study was supported by a grant from Universidad Santo Tomas, Chile.

References

(1.) Gonzalez-Acuna D, Guglielmone AA. Ticks (Acari: Ixodoidea: Argasidae, Ixodidae) of Chile. Exp Appl Acarol. 2005;35:147-63.

(2.) Sanogo YO, Davoust B, Inokuma H, Camieas JL, Parola P, Brouqui P. First evidence of Anaplasma platys in Rhipicephalus sanguineus (Acari: Ixodida) collected from dogs in Africa. Onderstepoort J Vet Res. 2003;70:205-12.

(3.) Lopez J, Castillo A, Munoz M, Hildebrand S. Hallazgo de Ehrlichia canis en Chile, informe preliminar. Archivos de Medicina Veterinaria. 1999;31:211-4.

(4.) Lopez J, Rivera M, Concha concha /con·cha/ (kong´kah) pl. con´chae   [L.] a shell-shaped structure.

concha of auricle
 JC, Gatica S, Loeffeholz M, Barriga O. Serologic evidence for human ehrlichiosis in Chile. Rev Med Chil. 2003;131:67-70.

(5.) Breitschwerdt EB, Hegarty BC, Hancock SI. Sequential evaluation of dogs naturally infected with Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia equi, Ehrliehia ewingii, or Bartonella vinsonii. J Clin Microbiol. 1998;36:2645-51.

(6.) Massung RF, Slater K, Owens J, Nicholson W, Mather T, Solberg V, et al. Nested PCR assay for detection of granulocytic granulocytic

pertaining to granulocytes.


granulocytic leukemia
see myelocytic leukemia.

granulocytic sarcoma
extramedullary growth of multiple, focal granulocytic neoplasm. They may be neutrophilic or eosinophilic.
 ehrlichiae. J Clin Microbiol. 1998;36:1090-5.

(7.) Kordick SK, Breitschwerdt EB, Hegarty BC, Southwick KL, Colitz CM, Hancock SI, et al. Coinfection with multiple tick-borne pathogens in a Walker Hound Walker hound

see treeing walker coonhound.
 kennel in North Carolina North Carolina, state in the SE United States. It is bordered by the Atlantic Ocean (E), South Carolina and Georgia (S), Tennessee (W), and Virginia (N). Facts and Figures


Area, 52,586 sq mi (136,198 sq km). Pop.
. J Clin Microbiol. 1999;37:2631-8.

(8.) Inokuma H, Fujii K, Okuda M, Onishi T, Beaufils JP, Raoult D, et al. Determination of the nucleotide sequences of heat shock operon groESL and the citrate synthase gene (gltA) of Anaplasma (Ehrlichia) platys for phylogenetic and diagnostic studies. Clin Diagn Lab Immunol. 2002;9:1132-6.

(9.) Chae JS, Foley JE, Dumler JS, Madigan JE. Comparison of the nucleotide sequences of 16S rRNA, 444 Ep-ank, and groESL heat shock operon genes in naturally occurring Ehrlichia equi and human granulocytic ehrlichiosis human granulocytic ehrlichiosis: see ehrlichiosis.  agent isolates from northern California. J Clin Microbiol. 2000;38:1364-9.

(10.) Harvey JW, Simpson CF, Gaskin gaskin

the muscular portion of the hindleg between the stifle and hock, corresponding to the human calf. The term is used in horses and sometimes dogs.
 JM. Cyclic thrombocytopenia induced by a Rickettsia-like agent in dogs. J Infect Dis. 1978;137: 182 8.

(11.) Aguirre E, Tesouro MA, Ruiz L, Amusategui I, Sainz A. Genetic characterization of Anaplasma (Ehrlichia) platys in dogs in Spain. J Vet Med B Infect Dis Vet Public Health. 2006;53:197-200.

(12.) de la Fuente De La Fuente is a common surname in the Spanish language meaning of the Source
  • Cristián de la Fuente
  • David De La Fuente
  • Juan Ramón de la Fuente
 J, Torina A, Naranjo V, Nicosia S, Alongi A, La Mantia F, et al. Molecular characterization of Anaplasma platys strains from dogs in Sicily, Italy. BMC (BMC Software, Inc., Houston, TX, www.bmc.com) A leading supplier of software that supports and improves the availability, performance, and recovery of applications in complex computing environments.  Vet Res. 2006;2:24.

(13.) Huang H, Unver A, Perez MJ, Orellana NG, Rikihisa Y. Prevalence and molecular analysis of Anaplasma platys in dogs in Lara. Venezuela. Brazilian Journal of Microbiology. 2005;36:211-6.

(14.) Arraga-Alvarado C, Palmar M, Parra O, Salas P. Fine structural characterisation of a Rickettsia-like organism in human platelets from patients with symptoms of ehrlichiosis. J Med Microbiol. 1999;48:991-7.

(15.) Arraga-Alvarado C, Montero-Ojeda M, Bernardoni A, Anderson BE, Parra O. Human ehrlichiosis: report of the 1st case in Venezuela. Invest Clin. 1996;37:35-49.

Address for correspondence: Katia Abarca, Infectious Diseases and Molecular Virology Laboratory, Marcoleta 391, Third Floor, Pontificia Universidad Catolica de Chile, Santiago, Chile; email: katia@med.puc.cl

Katia Abarca, * Javier Lopez, ([dagger])([double dagger]) Cecilia Perret, * Javier Guerrero, ([dagger]) Paula Godoy, * Ana Veloz, * Fernando Valiente-Echeverria, * Ursula Leon, * Constanza Gutjahr, ([dagger]) and Teresa Azocar *

* Pontificia Universidad Catolica de Chile, Santiago, Chile; [dagger] Faculty of Veterinary Medicine veterinary medicine, diagnosis and treatment of diseases of animals. An early interest in animal diseases is found in ancient Greek writings on medicine. Veterinary medicine began to achieve the stature of a science with the organization of the first school in the , Universidad Santo Tomas, Santiago, Chile; and [double dagger] Alcantara Veterinary Clinic, Santiago, Chile

Dr Abarca is a pediatrician and infectious disease Infectious disease

A pathological condition spread among biological species. Infectious diseases, although varied in their effects, are always associated with viruses, bacteria, fungi, protozoa, multicellular parasites and aberrant proteins known as prions.
 specialist and associate professor of pediatrics at the Pontificia Universidad Catolica de Chile School of Medicine. Her primary research interests include emerging infectious diseases, zoonotic diseases Zoonotic diseases
Diseases caused by infectious agents that can be transmitted between (or are shared by) animals and humans. This can include transmission through the bite of an insect, such as a mosquito.

Mentioned in: West Nile Virus
, pet infections, and pediatric pediatric /pe·di·at·ric/ (pe?de-at´rik) pertaining to the health of children.

pe·di·at·ric
adj.
Of or relating to pediatrics.
 vaccinology vac·ci·nol·o·gy
n.
The science or methodology of vaccine development.


vaccinology A nascent field of expertise related to the creation and deployment of vaccines; the field 'borrows' from epidemiology, immunology,
.
Table 1. Ehrlichia/Anaplasma spp. PCR primers used in this study

Ehrlichia/
Anaplasma spp.                             Primer sequence (5'
(primer type)          Primer                [right arrow] 3')

Ehrlichia spp.,       EHR-OUT1         CTGGCGGCAAGCCTAACACATGCCAACAT
  A. phagocyto-
  philum,
E. canis, E.          EHR-OUT2      GCTCGTTGCGGGACTTAACCCAACATCTCACGAC
  chaffeensis,
E. ewingii, A.
  platys (outer)
Ehrlichia spp.          GE2F               GTTAGTGGCATACGGGTGAAT
  (inner)            EHRL3-IP2             TCATCTAATAGCGATAAATC
A. phagocyto-           ge9f             AACGGATTATTCTTTATAGCTTGCT
  philum (inner)        ge2              GGCAGTATTAAAAGCAGCTCCAGG
E. canis, E.           HE3-R          CTTCTATAGGTACCGTCATTATCTTCCCTAT
  chaffeensis,
E. ewingii
  (inner)
E. canis (inner)      E. canis         CAATTATTTATAGCCTCTGGCTATAGGAA
E. chaffeensis     E. chaffeensis     CAATTGCTTATAACCTTTTGGTTATAAATA
  (inner)
E. ewingii           E. ewingii         CAATTCCTAAATAGTCTCTGACTATT
  (inner)
E. equi (inner)    E. equi-3-IP2        GTCGAACGGATTATTCTTTATAGCTTG
E. platys            EHRL3-IP2             TCATCTAATAGCGATAAATC
  (inner)            E. platys             GATTTTTGTCGTAGCTTGCTA
E. platys             EEgro1F             GAGTTCGACGGTAAGAAGTTCA
  (outer)             EEgro2R             CAGCGTCGTTCTTACTAGGAAC
A. platys               SQ3F               ATTAGCAAGCCTTATGGGTC
  (inner)               SQ5F               TCAGTGTGTGAAGGAAGTTG
                        SQ4R               CTTTAGGCTATCAAGAGATG
                        SUR                TGCTTCCTATGTTCTTATCG

Ehrlichia/
Anaplasma spp.
(primer type)       Region    Reference

Ehrlichia spp.,    16S rRNA      (5)
  A. phagocyto-
  philum,
E. canis, E.       16S rRNA      (5)
  chaffeensis,
E. ewingii, A.
  platys (outer)
Ehrlichia spp.     16S rRNA      (5)
  (inner)          16S rRNA      (5)
A. phagocyto-      16S rRNA      (6)
  philum (inner)   16S rRNA      (6)
E. canis, E.       16S rRNA      (5)
  chaffeensis,
E. ewingii
  (inner)
E. canis (inner)   16S rRNA      (5)
E. chaffeensis     16S rRNA      (5)
  (inner)
E. ewingii         16S rRNA      (5)
  (inner)
E. equi (inner)    16S rRNA      (5)
E. platys          16S rRNA     (57)
  (inner)          16S rRNA      (7)
E. platys           groESL       (8)
  (outer)           groESL       (8)
A. platys           groESL       (9)
  (inner)           groESL       (9)
                    groESL       (9)
                    groESL       (9)

Table 2. Nucleotide sequence differences among groESL genes from
different strains of Anaplasma platys

                                    Nucleotide position
                                        ([dagger])
                      Similarity,
Strain                    * %       591   1259   1271

A. platys Sommieres     100         G      A      C
A. platys Lara          100         -      -      -
A. platys RDC           100         -      -      -
A. platys Okinawa       100         -      -      -
A. platys Louisiana      99.7       -      G      T
Dog 17                   99.8       T      -      -
Dog 23                   99.8       T      -      -
Dog 25                   99.8       T      -      -

* Percentages of nucleotide sequence identities for 686-bp region
determined from pairwise alignment.

([dagger]) Nucleotide positions of A platys Sommieres strain, GenBank
accession no. AY0441621. -, same base as the type strain.
COPYRIGHT 2007 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2007, Gale Group. All rights reserved.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:DISPATCHES
Author:Abarca, Katia; Lopez, Javier; Perret, Cecilia; Guerrero, Javier; Godoy, Paula; Veloz, Ana; Valiente-
Publication:Emerging Infectious Diseases
Date:Sep 1, 2007
Words:2227
Previous Article:Norovirus and gastroenteritis in hospitalized children, Italy.
Next Article:Human metapneumovirus in children, Singapore.
Topics:



Related Articles
Canine coronavirus highly pathogenic for dogs.
Avian influenza (H5N1) susceptibility and receptors in dogs.
The last word.
Quick-spreading blaze guts duplex.
LETTERS IN THE EDITOR'S MAILBAG.
Molecular evidence for Anaplasma phagocytophilum in Israel.
Stray dogs and leishmaniasis in urban areas, Portugal.
American Inventor TV Show - Try These Inventions

Terms of use | Copyright © 2012 Farlex, Inc. | Feedback | For webmasters | Submit articles