Printer Friendly
The Free Library
7,774,290 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Anaplasma phagocytophilum, Sardinia, Italy.


To the Editor: Anaplasma phagocytophilum (formerly Ehrlichia phagocytophila), a tick-transmitted pathogen that infects several animal species, including humans (involved as accidental "dead-end" hosts), is the causative agent of human granulocytic granulocytic

pertaining to granulocytes.


granulocytic leukemia
see myelocytic leukemia.

granulocytic sarcoma
extramedullary growth of multiple, focal granulocytic neoplasm. They may be neutrophilic or eosinophilic.
 anaplasmosis (HGA HGA High-Gain Antenna
HGA Handweavers Guild of America
HGA Hammel Green and Abrahamson
HGA Hercules Graphics Adapter
HGA Homogentisic Acid
HGA Honor Guard Academy
HGA Holy Guardian Angels (Reading, PA catholic church) 
). It is a pathogen of veterinary importance responsible for tickborne fever of ruminants and for granulocytic anaplasmosis of horses and dogs (1,2). HGA was first described in the United States in 1994 (2) and is emerging in Europe (3). Although only 2 human cases have been reported in Italy (4), serologic se·rol·o·gy  
n. pl. se·rol·o·gies
1. The science that deals with the properties and reactions of serums, especially blood serum.

2.
 and molecular findings have shown A. phagocytophilum infections in dogs and Ixodes ricinus ticks (5). Incidence, prevalence, and public impact of HGA and horse granulocytic anaplasmosis are, therefore, unknown for this geographic area. From 1992 to 1996, an average rate of 13.4 cases/year/ 100,000 inhabitants of tick bite-related fever of unknown etiology has been reported on the island of Sardinia, Italy, which is considerably higher than the corresponding national average value of 2.1 cases/year/ 100,000 inhabitants. Moreover, 117 cases of tick bite related fever, whose etiology remains obscure, have been reported from 1995 to 2002 in the central west coast area of the island. Local newspapers occasionally report deaths as a result of tick bites, although no HGA-associated deaths have been documented in Europe.

This study investigated A. phagocytophihtm in Sardinia. From 2002 to 2004, veterinarians based on the central west coast of the island were instructed to collect EDTA EDTA: see chelating agents.  blood samples when a suspected case of tick bite related fever was found at their clinics. A total of 70 blood samples were collected from 50 dogs and 20 horses that showed tick infestation infestation /in·fes·ta·tion/ (-fes-ta´shun) parasitic attack or subsistence on the skin and/or its appendages, as by insects, mites, or ticks; sometimes used to denote parasitic invasion of the organs and tissues, as by helminths.  and symptoms consistent with tickborne disease, such as fever, anorexia, jaundice (only in horses), anemia, myalgia, and reluctance to move. Genomic DNA was extracted from the buffy coat obtained by centrifugation Centrifugation

A mechanical method of separating immiscible liquids or solids from liquids by the application of centrifugal force. This force can be very great, and separations which proceed slowly by gravity can be speeded up enormously in centrifugal
 of 2 to 4 mL of blood, as previously described (6). Furthermore, DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 was extracted from 50 Rhipicephalus sanguineus ticks removed from 30 dogs. Primers EphplgroEL(569)F (ATGGTATGCAGTTTGATCGC), EphplgroEL (1193) R (TCTACTCTGTCTTTGCGTTC), and EphgroEL(1142)R (TTGAGTACAGCAACACCACCGGAA) were designed and used in combination to generate a heminested polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) for the selective amplification of 573 bp of the groEL gene of A. phagocytophilum. The final 50 [micro]L PCR volume of the first PCR round contained 5 [micro]L of the DNA extraction, primers EphplgroEL (569)F and EphplgroEL(1193)R, and HotMaster Taq DNA polymerase (5u/[micro]L, Eppendorf) according to the manufacturer's basic protocol (Eppendorf AG, Hamburg, Germany). Heminested PCR was performed by using 5 [micro]L of each of the first PCR products and primer EphgroEL (1142)R. To confirm the PCR diagnosis, amplicons were digested with the HindIII restriction endonuclease (predicted digestion pattern: 3 fragments of 525 bp, 21 bp, and 27 bp). Anaplasma phagocytophilum DNA was obtained from strain NCH-1 and used as positive control in PCR reactions. Sequences were obtained by cloning the PCR products into the pCR2.1-TOPO vector (Invitrogen S.R.L., Milan, Italy) and using the ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA, USA), according to the protocols supplied by the manufacturers. Sequences (AY848751, AY848747) were aligned to the corresponding region of other species belonging to Rickettsiales by using ClustalX (7). Genetic distances among species were computed by the Kimura 2-parameters method by using MEGA, and were used to construct bootstrapped neighbor-joining trees (8).

Of 120 DNA samples, l tick, 3 dog, and 3 horse samples generated the predicted band of 573 bp representative of the groEL gene of A. phagocytophilum. HindIII digestions confirmed PCR diagnosis (see Appendix Figure, available at http://www.cdc. gov/ncidod/eid/vol11no08/05-0085 app.htm). Two different groEL sequence types were obtained from 1 dog and 1 horse and confirmed by BLAST (http://www.ncbi.nlm.nih. gov/Education/BLASTinfo/information3.html) queries as A. phagocytophilum groEL sequences (average identity 99%; average E value = 0), indicating that sequences did not reflect contamination. Bootstrapped neighbor-joining trees confirmed the identity of the new sequences obtained, which are closely related to HGA strains isolated in Europe and the United States (Figure).

The molecular approach applied in this study established A. phagocytophilum in an area of Sardinia characterized by a high prevalence of tick bite-related fever in humans and animal species. To our knowledge, this is the first evidence of A. phagocytophilum in Sardinian dogs and horses and the first documentation of infection in Italian horses caused by pathogenic strains. Therefore, these findings suggest the emergence of Anaplasma phagocytophilum in Italy. lxodes ricinus ticks are indicated as vectors transmitting A. phagocytophilum in Europe. Although only 0.3% of 4,086 ticks collected in 72 sites of Sardinia (9) have been identified as Ixodes, other tick species are better represented on the island (Rhipicephalus, 67.2%; Haemaphysalis, 24.1%; Dermacentor, 4.9%). A. phagocytophilum in 1 Rhipicephalus sanguineus could indicate a role of this tick in the epidemiology of HGA. Finally, these data indicate the presence of a potential threat to human and animal health and suggest activation of further epidemiologic surveillance and controls.

[FIGURE OMITTED]

Acknowledgment

We thank Sandra Edwards, University of Newcastle University of Newcastle can refer to:
  • Newcastle University, a university in the United Kingdom.
  • The University of Newcastle, a university in New South Wales, Australia
, UK, for critical reading and final editing of the manuscript.

References

(1.) Dumler JS, Barbet barbet

Any of about 75 species of tropical birds (family Capitonidae) named for the bristles at the base of their stout, sharp bill. They are big-headed and short-tailed, 3.5–12 in.
 AF, Bekker CPJ CPJ Committee to Protect Journalists
CPJ Citizens for Public Justice (Canada)
CPJ Center for Public Justice
CPJ Critical Path Job
CPJ Common Place Journal
CPJ Controlled Pipe Joints
CPJ Cooperative Programming in Java
CPJ Cd Project
, Dasch GA, Palmer GH, Ray SC, et al. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia, and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and 'HGA agent' as subjective synonyms of Ehrlichia phagocytophila. lnt J Syst Evol Microbiol. 2001;51: 2145-65.

(2.) Chen SM, Dumler JS, Bakken JS, Walker DH. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J Clin Microbiol. 1994;32:589-95.

(3.) Parola P. Tick-borne rickettsial diseases: emerging risks in Europe. Comp Immunol Microbiol Infect Dis. 2004;27:297-304.

(4.) Ruscio M, Cinco M. Human granulocytic ehrlichiosis human granulocytic ehrlichiosis: see ehrlichiosis.  in Italy: first report on two confirmed cases. Ann NY Acad Sci. 2003;990:350-2.

(5.) Manna L, Alberti A, Pavone LM, Scibelli A, Staiano N, Gravino AE. First molecular characterisation of a granulocytic Ehrlichia strain isolated from a dog in South Italy. Vet J. 2004;167:224-7.

(6.) Pusterla N, Huder J, Wolfensberger C, Litschi B, Parvis par·vis  
n.
1. An enclosed courtyard or space at the entrance to a building, especially a cathedral, that is sometimes surrounded by porticoes or colonnades.

2. One of the porticoes or colonnades surrounding such a space.
 A, Lutz H. Granulocytic ehrlichiosis in two dogs in Switzerland. J Clin Microbiol. 1997;35:2307-9.

(7.) Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The ClustalX windows interface: flexible strategies for multiple sequence alignment A multiple sequence alignment (MSA) is a sequence alignment of three or more biological sequences, generally protein, DNA, or RNA. In general, the input set of query sequences are assumed to have an evolutionary relationship by which they share a lineage and are descended from a  aided by quality analysis tools. Nucl Acid Res. 1997:25: 4876-82.

(8.) Kumar S, Tamura K, Jakobsen IB, Nei M. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics. 2001; 17: 1244-5.

(9.) Di Todaro N. Piazza C, Otranto D, Giangaspero A. Ticks infesting domestic animals in Italy: current acarological studies carried out in Sardinia and Basilicata regions. Parassitologia. 1999;41 (Suppl 1): 39-40.

Alberto Alberti, * Maria Filippa Addis, * Olivier Sparagano, ([dagger]) Rosanna Zobba, * Bernardo Chessa, * Tiziana Cubeddu, * Maria Luisa Pinna pinna /pin·na/ (pin´ah) auricle (1).pin´nal

pin·na
n. pl. pin·nae
See auricle.



pin
 Parpaglia, * Mauro Ardu, * and Marco Pittau *

* Universita degli Studi di Sassari, Sassari, Italy; ([dagger]) University of Newcastle, Newcastle upon Tyne Newcastle upon Tyne, city (1991 pop. 199,064) and metropolitan district, NE England, on the Tyne River. The city is an important shipping and trade center. The famous coal-shipping industry began in the 13th cent. , United Kingdom

Address for correspondence: Alberto Alberti, Istituto di Patologia Speciale e Clinica Medica medica (māˑ·dē·k  Veterinaria, Universita degli Studi di Sassari, Via Vienna 2, 07100 Sassari, Italy; fax: 39-079-229451; email: alberti@uniss.it
COPYRIGHT 2005 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2005, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:LETTERS
Author:Pittau, Marco
Publication:Emerging Infectious Diseases
Article Type:Letter to the Editor
Geographic Code:4EUIT
Date:Aug 1, 2005
Words:1222
Previous Article:Q fever and the US military.(LETTERS)
Next Article:Williamsia muralis pulmonary infection.(LETTERS)(Letter to the Editor)
Topics:



Related Articles
Anaplasma phagocytophilum, Babesia microti, and Borrelia burgdorferi in Ixodes scapularis, Southern Coastal Maine.(Dispatches)
Detection of Anaplasma phagocytophilum DNA in Ixodes ticks (Acari: Ixodidae) from Madeira Island and Setubal District, mainland Portugal.(Research)
Concomitant tickborne encephalitis and human granulocytic ehrlichiosis.(Dispatches)
Survey of tickborne infections in Denmark.(RESEARCH)
Anaplasma phagocytophilum in white-tailed deer.
Tickborne pathogen detection, Western Siberia, Russia.(RESEARCH)
Anaplasma phagocytophilum-infected ticks, Japan.(DISPATCHES)
Human granulocytic anaplasmosis and Anaplasma phagocytophilum.(PERSPECTIVE)
Borrelia burgdorferi and Anaplasma phagocytophilum Coinfection.(acute human granulocytic ehrlichiosis)
Febrile illness associated with Rickettsia conorii infection in dogs from Sicily.(DISPATCHES)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles