Printer Friendly
The Free Library
19,588,385 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Analysis of 2 Antiapoptotic Factors in Gliomas: bcl-2 Overexpression and p53 Mutations.


bcl-2 Overexpression and p53 Mutations

Cancer is produced by some alterations in mechanisms that control cell division and also by failures in mechanisms that regulate programmed cell death pro·grammed cell death
n.
See apoptosis.



programmed cell death

proposed system of cell death, often including poly(ADP)-ribosylation, ensures that a cell will not survive if it is so badly damaged that its recovery would harm the
, a process also known as apoptosis.[1] It can be induced by radiation, drugs, and any agent that causes damage in DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
. Primary apoptosis is started by a signal that comes into the genoma and leads into the activation of a group of "lethal" genes. The most important group of genes involved in apoptosis are myc myc  
n.
Any of a group of vertebrate oncogenes whose product, a DNA binding protein, is thought to promote the growth of tumor cells.



[Possibly from my(elo)c(ytomatosis virus).]
, interleukin-1 converting enzyme converting enzyme Angiotensin converting enzyme, see there  proteases, APO-1/Fas and p53 (stimulators), and bcl-2 (inhibitors). This process makes possible a balance between cells in division and cells that die.[2]

p53 is the most frequently mutated tumor suppressor gene tumor suppressor gene
n.
A gene that suppresses cellular proliferation. When inherited in a mutated state, it is associated with the development of various cancers, including most familial cancers. Also called antioncogene.
 in human cancers.[3] It is located in band 13 of the short arm of chromosome 17 (17p13)[4] and consists of 11 exons (10 of them are encodings); exons 5 to 8 are very well preserved in evolution.[5] p53 has 3 known functions: (1) inhibition of cell cycle in G1 phase, (2) induction of apoptosis, and (3) cellular differentiation.[2] p53 would intervene in apoptosis, inducing transcription and increasing the levels of different products, such as bax, a protein that counteracts bcl-2 action.[6] An interesting model for p53-induced apoptosis was proposed by Polyak et al[7]; it includes 3 steps: (1) the transcriptional induction of redox-related genes, (2) the formation of reactive oxygen species reactive oxygen species,
n molecules and ions of oxygen that have an unpaired electron, thus rendering them extremely reactive. Many cellular structures are susceptible to attack by ROS contributing to cancer, heart disease, and cerebrovascular disease.
, and (3) the oxidative degradation of mitochondrial mitochondrial

pertaining to mitochondria.


mitochondrial RNAs
a unique set of tRNAs, mRNAs, rRNAs, transcribed from mitochondrial DNA by a mitochondrial-specific RNA polymerase, that account for about 4% of the total cell RNA that
 component.

p53 mutations could play a role in pathogenesis[8,9] and progression'"[10,11] of gliomas; they correlate with histological grade[12,13] and prognosis. There is no agreement between those who consider that p53 mutations increase survival rates[14] and those who say that their presence represents a worse prognosis.[13,15] Others think that p53 mutations on their own cannot induce any of these effects.

The bcl-2 oncogene oncogene

Gene that can cause cancer. It is a sequence of DNA that has been altered or mutated from its original form, the proto-oncogene (see mutation). Proto-oncogenes promote the specialization and division of normal cells.
 was first obtained as the product of the translocation translocation /trans·lo·ca·tion/ (trans?lo-ka´shun) the attachment of a fragment of one chromosome to a nonhomologous chromosome. Abbreviated t.  between chromosomes 14 and 18 in (q23: q21).[16] Its essential function is direct inhibition of apoptosis: bcl-2 can cooperate with myc, immortalizing tumor cells, or with r-ras; it can also interact with other proteins of its own family, such as bax.[17]

bcl-2 can be overexpressed in glioblastomas.[18] Krishna et al[19] found bcl-2 overexpression in gliomas of any histological grade. Alderson et al[20] found an association between bcl-2 and p53 immunohistochemical overexpression.

p53 mutations, which represent the absence of an important inductor inductor, electric device consisting of one or more turns of wire and typically having two terminals. An inductor is usually connected into a circuit in order to raise the inductance to a desired value.  of apoptosis, and bcl-2 overexpression, a potential mechanism by which tumor cells escape p53-mediated apoptosis,[21] can be considered as 2 antiapoptotic factors.

Reports about the role of p53 in human gliomas are contradictory; only a few studies can be found about bcl-2, and there are even fewer references about the possible interactions between them. Herein, we investigate the possible correlation and the clinicopathologic implications of these 2 factors in 61 human gliomas, using immunohistochemical and molecular methods.

MATERIALS AND METHODS

Information on 61 glial tumors (21 astrocytomas, 9 anaplastic an·a·plas·tic
adj.
1. Relating to the surgical restoration of a lost or absent part.

2. Of, relating to, or characterized by cells that have become less differentiated.



anaplastic

1.
 astrocytomas, 29 glioblastomas, 1 oligodendroglioma oligodendroglioma /ol·i·go·den·dro·gli·o·ma/ (-den?dro-gli-o´mah) a neoplasm derived from and composed of oligodendrocytes in varying stages of differentiation.

ol·i·go·den·dro·gli·o·ma
n.
, and 1 oligoastrocytoma), corresponding to 61 patients from whom enough clinical data and follow-up information were available, was recovered from the files of the Department of Pathology, University Hospital, Santiago, Spain, between 1992 and 1997. The specimens were fixed in buffered formalin formalin /for·ma·lin/ (for´mah-lin) formaldehyde solution.

for·ma·lin
n.
An aqueous solution of formaldehyde that is 37 percent by weight.
 and paraffin embedded.

Four-micrometer sections from paraffin blocks were obtained for routine staining (hematoxylin-eosin) and immunohistochemical procedures (streptavidin-biotin-peroxidase complex), by using the monoclonal antibodies p53; clon DO-7, which reacts with mutated and wild-type p53 (Dako, Glostrup, Denmark), diluted 1:50; and bcl-2, clon 124 (Dako), diluted 1:5. Tumors were diagnosed according to World Health Organization (WHO) classification,[22] although only tumor grade was considered for statistical analysis, because this is a better way to compare different tumors with the same nature.

Quantification of p53 immunostaining was made by using an automatic cell counting system (CAS-200, Becton-Dickinson, Leiden, The Netherlands). This system enables the measurement of the percentage of cells stained for a nuclear marker on tissue sections. One hundred cells with a magnification of 400 were counted. Samples from ductal invasive carcinoma of the breast, with p53 mutations demonstrated by single-strand conformational polymorphism (SSCP (1) (System Services Control Point) A controlling program in an SNA domain. It resides in the host and is a component within VTAM. See also SCCP. ) and sequencing and with more than 50% of positive nuclei for p53 by immunohistochemistry, were used as positive controls.

Quantification of bcl-2 immunostaining was made by counting of 100 cells with a magnification of 400. Positivity was expressed in percentage of cells with cytoplasmic cytoplasmic

pertaining to or included in cytoplasm.


cytoplasmic inclusions
include secretory inclusions (enzymes, acids, proteins, mucosubstances), nutritive inclusions (glycogen, lipids), pigment granules (melanin, lipofuscin,
 staining. Lymph nodes Lymph nodes
Small, bean-shaped masses of tissue scattered along the lymphatic system that act as filters and immune monitors, removing fluids, bacteria, or cancer cells that travel through the lymph system.
 with follicular lymphoma follicular lymphoma
n.
See nodular lymphoma.


follicular lymphoma Follicle center lymphoma A heterogeneous group of NHLs arising in follicular center cells, which comprises 50% of all NHLs in adults–US,
, with more than 50% of positive cells for bcl-2, were used as positive controls.

Ten-micrometer sections were also obtained, and appropriate areas from tumor parenchyma Parenchyma

A ground tissue of plants chiefly concerned with the manufacture and storage of food. The primary functions of plants, such as photosynthesis, assimilation, respiration, storage, secretion, and excretion—those associated with living
 were selected by light microscopy and microdissected for DNA extraction. Necrotic areas were avoided. Digestion with proteinase proteinase /pro·tein·ase/ (pro´ten-as?) endopeptidase.

pro·tein·ase
n.
A protease that begins the hydrolytic breakdown of proteins usually by splitting them into polypeptide chains.
 K without ionic detergents followed by boiling was used as the extracting DNA method? During the extracting process, HLA-DQ HLA-DQ HLADC Histocompatibility Type [Alpha] was used as a control of viable DNA. Polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  amplification of p53 exons 5 to 8 was performed: for a reaction of 25 [micro]L, 2 [micro]L of extracted DNA was added to a mix of 10 mmol/L HC1 (hydrochloric acid hydrochloric acid: see hydrogen chloride.
hydrochloric acid
 or muriatic acid

Solution in water of hydrogen chloride (HCl), a gaseous inorganic compound.
; pH 8.3), 50 mmol/L KC1 (potassium chloride potassium chloride, chemical compound, KCl, a colorless or white, cubic, crystalline compound that closely resembles common salt (sodium chloride). It is soluble in water, alcohol, and alkalies. ), 1.5 mmol/L Mg[Cl.sub.2] (magnesium chloride magnesium chloride Warning - High-alert drug!

Chloromag, Mag 64, Mag Delay, Slo-Mag

Pharmacologic class: Mineral

Therapeutic class:
), 200 mmol/L of each dNTP (dinucleotide dinucleotide /di·nu·cleo·tide/ (di-nldbomack´le-o-tid?) one of the cleavage products into which a polynucleotide may be split, itself composed of two mononucleotides.

di·nu·cle·o·tide
n.
 triphosphate triphosphate /tri·phos·phate/ (tri-fos´fat) a salt containing three phosphate radicals.

tri·phos·phate
n.
A salt or ester containing three phosphate groups.
), and 1.25 U of Taq-polymerase (TaqBead Hot Start Polymerase, Promega). Primers and amplification conditions are described in Table 1. A screening of mutations was performed through SSCP analysis using an automatic electrophoresis system (Phast System, Pharmacia) followed by a silver staining method for the detection of amplified products.[24] A sample of normal tissue for each exon Exon

In split genes, a portion that is included in the ribonucleic acid (RNA) transcript of a gene and survives processing of the RNA in the cell nucleus to become part of a spliced messenger RNA (mRNA) or structural RNA in the cell cytoplasm.
 studied was used as a negative control.

Table 1. Primers and Amplification Conditions
Amplification conditions

      95 [degrees] C       30 s
      66 [degrees] C       45 s          40 cycles
      72 [degrees] C        1 min 30 s

Primers
   5     5' TTCCTCTTCCTACAGTACTC 3
         5' GCAAATTTCCTTCCACTCG 3'
   6     5' CCATGAGCGCTGCTCAGAT 3'
         5' AGTTGCAAACCAGACCTCAG 3
   7     5' GTGTTATCTCCTCGGTTGGC 3
         5' CAAGTGGCTCCTGACCTGGA 3
   8     5' CTGCCTCTTGCTTCTCTTTT 3
         5' GAGGCAAGGAAAGGTGATAA 3


Any grade of nuclear staining for p53 was considered a positive result. For bcl-2, we considered those cases with more than 5% of cells with cytoplasmic immunoreactivity as positive per Alderson et al.[20] p53 mutations were identified by an abnormal migration pattern on SSCP gels.

Clinical and pathological data were also registered: histological type (WHO 1993) and histological grade (2, 3, or 4) (both of which may be considered the major variables, because in the central nervous system grade is the stage), age, sex, tumor size (in centimeters), tumor location (considering 3 categories: supratentorial lateral, supratentorial medial, and infratentorial [the most used criterion is the distinction between superficial and deep gliomas]; we think that the 3-category scheme proposed in this study could be useful and reproducible for statistical analysis, because a glioma glioma /gli·o·ma/ (gli-o´mah) a tumor composed of neuroglia in any of its states of development; sometimes extended to include all intrinsic neoplasms of the brain and spinal cord, as astrocytomas, ependymomas, etc.  of right basal nuclei [supratentorial lateral] does not behave as a brainstem tumor [infratentorial], and both are deep gliomas), and survival (in months). Treatment was considered in the multivariant analysis, although the study was not prospective and patients were not homogeneously distributed for treatments (categories for treatment were surgery only, surgery with radiotherapy or chemotherapy, and radiotherapy or chemotherapy only). Patient follow-up ranged from 1 to 71 months (mean, 18.5 [+ or -] 19.5 months), and for those who were alive at the end of the study, it ranged from 3 to 71 months.

For statistical purposes, age and size were considered quantitative variables. Sex, p53 and bcl-2 immunoreactivity, and p53 mutations were considered as 2-category qualitative variables and grade, location, and treatment as more than 2-category qualitative variables. Bivariant analysis was made to test the relation between qualitative variables by using the Pearson [chi square chi square (kī),
n a nonparametric statistic used with discrete data in the form of frequency count (nominal data) or percentages or proportions that can be reduced to frequencies.
] test. Yates correction for continuity was used for those cases with expected effectiveness lower than 5. Analysis of variance was used to study the relations between quantitative and qualitative variables with more than 2 categories, and Student's t test allowed the analysis of the relations between quantitative and qualitative variables with 2 categories. Kaplan-Meier analysis was performed as a first approach to study significant variables in survival. Cox multivariant regression for survival was used to rule out confusion factors or interactions between variables. The statistical analysis was made by using SPSS A statistical package from SPSS, Inc., Chicago (www.spss.com) that runs on PCs, most mainframes and minis and is used extensively in marketing research. It provides over 50 statistical processes, including regression analysis, correlation and analysis of variance.  6.1 for Windows?

RESULTS

Thirty-two (53%) of the 61 patients were male, and 29 (47%) were female. Average age was 52.9 [+ or -] 18.3 years (mean [+ or -] SD). Considering the histologic grade, 23 (37.7%) were grade 2 gliomas, 9 (14.8%) grade 3 gliomas, and 29 (47.5%) grade 4 gliomas. Fifty-four tumors (88.0%) were located at the cerebral hemispheres (supratentorial lateral); 3 (5.0%) (a grade 2 glioma in a patient aged 34 years, a grade 3 glioma in a patient aged 14 years, and a grade 4 glioma in a patient aged 51 years) were supratentorial and medial; and 4 (6.5%) (a grade 2 glioma in a patient aged 15 years, 2 grade 3 gliomas in patients aged 12 and 44 years, and a grade 4 glioma in a patient aged 49 years) were infratentorial. Average size of the tumors was 4.2 [+ or -] 1.4 cm. The tumors were measured by computed tomographic scan and magnetic resonance magnetic resonance, in physics and chemistry, phenomenon produced by simultaneously applying a steady magnetic field and electromagnetic radiation (usually radio waves) to a sample of atoms and then adjusting the frequency of the radiation and the strength of the  images. Forty-one patients (67%) died during this period, 37 (40.2%) because of their tumors. Survival rates were as follows: 52.2 months for patients with grade 2 tumors, 24.0 months for patients with grade 3 gliomas, and 8.3 months for grade 4 gliomas.

bcl-2 Immunoreactivity

bcl-2 was also studied in the 61 cases. Thirty-four cases (57%) were positive (Figure 1) and 27 (43%) negative. Distribution of bcl-2 immunoreactivity is showed in Table 2. bcl-2 was not related to age, sex, histological grade, tumor location, or tumor size.

[Figure 1 ILLUSTRATION OMITTED]

Table 2. Distribution of BCL-2 Immunoreactivity in Gliomas
Grade     No. of Cases   bcl-2 Positive   bcl-2 Negative

2              23              10               13
3               9               6                3
4              29              18               11
Total          61              34               27


p53 Immunoreactivity

p53 immunoreactivity was studied in the 61 cases. Thirty-four (56%) were positive (Figure 2) and 27 (44%) negative. Distribution of p53 immunoreactivity is showed in Table 3.

[Figure 2 ILLUSTRATION OMITTED]

Table 3. Distribution of p53 Immunoreactivity in Gliomas
Grade     No. of Cases   p53 Positive   p53 Negative

2              23             13             10
3               9              5              4
4              29             16             13
Total          61             34             27


p53 was not related to age, sex, or tumor size. But p53 immunoreactivity increased with histological grade and when tumors were supratentorial and lateral.

p53 Mutations

A study of p53 mutations was made by means of SSCP analysis. Ten cases (17%) showed an abnormal migration pattern in any of the 4 exons studied (5 to 8). Sequencing demonstrated that all of them were mutations. Two of the mutations were in exon 5, 5 in exon 6, 2 in exon 7, and 1 in exon 8. Five of the mutations corresponded to glioblastomas, 2 in grade 3 gliomas and 3 in grade 2 gliomas.

p53 mutations were not related to the studied parameters (age, sex, histological grade, or tumor location, and tumor size).

p53 and bcl-2

bcl-2 immunoreactivity was not related to p53 immunoreactivity using [chi square] test. The same test was used and the same results were obtained when p53 mutations detected by SSCP and bcl-2 immunoreactivity were compared. Twenty-six cases (42%) showed p53 immunoreactivity without p53 mutations. No relation was found when we compared cases with immunoreactive immunoreactive

exhibiting immunoreactivity.
 and nonmutated p53 and cases positive for bcl-2.

Clinicopathologic Parameters and Survival

Survival was related to tumor grade, location, and size. The relative risk of death for grade 3 gliomas was 4.2 times higher than for grade 2 gliomas (95% confidence interval [CI], 2.4 [+ or -] 9.1), and the risk increased when we compared grade 4 and grade 2 gliomas; in the last case, the relative risk for death was 13.5 times higher (95% CI, 7.2 [+ or -] 29.5). The relative risk of death for supratentorial lateral gliomas was 4.1 times higher than for infratentorial ones (95% CI, 1.1 [+ or -] 12.5) (P = .0123). This result could be due to the different proportion of glioblastomas in the supratentorial lateral group (50%) in contrast to the infratentorial group (25%). It also could reinforce the usefulness of the WHO grading system as a way of comparison for gliomas of different anatomic location.

Survival was related to size (P = .0228). An increase of 1 cm in tumor size represents an increase in relative risk of death of 1.1 times (95% CI, 1.02 [+ or -] 1.07). There were no differences in survival for bcl-2, p53 immunoreactivity, p53 mutations, or sex.

Cox regression was made to identify independent prognostic variables. We found that only age, treatment, histological grade, and tumor size were significant. Age may not be considered a real prognostic factor; survival depends on age, obviously, and most of glioblastomas occur in old patients. Neither treatment can be considered: it shows a slight correlation with survival, but the design of the study cannot define any treatment as the best. So the only real and significant variables for survival in the study were histological grade and tumor size.

COMMENT

Six internal molecular mechanisms are believed to intervene in carcinogenesis car·ci·no·gen·e·sis
n.
The production of cancer.



carcinogenesis

production of cancer.


biological carcinogenesis
viruses and some parasites are capable of initiating neoplasia.
: (1) increase in cellular proliferation, (2) activation of oncogenes oncogenes

1. genes carried by tumor viruses that are directly and solely responsible for the neoplastic transformation of host cells. Many oncogenes function after integration into the DNA of the host cell and some up-regulate normal downstream host cell genes to cause neoplasia.
 and inactivation inactivation /in·ac·ti·va·tion/ (in-ak?ti-va´shun) the destruction of biological activity, as of a virus, by the action of heat or other agent.  of tumor suppressor genes, (3) alterations in the regulation of cell cycle, (4) alterations in the control of apoptosis, (5) alterations in the control of cellular differentiation, and (6) genetic instability. Some alterations related to these pathways in gliomas are epidermal growth factor receptor This article is about a cell suface receptor. For estimated measure of kidney function (eGFR), see Glomerular filtration rate.
The epidermal growth factor receptor
 overexpression, mutations of Rb gene, loss of p15 and p16, and loss of apoptosis regulation. Overexpression of bcl-2 oncogene and overexpression and mutations of p53 tumor suppressor gene might be related to the first 4 mechanisms. So, the study of these 2 antiapoptotic factors could be essential to make a hypothesis about etiopathogeny, progression, prognosis, and response to therapy of glial tumors. Several hypotheses have been made to explain glial glial /gli·al/ (gli´'l) of or pertaining to the neuroglia.

glial

of or pertaining to glia or neuroglia.


glial limitans
a dense network of glial processes at the pia mater.
 tumorigenesis tumorigenesis /tu·mor·i·gen·e·sis/ (-jen´e-sis) oncogenesis.

tu·mor·i·gen·e·sis
n.
Formation or production of tumors.
 and evolution. The first one was established for glioblastomas by Van Meyel et al.[14] They said that low-grade astrocytomas that progress to higher grades do so along 2 distinct clinicopathologic pathways: either stepwise stepwise

incremental; additional information is added at each step.


stepwise multiple regression
used when a large number of possible explanatory variables are available and there is difficulty interpreting the partial regression
 to anaplastic glioma then glioblastoma glioblastoma /glio·blas·to·ma/ (gli?o-blas-to´mah) any malignant astrocytoma.

glioblastoma multifor´me
 (marked by p53 mutations, p53 immunoreactivity, and DNA nondiploidy) or directly to glioblastoma (with absence of p53 mutations or immunoreactivity). Four aspects must be considered in the making of an etiopathogenetic hypothesis of glial tumorigenesis and evolution based on the antiapoptotic factors bcl-2 and p53: (1) frequency and characteristics of p53 and bcl-2 immunodetection and p53 mutations in human gliomas; (2) possible correlation of these parameters with other clinicopathological variables, with special emphasis on survival; (3) rate of concordance concordance /con·cor·dance/ (-kord´ins) in genetics, the occurrence of a given trait in both members of a twin pair.concor´dant

con·cor·dance
n.
 between p53 immunoreactivity and p53 molecular detection; and (4) possible interactions of bcl-2 overexpression and p53 overexpression and mutations, as antiapoptotic factors, in the evolution of gliomas.

bcl-2 Immunoreactivity

We have not found any relation between bcl-2 and any of the parameters studied, although a relation between bcl-2 and low-grade astrocytomas has been described.[26,27] Other authors found bcl-2 overexpression in any grade of glial tumors. Nobody, including us, has found any unequivocal influence of bcl-2 in survival of gliomas (Figure 3).

[Figure 3 ILLUSTRATION OMITTED]

p53 Immunoreactivity

In our study, 34 gliomas (56%) were immunoreactive for p53 (10 cases were p53 mutations, and 24 cases had p53 overexpression). The results are similar to those of other authors.[28-32] All of them are about a 50% of immunopositive cases, and they also consider positive any grade of p53 immunoreaction im·mu·no·re·ac·tion
n.
See immune reaction.



immu·no·re·active adj.
 (the most commonly used thresh thresh  
v. threshed, thresh·ing, thresh·es

v.tr.
1.
a. To beat the stems and husks of (grain or cereal plants) with a machine or flail to separate the grains or seeds from the straw.
 old). Ahmed Rasheed et al[28] found only 14 positive cases in their wide series of 120 tumors, but they use a threshold of positivity of 10%. Van Meyel et al[14] and Pollack et al[29] obtained percentages higher than 65%, but the first authors obtained these results in low-grade astrocytomas and the second authors in high-grade gliomas of childhood; both studies examined fewer than 30 cases.

We have not found any relation between p53 immunoreactivity and age, sex, tumor size, or survival (Figure 4). Nevertheless, p53 immunoreactivity increases along with histological grade (this is widely represented in the literature[31-.35]) and also with a supratentorial location. Both features (higher levels in glioblastomas and in supratentorial lateral tumors, which are mainly glioblastomas) may suppose that p53 protein alterations should be a late event in gliomas evolution, as Fults et al[36] and Wu et al[37] have pointed out.

[Figure 4 ILLUSTRATION OMITTED]

Although some authors consider that p53 immunopositivity implies a worse prognosis (Soini et al[13] Jaros et al,[15] Haapasalo et al[31]), most studies consider that immunodetection, as an isolated factor, has no prognostic significance (Cunningham et al,[38] Bhattacharjee et al,[39] Ahmed Rasheed et al,[28] Koga et al[32]. The use of antibodies that detect both the wild-type and mutated p53 protein (CM-1 and DO-7) makes it difficult to draw conclusions from these results, since detection of p53 overexpression is not always associated with mutations.

p53 Mutations

Of 61 cases studied, 10 (16%) showed mutations by SSCP analysis, frequently in exon 6 (5 cases) and in glioblastomas (5 of 10 total mutations). The results of mutations in literature are heterogeneous. Three groups can be considered: those who find a high percentage of cases with mutations (more than 50%),[14,40,41] others who detect a range between 30% and 50%,[8,29,32,41] and another group, who find between 10% and 30% of mutations,[30,37,42-44] With a percentage of detection of 16%, we are in this last group. Divergences can be explained by the heterogeneity in the series (authors with a high percentage of mutations study only a few cases). However, the average of mutations can be placed at 35%, higher than ours (16%). The small number of mutations in this study could be explained by DNA degradation of samples. A wide agreement exists about the devastating dev·as·tate  
tr.v. dev·as·tat·ed, dev·as·tat·ing, dev·as·tates
1. To lay waste; destroy.

2. To overwhelm; confound; stun: was devastated by the rude remark.
 effect of overfixation in formalin for DNA.[45] Even with standardized procedures of fixation, the effect of formalin in small biopsy specimens (as is the case with many brain samples) could diminish the quality of DNA and, therefore, the detection of p53 mutations. The absence of an accurate method of selection of tumor cells in tissues could also explain this point.

No relation was found between p53 mutations and any of the clinicopathologic parameters studied (Figure 5). Survival has been the main parameter analyzed in most series: there are contradictory conclusions about the prognostic significance of p53 mutations detected by SSCE SSCE Solid Surface Combustion Experiment (NASA)
SSCE Smurfit-Stone Container Enterprises (Chicago, IL)
SSCE Swiss Society for Chemical Engineering
SSCE Space Station Core Equipment
 Fults et al[36] consider that gliomas have an equivalent evolution to colonic carcinoma (p53 mutations indicate an increasing grade of malignancy), so p53 mutations should be an essential event in gliomas progression. For Del Arco et al,[46] mutations are an early event. In addition, other authors[29,32,42] think that they are not necessary for gliomas evolution. Perhaps these divergent opinions could convey the idea that p53 mutations are not useful to predict survival in all patients with gliomas as an isolated factor, but they could be an important event when they are associated with other genetic alterations. The recent discovery of P-TEN,[47,48] a new tumor suppressor gene of glioblastomas, and genetic abnormalities that will be discovered in the future should be able to explain the real importance of p53 mutations in the evolution and progression of many types of gliomas.

[Figure 5 ILLUSTRATION OMITTED]

Comparison Between p53 Immunohistochemistry and p53 Molecular Detection

Twenty-six (45%) of the 61 cases showed p53 immunoreactivity without p53 mutations. Normal p53 has a short average life (less than 20 minutes), and it is usually undetectable in normal tissues. When there is a mutation in p53 gene, levels of p53 protein increase by means of a mechanism of posttransductional stabilization or because of conformational changes,[30,41] which allows the immunohistochemical detection of p53.[50] Detection of p53 protein in absence of mutations needs to be explained. Wynford-Thomas[51] says that p53 immunoreaction without mutations is a consequence of alteration of p53 function, with a loss of the target that joins and degrades p53. The simple loss of p53 normal function[50,52,53] is another explanation for this phenomenon. Other authors[35,41] think that the increase in half-life could be an effect when p53 joins to other proteins, such as viral (simian vacuolating virus No. 40, human papilloma virus human papilloma virus
n. Abbr. HPV
A DNA virus of the genus Papillomavirus, certain types of which cause cutaneous and genital warts in humans, including condyloma acuminatum.
 6) or cellular (MDM-2) products. Van Meyel et al[14] consider that the abnormal expression of p53 wild-type protein is enough to explain the evolution of gliomas. However, this hypothesis requires a large series of recurrent gliomas, and it has not been proved yet. An interesting observation is that overexpression of normal p53 protein could be a response to DNA damage.[32,52] Our results agree with this observation: we found higher p53 levels in glioblastomas (high-grade tumors), which are supposed to have a greater amount of genetic abnormalities and, therefore, more damage on DNA, regardless the presence of p53 mutations.

Correlation in detection of p53 mutations was poor: of the 61 gliomas studied, only 7 (11.5%) had p53 mutations and were p53 immunoreactive. Twenty-seven (51%) were immunoreactive and had no mutations. In addition, 3 gliomas with mutations were negative for p53. The proportion of concordant cases was 16.4%. Although the results of molecular analysis may reflect other underlying mechanisms, it is necessary to know if there are important differences in rates of detection between immunohistochemistry and mutational analysis. Some authors[14,31,54] find a high concordance (45% or more). Kyritsis et al[54] suggest that concordance is high when the percentage of p53 immunoreactive cells within the tumor is greater than 5%. Anyway, this problem has a difficult solution: it is necessary to study bigger series to obtain valid conclusions. It is also necessary to use more refined methods for selection of tumor cells in tissues (as new microdissection procedures), mainly in small samples with a high percentage of normal cells.

p53 and bcl.2 Coexpression: Results and Implications

No relation was found between bcl-2 overexpression and p53 immunodetection. It seems that DNA damage could increase p53 levels, and it has been proved that overexpression of normal p53 protein can induce apoptosis.[55,56] Overexpression of bcl-2 is probably one of the most important mechanisms by which tumor cells escape p53 mediated-apoptosis. So there should be a relation between overexpressed (mutated) p53 and bcl-2, because both of them could act as antiapoptotic factors. Our statistical study did not confirm the relation. The same happened when we compared cases with overexpressed and nonmutated p53 with cases positive for bcl-2. However, Alderson et al[20] found, in their study of 28 gliomas, that bcl-2-positive tumors were frequently immunoreactive for wild-type p53, using the antibody Pab 1801, which reacts only with wild-type p53. They suggested that the functional nature of p53, and not its level, was the factor that determined the need to block apoptosis. The absence of this correlation leads us to suggest that p53 and bcl-2 overexpression may not act at the same time in the apoptosis blockade in gliomas. This fact has also been pointed by Ehrmann et al.[57] For these authors, p53 and bcl-2 would be important events in astroglial tumors survival, but p53 should be a prognostic factor only in glioblastomas and bcl-2 only in low-grade astrocytomas. In addition, Carrol et al[58] described the absence of correlation between bcl-2 expression and apoptosis in their study of 59 gliomas: whereas apoptotic indices were higher in glioblastomas, bcl-2 expression was similar in all grades of astrocytic as·tro·cyte  
n.
A star-shaped cell, especially a neuroglial cell of nervous tissue.



astro·cyt
 tumors. Although p53 overexpression probably indicates a damage to DNA, there should be other factors different to p53 mutations or overexpression that intervene also with bcl-2 to make cells escape from the apoptosis mediated by p53. In contrast to Alderson et al,[20] we think that p53 and bcl-2 overexpression follow different pathways in the process of apoptosis in glial tumors: bcl-2 overexpression should be an early fact (as the frequent and similar distribution between different types of gliomas indicates), whereas p53 overexpression should be a late event (its frequency increases with tumor grade), demonstrating the damage and molecular alterations that happen in cellular DNA when a tumor increases its malignancy. Therefore, these 2 antiapoptotic factors would not act together in the progression of gliomas. Future investigations of new oncogenes and tumor suppressor genes (such as P-TEN studies that are been carried out in glioblastomas[59, 60]) will improve our knowledge of the mechanisms, consequences, and clinical implications of the apoptosis alterations in these tumors.

References

[1.] Kerr JFR JFR Jet-Fuel Resistant
JFR Joint Funding Resolution
JFR Justice of Federal Reconnaissance
JFR Joint Functional Requirements
JFR Joint Fundraising Representative
, Wyllie AH, Currie AR. Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer. 1972;26:239-257.

[2.] Ashwell J. Coming to terms with death: apoptosis in cancer and immune development. Immunol Today. 1994; 15:147-151.

[3.] Harris CC. p53 tumor suppressor gene: from the basic research laboratory to the clinician abridged historical perspective. Carcinogenesis. 1996;17:11871198.

[4.] Levine AJ, Momand J, Finlay CA. The p53 tumor suppressor gene. Nature. 1991; 351:453-456.

[5.] Montenarh M. Biochemical properties of the growth suppressor/oncoprotein p53. Oncogene. 1993;7:1673-1680.

[6.] Selvakumaran M, Lin HK, Miyoshita T, et al. Immediate early up-regulation of bax expression by p53 but not TGF TGF transforming growth factor. [Beta]1: a paradigm for distinct apoptotic pathways. Oncogene. 1994;9:1791-1798.

[7.] Polyak K, Xia Y, Zweler JL, Kinzler KW, Vogelstein B. A model for p53induced apoptosis. Nature. 1997;389:300-305.

[8.] Von Deimling A, Eibl RH, Ohgaki H, et al. P53 mutations are associated with 17p allelic al·lele  
n.
One member of a pair or series of genes that occupy a specific position on a specific chromosome.



[German Allel, short for Allelomorph, allelomorph, from English
: loss in grade II and grade III astrocytoma grade III astrocytoma
n.
See astroblastoma.
. Grocer Res. 1992;52: 2987-2990.

[9.] Aka K, Brunet JM, Bondy ML, et al. Detection of p53 alterations in human astrocytomas using frozen tissue sections for PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
. J Neurooncol. 1993;16:125-133.

[10.] Karamitopoulou E, Perentes E, Diamantis Y. P53 protein expression in central nervous system tumors: an immunohistochemical study with CM1 polyvalent polyvalent /poly·va·lent/ (-va´lent) multivalent.

pol·y·va·lent
adj.
1. Acting against or interacting with more than one kind of antigen, antibody, toxin, or microorganism.

2.
 and DO-7 monoclonal antibodies. Acta Neuropathol. 1993;85:611-616.

[11.] Ng HK, Lo SY, Huang DP, Poon poon  
n.
Any of several trees of the genus Calophyllum, of southern Asia, having light hard wood used for masts and spars.



[Sinhalese p
 WS. Paraffin section P53 protein immunohistochemistry in neuroectodermal tumors. Pathology 1994;26:1-5.

[12.] Ellison DW, Gatter KC, Steart PV, et al. Expression of the P53 protein in a spectrum et astrocytic tumors. J Pathol. 1992;168:38:1-386.

[13.] Soini Y, Niemela A, Kamel D, et al. P53 immunohistochemical positivity as a prognostic marker in intracranial intracranial /in·tra·cra·ni·al/ (-kra´ne-al) within the cranium.

in·tra·cra·ni·al
adj.
Within the cranium.
 tumors. APMIS APMIS Acta Pathologica, Microbiologica et Immunologica Scandinavica
APMIS Automated Project Management Information System
APMIS Automated Project Management System
. 1994;102:786-792.

[14.] Van Meyel DJ, Ramsay DA, Casson AG, et al. P53 mutation, expression, and DNA ploidy ploidy

Number of sets of chromosomes in the nucleus of a cell. In normal human body cells, chromosomes exist in pairs, a condition called diploidy. During meiosis the cell produces sex cells (gametes), each containing half the normal number of chromosomes, a condition called
 in evolving gliomas: evidence for two pathways of progression. J Natl Cancer Inst. 1994;86:1011-1017.

[15.] Jaros E, Perry RH, Adam L, et al. Prognostic implications of P53 protein, epidermal growth factor receptor, and Ki-67 labelling in brain tumors. Br J Cancer. 1992;66:373-375.

[16.] Tsujimoto Y, Finger RL, Yunis J, et al. Cloning of the chromosomal breakpoint The location in a program used to temporarily halt the program for testing and debugging. Lines of code in a source program are marked for breakpoints. When those instructions are about to be executed, the program stops, allowing the programmer to examine the status of the program  of neoplastic neoplastic /neo·plas·tic/ (ne?o-plas´tik)
1. pertaining to a neoplasm.

2. pertaining to neoplasia.


neoplastic

pertaining to neoplasia or a neoplasm.
 B-cells with the (14-18) chromosome translocation. Science. 1984;226:1097-1099.

[17.] Hanada M, Aime-Sempe C, Sate T, et al. Structure-function analysis of bcl-2 protein. Identification of conserved domains important for homodimerization with bcl-2 and heterodimerization with bax. J Biol Chem. 1995;270:11962-11969.

[18.] Weller M, Malipiero U, Aguzzi A, et al. Protooncogene bcl-2 gene transfer abrogates Fas/APO1 antibody-mediated apoptosis of human malignant glioma and confers resistance to chemotherapeutic drugs and therapeutic irradiation. J Clin Invest. 1995;95:2633-2643.

[19.] Krishna M, Smith TW, Recht LD. Expression of bcl-2 in reactive and neoplastic astrocytes astrocytes (as´trōsī´ts),
n a large, star-shaped cell found in certain tissues of the nervous system. A mass of astrocytes is called astroglia. See also astrocytoma.
: lark of correlation with presence or degree of malignancy. J Neurosurg. 1995;83:1017-1022.

[20.] Alderson LM, Castleberg RL, Harsh GR. Human gliomas with wild-type p53 express bcl-2. Cancer Res. 1995;55:999-1001.

[21.] Wang Y, Szekely L, Okan Y, Klein G, et al. Wild type p53-triggered apoptosis is inhibited by bcl-2 in a v-myc-induced T cell lymphoma line. Oncogene.

[22.] Kleihues P, Burger PC, Scheithauer BW. Histological Typing of Tumors of the Central Nervous System. 2nd ed. Berlin: Springer-Verlag; 1993:2-20.

[23.] Frank TS, Svoboda-Newman SM, Hsi DE. Comparison of methods for extracting DNA from formalin-fixed paraffin sections for nonisotopic PCR. Diagn Mol Pathol. 1996;5:220-224.

[24.] Heukeshoven J, Dernick R. Simplified methods for silver staining of proteins in polyacrylamide gels and the mechanism of silver staining. Electrophoresis. 1985;6:103-112.

[25.] Nourusis MJ. SPSS for Windows. SPSS Base System Release 6.0. Chicago, Ill: SPSS Inc; 1993.

[26.] Nakasu S, Nakasu Y, Nioka H, et al. Bcl-2 protein expression in tumors of the central nervous system. Acta Neuropathol. 1994;88:520-526.

[27.] Krajewski S, Krajewska M, Ehrmann J, et al. Immunohistochemical analysis of bcl-2, bcl-X, Mcl-1 and Bax in tumors of central and peripheral nervous system peripheral nervous system: see nervous system.  origin. Am J Pathol. 1997;150:805-814.

[28.] Ahmed Rasheed BK, Maclendon RE, Herndon JE, et al. Alterations of the TP53 in human gliomas. Cancer Res. 1994;54:1324-1330.

[29.] Pollack IF, Hamilton RL, Finkelstein SD, et al. The relationship between TP53 mutations and overexpression of P53 and prognosis in malignant gliomas of childhood. Cancer Res. 1997;57:304-309.

[30.] Bruner JM, Saya H, Moser RP. Immunocytochemical detection of p53 in human gliomas. Mod Pathol. 1991;4:671-674.

[31.] Haapasalo H, Isola J, Sallinen P, et al. Aberrant p53 expression in astrocytic neoplasms of the brain; association with proliferation. Am J Pathol. 1993;142: 1347-1351.

[32.] Koga H, Zhang S, Kumanishi T, et al. Analysis of p53 gene mutations in low and high grade astrocytomas by PCR-SSCP PCR-SSCP Polymerase Chain Reaction–Single Strand Conformation Polymorphism  and immunohistochemistry. Acta Neuropathol. 1994;87:225-232.

[33.] Montine TJ, Bruner JM, Vandersteenhoven JJ, et al. Prognostic significance of p53 immunoreactivity in adult patients with supratentorial fibrillary fi·bril  
n.
1. A small slender fiber or filament.

2. Anatomy Any threadlike fiber or filament, such as a myofibril or neurofibril, that is a constituent of a cell or larger structure.
 astrocytic neoplasms. Diagn Mol Pathol. 1994;3:240-245.

[34.] Kordek R, Bratosiewicz J, Biernat W, et al. Expression of P53 protein, EGFR EGFR Epidermal Growth Factor Receptor (a kinase enzyme)
EGFR Estimated Glomerular Filtration Rate
 and proliferating cell antigens in human gliomas. Folia fo·li·a  
n.
Plural of folium.
 Neuropathol. 1994;32: 227-228.

[35.] Yaziji H, Massarani-Wafai R, Gujrati M, et al. Role of p53 immunohistochemistry in differentiating reactive gliosis from malignant astrocytic lesions. Am J Surg Pathol. 1996;20:10136-1090.

[36.] Fults D, Brockmeyer D, Tullous MW, et al. P53 mutation and loss of heterozygosity Loss of heterozygosity (LOH) in a cell represents the loss of one parent's contribution to part of the cell's genome. LOH can arise via several pathways, including deletion, gene conversion, mitotic recombination and chromosome loss.  on chromosomes 17 and 10 during human astrocytoma astrocytoma /as·tro·cy·to·ma/ (as?tro-si-to´mah) a tumor composed of astrocytes; the most common type of primary brain tumor and also found throughout the central nervous system, classified on the basis of histology or in order of  progression. Cancer Res. 1992;52:674-679.

[37.] Wu JK, Ye Z, Darras BT. Frequency of p53 tumor suppressor gene mutations in human primary brain tumors. Neurosurgery neurosurgery /neu·ro·sur·gery/ (noor´o-sur?jer-e) surgery of the nervous system.

neu·ro·sur·ger·y
n.
Surgery on any part of the nervous system.
. 1993;3:824-830.

[38.] Cunningham JM, Kimmel DW, Scheithauer BW, et al. Analysis of proliferation markers and p53 expression in gliomas of astrocytic origin: relationships and prognostic value. J Neurosurg. 1997;86:121-130.

[39.] Bhattacharjee MB, Brunet JM. p53 protein in pediatric pediatric /pe·di·at·ric/ (pe?de-at´rik) pertaining to the health of children.

pe·di·at·ric
adj.
Of or relating to pediatrics.
 malignant astrocytomas: a study of 21 patients. J Neurooncol. 1997;32:225-233.

[40.] Kraus JA, Bolln C, Wolf HK, et al. TP53 alterations and clinical outcome in low grade astrocytomas. Genes Chromosomes Cancer. 1994;10:143-149.

[41.] Louis DN, Von Deimling A, Chung RY, et al. Comparative study of p53 gene and protein alterations in human astrocytic tumors. J Neuropathol Exp Neurol. 1993;52:31-38.

[42.] Mashiyama S, Murakami Y, Yoshimoto T, et al. Detection of p53 gene mutations in human brain tumors by single-strand conformation polymorphism analysis of polymerase chain reaction products. Oncogene. 1991;6:1313-1318.

[43.] Sarkar Sarkar could mean:
  • Government in Urdu/Persian/Hindi. Colloquially in India, it is a Metonymy for the incumbent government. The Persian wordSarkar is derived from two words; 'Sar' meaning Head and 'Kar' meaning Work.
 FH, Kupsky WJ, Li YW, et al. Analysis of p53 gene mutations in human gliomas by PCR-SSCP and DNA sequencing. Diagn Mol Pathol. 1994;3:2-8.

[44.] Tsuzuki T, Tsunoda S, Sakaki T, et al. Alterations of retinoblastoma Retinoblastoma Definition

Retinoblastoma is a malignant tumor of the retina that occurs predominantly in young children.
Description

The eye has three layers, the sclera, the choroid, and the retina.
, p53, p16(CDKN CDKN Cyclin-Dependent Kinase Inhibitor 2), and p15 genes in human astrocytomas. Cancer. 1996;78:287-293.

[45.] Greer CE, Wheeler CL, Manes manes (mā`nēz), in Roman religion, spirits of the dead. Originally, they were called di manes, a collective divinity of the dead. Manes could also refer to the realm of the dead and, later, to the individual souls of the dead.  MM. Sample preparation and PCR amplification from paraffin-embedded tissues. PCR Methods Appl. 1994;23:113-122.

[46.] Del Arco A, Garcia J, Arribas C, et al. Timing of p53 mutations during astrocytoma tumorigenesis. Hum Mol Genet genet: see civet. . 1993;2:1687-1690.

[47.] Li J, Yen C, Liaw D, et al. P-TEN: a putative protein tyrosine phosphatase Protein tyrosine phosphatases (PTPs) are a group of enzymes that remove phosphate groups from phosphorylated tyrosine residues on proteins. Functions
Together with tyrosine kinases, PTPs regulate the phosphorylation state of many important signalling molecules, such as
 gene mutated in human brain, breast and prostate cancer. Science. 1997;275: 1943-1947.

[48.] Steck PA, Pershouse MA, Jasser SA, et al. Identification of a candidate tumor suppressor gene, MMAC MMAC Multimedia Mobile Access Communication
MMAC Metropolitan Milwaukee Association of Commerce
MMAC Mike Monroney Aeronautical Center
MMAC Mutated in Multiple Advanced Cancers
MMAC Multi Media Access Center (Cabletron) 
1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet. 1997;15:356-362.

[49.] Bartek J, Iggo R, Gannon J, et al. Genetic and immunohistochemical analysis of mutant P53 in human breast cancer lines. Oncogene. 1990;5:893-899.

[50.] Hall PA, Lane DP. p53 in tumor pathology: can we trust immunohistochemistry? revisited! J Pathol. 1994;172:1-4.

[51.] Wynford-Thomas D. p53 in tumor pathology: can we trust immunocyto-chemistry? J Pathol. 1992;166:329-330.

[52.] Rubio MP, Von Deimling A, Yandell DW, et al. Accumulation of wild type P53 protein in human astrocytomas. Cancer Res. 1993;53: 3465-3467.

[53.] Yahanda AM, Bruner JM, Donehower LA, Morrison RS. Astrocytes derived from p53-deficient mice provide a multistep in vitro model for development of malignant gliomas. Mol Cell Biol. 1995;15:4249-4259.

[54.] Kyritsis AP, Xu R, Bondy ML, et al. Correlation of P53 immunoreactivity and sequencing in patients with glioma. Mol Carcinog. 1996;15:1-4.

[55.] Shaw P, Bovey R, Tardy tar·dy  
adj. tar·di·er, tar·di·est
1. Occurring, arriving, acting, or done after the scheduled, expected, or usual time; late.

2. Moving slowly; sluggish.
 S, et al. Induction of apoptosis by wild-type p53 in a human colon tumor derived cell line. Proc Natl Acad Sci U S A. 1992;89: 4495-4499.

[56.] Yonish-Rouach E, Resnitzky D, Lotem J, et al. Wild-type p53 induces apoptosis of myeloid myeloid /my·eloid/ (mi´e-loid)
1. medullary; pertaining to, derived from, or resembling bone marrow or the spinal cord.

2. having the appearance of myelocytes, but not derived from bone marrow.
 leukemic cells that is inhibited by interleukin-6. Nature. 1991; 352:345-347.

[57.] Ehrmann J Jr, Kolar Z, Vojtesek B, et al. Prognostic factors in astrocytomas: relationship of p53, MDM-2, bcl-2 and PCNA PCNA Proliferating Cell Nuclear Antigen
PCNA Preventive Cardiovascular Nurses Association
PCNA Pepsi Cola North America
PCNA Post Conflict Needs Assessment (United Nations)
PCNA Pudelpointer Club of North America
 immunohistochemical expression to tumor grade and overall patient survival. Neoplasma. 1997;44:299-304.

[58.] Carroll RS, Zhang J, Chauncey BW, et al. Apoptosis in astrocytic neoplasms. Acta Neurochir Wien. 1997; 139:845-850.

[59.] Furnari FB, Lin H, Huang HS, Cavanee WK. Growth suppression of glioma cells by PTEN PTEN Protein Tyrosine Phosphatase
PTEN Phosphatase and Tensin Homolog
PTEN Prime Time Entertainment Network (television network) 
 requires a functional phosphatase phosphatase /phos·pha·tase/ (-tas) any of a group of enzymes that catalyze the hydrolytic cleavage of inorganic phosphate from esters.

phos·pha·tase
n.
 catalytic domain. Proc Natl Acad Sci U S A. 1997;94:12479-12484.

[60.] Chiariello E, Roz L, Albarosa R, et al. PTEN/MMAC1 mutations in primary glioblastomas and short term cultures of malignant gliomas. Oncogene. 1998;16: 541-545.

Accepted for publication September 1, 2000.

From the Departments of Pathology (Drs Rodriguez-Pereira, Suarez-Penaranda, and Forteza), Molecular Medicine (INGO-SERGAS) (Dr Barros), and Neurology (Dr Sobrido), Complejo Hospitalario Universitario de Santiago, Santiago, Spain; and Department of Preventive Medicine, Hospital General del Insalud, Soria, Spain (Dr Vazquez-Salvado). Dr Rodriguez-Pereira is currently with the Department of Pathology, Hospital General de Castellon, Castellon, Spain.

Reprints: Carlos Rodriguez-Pereira, MD, PhD, Servicio de Anatomia Patologica, Hospital General de Castellon, Av. de Benicassim, s.n., 12004 Castellon, Spain (e-mail: apimljspCo@usc.es).
COPYRIGHT 2001 College of American Pathologists
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2001 Gale, Cengage Learning. All rights reserved.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Rodriguez-Pereira, C.; Suarez-Penaranda, J. M.; Barros, F.; Sobrido, M. J.; Vazquez-Salvado, M.; For
Publication:Archives of Pathology & Laboratory Medicine
Date:Feb 1, 2001
Words:5734
Previous Article:The Relation Between Newborn Hemoglobin F Fractions and Risk Factors for Sudden Infant Death Syndrome.
Next Article:Ischemic Colitis With Atypical Reactive Changes That Mimic Dysplasia (Pseudodysplasia).
Topics:



Related Articles
Getting down to basics.
Hoechst 33342-Induced Apoptosis Is Associated With Intracellular Accumulation of E2F-1 Protein in BC3H-1 Myocytes and HL-60 Cells.
Novel Method for Simultaneous Analysis of p53 and K-ras Mutations and p53 Protein Expression in Single Histologic Sections.
Correlation of Ki-67 and p53 With the New World Health Organization/International Society of Urological Pathology Classification System for...
Computerized Image Analysis of p53 and Proliferating Cell Nuclear Antigen Expression in Benign, Hyperplastic, and Malignant Endometrium.
Validation of p53 immunohistochemistry as a prognostic factor in breast cancer in clinical practice.
Increased apoptosis in infiltrating mononuclear cells of colorectal cancer: a mechanism for tumor escape.
Cell cycle alterations in endometrial carcinoma.

Terms of use | Copyright © 2012 Farlex, Inc. | Feedback | For webmasters | Submit articles