Analysis of 2 Antiapoptotic Factors in Gliomas: bcl-2 Overexpression and p53 Mutations.

bcl-2 Overexpression and p53 Mutations

Cancer is produced by some alterations in mechanisms that control cell division and also by failures in mechanisms that regulate programmed cell death, a process also known as apoptosis.[1] It can be induced by radiation, drugs, and any agent that causes damage in DNA. Primary apoptosis is started by a signal that comes into the genoma and leads into the activation of a group of "lethal" genes. The most important group of genes involved in apoptosis are myc, interleukin-1 converting enzyme proteases, APO-1/Fas and p53 (stimulators), and bcl-2 (inhibitors). This process makes possible a balance between cells in division and cells that die.[2]

p53 is the most frequently mutated tumor suppressor gene in human cancers.[3] It is located in band 13 of the short arm of chromosome 17 (17p13)[4] and consists of 11 exons (10 of them are encodings); exons 5 to 8 are very well preserved in evolution.[5] p53 has 3 known functions: (1) inhibition of cell cycle in G1 phase, (2) induction of apoptosis, and (3) cellular differentiation.[2] p53 would intervene in apoptosis, inducing transcription and increasing the levels of different products, such as bax, a protein that counteracts bcl-2 action.[6] An interesting model for p53-induced apoptosis was proposed by Polyak et al[7]; it includes 3 steps: (1) the transcriptional induction of redox-related genes, (2) the formation of reactive oxygen species, and (3) the oxidative degradation of mitochondrial component.

p53 mutations could play a role in pathogenesis[8,9] and progression'"[10,11] of gliomas; they correlate with histological grade[12,13] and prognosis. There is no agreement between those who consider that p53 mutations increase survival rates[14] and those who say that their presence represents a worse prognosis.[13,15] Others think that p53 mutations on their own cannot induce any of these effects.

The bcl-2 oncogene was first obtained as the product of the translocation between chromosomes 14 and 18 in (q23: q21).[16] Its essential function is direct inhibition of apoptosis: bcl-2 can cooperate with myc, immortalizing tumor cells, or with r-ras; it can also interact with other proteins of its own family, such as bax.[17]

bcl-2 can be overexpressed in glioblastomas.[18] Krishna et al[19] found bcl-2 overexpression in gliomas of any histological grade. Alderson et al[20] found an association between bcl-2 and p53 immunohistochemical overexpression.

p53 mutations, which represent the absence of an important inductor of apoptosis, and bcl-2 overexpression, a potential mechanism by which tumor cells escape p53-mediated apoptosis,[21] can be considered as 2 antiapoptotic factors.

Reports about the role of p53 in human gliomas are contradictory; only a few studies can be found about bcl-2, and there are even fewer references about the possible interactions between them. Herein, we investigate the possible correlation and the clinicopathologic implications of these 2 factors in 61 human gliomas, using immunohistochemical and molecular methods.

MATERIALS AND METHODS

Information on 61 glial tumors (21 astrocytomas, 9 anaplastic astrocytomas, 29 glioblastomas, 1 oligodendroglioma, and 1 oligoastrocytoma), corresponding to 61 patients from whom enough clinical data and follow-up information were available, was recovered from the files of the Department of Pathology, University Hospital, Santiago, Spain, between 1992 and 1997. The specimens were fixed in buffered formalin and paraffin embedded.

Four-micrometer sections from paraffin blocks were obtained for routine staining (hematoxylin-eosin) and immunohistochemical procedures (streptavidin-biotin-peroxidase complex), by using the monoclonal antibodies p53; clon DO-7, which reacts with mutated and wild-type p53 (Dako, Glostrup, Denmark), diluted 1:50; and bcl-2, clon 124 (Dako), diluted 1:5. Tumors were diagnosed according to World Health Organization (WHO) classification,[22] although only tumor grade was considered for statistical analysis, because this is a better way to compare different tumors with the same nature.

Quantification of p53 immunostaining was made by using an automatic cell counting system (CAS-200, Becton-Dickinson, Leiden, The Netherlands). This system enables the measurement of the percentage of cells stained for a nuclear marker on tissue sections. One hundred cells with a magnification of 400 were counted. Samples from ductal invasive carcinoma of the breast, with p53 mutations demonstrated by single-strand conformational polymorphism (SSCP) and sequencing and with more than 50% of positive nuclei for p53 by immunohistochemistry, were used as positive controls.

Quantification of bcl-2 immunostaining was made by counting of 100 cells with a magnification of 400. Positivity was expressed in percentage of cells with cytoplasmic staining. Lymph nodes with follicular lymphoma, with more than 50% of positive cells for bcl-2, were used as positive controls.

Ten-micrometer sections were also obtained, and appropriate areas from tumor parenchyma were selected by light microscopy and microdissected for DNA extraction. Necrotic areas were avoided. Digestion with proteinase K without ionic detergents followed by boiling was used as the extracting DNA method? During the extracting process, HLA-DQ[Alpha] was used as a control of viable DNA. Polymerase chain reaction amplification of p53 exons 5 to 8 was performed: for a reaction of 25 [micro]L, 2 [micro]L of extracted DNA was added to a mix of 10 mmol/L HC1 (hydrochloric acid; pH 8.3), 50 mmol/L KC1 (potassium chloride), 1.5 mmol/L Mg[Cl.sub.2] (magnesium chloride), 200 mmol/L of each dNTP (dinucleotide triphosphate), and 1.25 U of Taq-polymerase (TaqBead Hot Start Polymerase, Promega). Primers and amplification conditions are described in Table 1. A screening of mutations was performed through SSCP analysis using an automatic electrophoresis system (Phast System, Pharmacia) followed by a silver staining method for the detection of amplified products.[24] A sample of normal tissue for each exon studied was used as a negative control.

Table 1. Primers and Amplification Conditions

Amplification conditions

      95 [degrees] C       30 s
      66 [degrees] C       45 s          40 cycles
      72 [degrees] C        1 min 30 s

Primers
   5     5' TTCCTCTTCCTACAGTACTC 3
         5' GCAAATTTCCTTCCACTCG 3'
   6     5' CCATGAGCGCTGCTCAGAT 3'
         5' AGTTGCAAACCAGACCTCAG 3
   7     5' GTGTTATCTCCTCGGTTGGC 3
         5' CAAGTGGCTCCTGACCTGGA 3
   8     5' CTGCCTCTTGCTTCTCTTTT 3
         5' GAGGCAAGGAAAGGTGATAA 3

Any grade of nuclear staining for p53 was considered a positive result. For bcl-2, we considered those cases with more than 5% of cells with cytoplasmic immunoreactivity as positive per Alderson et al.[20] p53 mutations were identified by an abnormal migration pattern on SSCP gels.

Clinical and pathological data were also registered: histological type (WHO 1993) and histological grade (2, 3, or 4) (both of which may be considered the major variables, because in the central nervous system grade is the stage), age, sex, tumor size (in centimeters), tumor location (considering 3 categories: supratentorial lateral, supratentorial medial, and infratentorial [the most used criterion is the distinction between superficial and deep gliomas]; we think that the 3-category scheme proposed in this study could be useful and reproducible for statistical analysis, because a glioma of right basal nuclei [supratentorial lateral] does not behave as a brainstem tumor [infratentorial], and both are deep gliomas), and survival (in months). Treatment was considered in the multivariant analysis, although the study was not prospective and patients were not homogeneously distributed for treatments (categories for treatment were surgery only, surgery with radiotherapy or chemotherapy, and radiotherapy or chemotherapy only). Patient follow-up ranged from 1 to 71 months (mean, 18.5 [+ or -] 19.5 months), and for those who were alive at the end of the study, it ranged from 3 to 71 months.

For statistical purposes, age and size were considered quantitative variables. Sex, p53 and bcl-2 immunoreactivity, and p53 mutations were considered as 2-category qualitative variables and grade, location, and treatment as more than 2-category qualitative variables. Bivariant analysis was made to test the relation between qualitative variables by using the Pearson [chi square] test. Yates correction for continuity was used for those cases with expected effectiveness lower than 5. Analysis of variance was used to study the relations between quantitative and qualitative variables with more than 2 categories, and Student's t test allowed the analysis of the relations between quantitative and qualitative variables with 2 categories. Kaplan-Meier analysis was performed as a first approach to study significant variables in survival. Cox multivariant regression for survival was used to rule out confusion factors or interactions between variables. The statistical analysis was made by using SPSS 6.1 for Windows?

RESULTS

Thirty-two (53%) of the 61 patients were male, and 29 (47%) were female. Average age was 52.9 [+ or -] 18.3 years (mean [+ or -] SD). Considering the histologic grade, 23 (37.7%) were grade 2 gliomas, 9 (14.8%) grade 3 gliomas, and 29 (47.5%) grade 4 gliomas. Fifty-four tumors (88.0%) were located at the cerebral hemispheres (supratentorial lateral); 3 (5.0%) (a grade 2 glioma in a patient aged 34 years, a grade 3 glioma in a patient aged 14 years, and a grade 4 glioma in a patient aged 51 years) were supratentorial and medial; and 4 (6.5%) (a grade 2 glioma in a patient aged 15 years, 2 grade 3 gliomas in patients aged 12 and 44 years, and a grade 4 glioma in a patient aged 49 years) were infratentorial. Average size of the tumors was 4.2 [+ or -] 1.4 cm. The tumors were measured by computed tomographic scan and magnetic resonance images. Forty-one patients (67%) died during this period, 37 (40.2%) because of their tumors. Survival rates were as follows: 52.2 months for patients with grade 2 tumors, 24.0 months for patients with grade 3 gliomas, and 8.3 months for grade 4 gliomas.

bcl-2 Immunoreactivity

bcl-2 was also studied in the 61 cases. Thirty-four cases (57%) were positive (Figure 1) and 27 (43%) negative. Distribution of bcl-2 immunoreactivity is showed in Table 2. bcl-2 was not related to age, sex, histological grade, tumor location, or tumor size.

[Figure 1 ILLUSTRATION OMITTED]

Table 2. Distribution of BCL-2 Immunoreactivity in Gliomas

Grade     No. of Cases   bcl-2 Positive   bcl-2 Negative

2              23              10               13
3               9               6                3
4              29              18               11
Total          61              34               27

p53 Immunoreactivity

p53 immunoreactivity was studied in the 61 cases. Thirty-four (56%) were positive (Figure 2) and 27 (44%) negative. Distribution of p53 immunoreactivity is showed in Table 3.

[Figure 2 ILLUSTRATION OMITTED]

Table 3. Distribution of p53 Immunoreactivity in Gliomas

Grade     No. of Cases   p53 Positive   p53 Negative

2              23             13             10
3               9              5              4
4              29             16             13
Total          61             34             27

p53 was not related to age, sex, or tumor size. But p53 immunoreactivity increased with histological grade and when tumors were supratentorial and lateral.

p53 Mutations

A study of p53 mutations was made by means of SSCP analysis. Ten cases (17%) showed an abnormal migration pattern in any of the 4 exons studied (5 to 8). Sequencing demonstrated that all of them were mutations. Two of the mutations were in exon 5, 5 in exon 6, 2 in exon 7, and 1 in exon 8. Five of the mutations corresponded to glioblastomas, 2 in grade 3 gliomas and 3 in grade 2 gliomas.

p53 mutations were not related to the studied parameters (age, sex, histological grade, or tumor location, and tumor size).

p53 and bcl-2

bcl-2 immunoreactivity was not related to p53 immunoreactivity using [chi square] test. The same test was used and the same results were obtained when p53 mutations detected by SSCP and bcl-2 immunoreactivity were compared. Twenty-six cases (42%) showed p53 immunoreactivity without p53 mutations. No relation was found when we compared cases with immunoreactive and nonmutated p53 and cases positive for bcl-2.

Clinicopathologic Parameters and Survival

Survival was related to tumor grade, location, and size. The relative risk of death for grade 3 gliomas was 4.2 times higher than for grade 2 gliomas (95% confidence interval [CI], 2.4 [+ or -] 9.1), and the risk increased when we compared grade 4 and grade 2 gliomas; in the last case, the relative risk for death was 13.5 times higher (95% CI, 7.2 [+ or -] 29.5). The relative risk of death for supratentorial lateral gliomas was 4.1 times higher than for infratentorial ones (95% CI, 1.1 [+ or -] 12.5) (P = .0123). This result could be due to the different proportion of glioblastomas in the supratentorial lateral group (50%) in contrast to the infratentorial group (25%). It also could reinforce the usefulness of the WHO grading system as a way of comparison for gliomas of different anatomic location.

Survival was related to size (P = .0228). An increase of 1 cm in tumor size represents an increase in relative risk of death of 1.1 times (95% CI, 1.02 [+ or -] 1.07). There were no differences in survival for bcl-2, p53 immunoreactivity, p53 mutations, or sex.

Cox regression was made to identify independent prognostic variables. We found that only age, treatment, histological grade, and tumor size were significant. Age may not be considered a real prognostic factor; survival depends on age, obviously, and most of glioblastomas occur in old patients. Neither treatment can be considered: it shows a slight correlation with survival, but the design of the study cannot define any treatment as the best. So the only real and significant variables for survival in the study were histological grade and tumor size.

COMMENT

Six internal molecular mechanisms are believed to intervene in carcinogenesis: (1) increase in cellular proliferation, (2) activation of oncogenes and inactivation of tumor suppressor genes, (3) alterations in the regulation of cell cycle, (4) alterations in the control of apoptosis, (5) alterations in the control of cellular differentiation, and (6) genetic instability. Some alterations related to these pathways in gliomas are epidermal growth factor receptor overexpression, mutations of Rb gene, loss of p15 and p16, and loss of apoptosis regulation. Overexpression of bcl-2 oncogene and overexpression and mutations of p53 tumor suppressor gene might be related to the first 4 mechanisms. So, the study of these 2 antiapoptotic factors could be essential to make a hypothesis about etiopathogeny, progression, prognosis, and response to therapy of glial tumors. Several hypotheses have been made to explain glial tumorigenesis and evolution. The first one was established for glioblastomas by Van Meyel et al.[14] They said that low-grade astrocytomas that progress to higher grades do so along 2 distinct clinicopathologic pathways: either stepwise to anaplastic glioma then glioblastoma (marked by p53 mutations, p53 immunoreactivity, and DNA nondiploidy) or directly to glioblastoma (with absence of p53 mutations or immunoreactivity). Four aspects must be considered in the making of an etiopathogenetic hypothesis of glial tumorigenesis and evolution based on the antiapoptotic factors bcl-2 and p53: (1) frequency and characteristics of p53 and bcl-2 immunodetection and p53 mutations in human gliomas; (2) possible correlation of these parameters with other clinicopathological variables, with special emphasis on survival; (3) rate of concordance between p53 immunoreactivity and p53 molecular detection; and (4) possible interactions of bcl-2 overexpression and p53 overexpression and mutations, as antiapoptotic factors, in the evolution of gliomas.

bcl-2 Immunoreactivity

We have not found any relation between bcl-2 and any of the parameters studied, although a relation between bcl-2 and low-grade astrocytomas has been described.[26,27] Other authors found bcl-2 overexpression in any grade of glial tumors. Nobody, including us, has found any unequivocal influence of bcl-2 in survival of gliomas (Figure 3).

[Figure 3 ILLUSTRATION OMITTED]

p53 Immunoreactivity

In our study, 34 gliomas (56%) were immunoreactive for p53 (10 cases were p53 mutations, and 24 cases had p53 overexpression). The results are similar to those of other authors.[28-32] All of them are about a 50% of immunopositive cases, and they also consider positive any grade of p53 immunoreaction (the most commonly used thresh old). Ahmed Rasheed et al[28] found only 14 positive cases in their wide series of 120 tumors, but they use a threshold of positivity of 10%. Van Meyel et al[14] and Pollack et al[29] obtained percentages higher than 65%, but the first authors obtained these results in low-grade astrocytomas and the second authors in high-grade gliomas of childhood; both studies examined fewer than 30 cases.

We have not found any relation between p53 immunoreactivity and age, sex, tumor size, or survival (Figure 4). Nevertheless, p53 immunoreactivity increases along with histological grade (this is widely represented in the literature[31-.35]) and also with a supratentorial location. Both features (higher levels in glioblastomas and in supratentorial lateral tumors, which are mainly glioblastomas) may suppose that p53 protein alterations should be a late event in gliomas evolution, as Fults et al[36] and Wu et al[37] have pointed out.

[Figure 4 ILLUSTRATION OMITTED]

Although some authors consider that p53 immunopositivity implies a worse prognosis (Soini et al[13] Jaros et al,[15] Haapasalo et al[31]), most studies consider that immunodetection, as an isolated factor, has no prognostic significance (Cunningham et al,[38] Bhattacharjee et al,[39] Ahmed Rasheed et al,[28] Koga et al[32]. The use of antibodies that detect both the wild-type and mutated p53 protein (CM-1 and DO-7) makes it difficult to draw conclusions from these results, since detection of p53 overexpression is not always associated with mutations.

p53 Mutations

Of 61 cases studied, 10 (16%) showed mutations by SSCP analysis, frequently in exon 6 (5 cases) and in glioblastomas (5 of 10 total mutations). The results of mutations in literature are heterogeneous. Three groups can be considered: those who find a high percentage of cases with mutations (more than 50%),[14,40,41] others who detect a range between 30% and 50%,[8,29,32,41] and another group, who find between 10% and 30% of mutations,[30,37,42-44] With a percentage of detection of 16%, we are in this last group. Divergences can be explained by the heterogeneity in the series (authors with a high percentage of mutations study only a few cases). However, the average of mutations can be placed at 35%, higher than ours (16%). The small number of mutations in this study could be explained by DNA degradation of samples. A wide agreement exists about the devastating effect of overfixation in formalin for DNA.[45] Even with standardized procedures of fixation, the effect of formalin in small biopsy specimens (as is the case with many brain samples) could diminish the quality of DNA and, therefore, the detection of p53 mutations. The absence of an accurate method of selection of tumor cells in tissues could also explain this point.

No relation was found between p53 mutations and any of the clinicopathologic parameters studied (Figure 5). Survival has been the main parameter analyzed in most series: there are contradictory conclusions about the prognostic significance of p53 mutations detected by SSCE Fults et al[36] consider that gliomas have an equivalent evolution to colonic carcinoma (p53 mutations indicate an increasing grade of malignancy), so p53 mutations should be an essential event in gliomas progression. For Del Arco et al,[46] mutations are an early event. In addition, other authors[29,32,42] think that they are not necessary for gliomas evolution. Perhaps these divergent opinions could convey the idea that p53 mutations are not useful to predict survival in all patients with gliomas as an isolated factor, but they could be an important event when they are associated with other genetic alterations. The recent discovery of P-TEN,[47,48] a new tumor suppressor gene of glioblastomas, and genetic abnormalities that will be discovered in the future should be able to explain the real importance of p53 mutations in the evolution and progression of many types of gliomas.

[Figure 5 ILLUSTRATION OMITTED]

Comparison Between p53 Immunohistochemistry and p53 Molecular Detection

Twenty-six (45%) of the 61 cases showed p53 immunoreactivity without p53 mutations. Normal p53 has a short average life (less than 20 minutes), and it is usually undetectable in normal tissues. When there is a mutation in p53 gene, levels of p53 protein increase by means of a mechanism of posttransductional stabilization or because of conformational changes,[30,41] which allows the immunohistochemical detection of p53.[50] Detection of p53 protein in absence of mutations needs to be explained. Wynford-Thomas[51] says that p53 immunoreaction without mutations is a consequence of alteration of p53 function, with a loss of the target that joins and degrades p53. The simple loss of p53 normal function[50,52,53] is another explanation for this phenomenon. Other authors[35,41] think that the increase in half-life could be an effect when p53 joins to other proteins, such as viral (simian vacuolating virus No. 40, human papilloma virus 6) or cellular (MDM-2) products. Van Meyel et al[14] consider that the abnormal expression of p53 wild-type protein is enough to explain the evolution of gliomas. However, this hypothesis requires a large series of recurrent gliomas, and it has not been proved yet. An interesting observation is that overexpression of normal p53 protein could be a response to DNA damage.[32,52] Our results agree with this observation: we found higher p53 levels in glioblastomas (high-grade tumors), which are supposed to have a greater amount of genetic abnormalities and, therefore, more damage on DNA, regardless the presence of p53 mutations.

Correlation in detection of p53 mutations was poor: of the 61 gliomas studied, only 7 (11.5%) had p53 mutations and were p53 immunoreactive. Twenty-seven (51%) were immunoreactive and had no mutations. In addition, 3 gliomas with mutations were negative for p53. The proportion of concordant cases was 16.4%. Although the results of molecular analysis may reflect other underlying mechanisms, it is necessary to know if there are important differences in rates of detection between immunohistochemistry and mutational analysis. Some authors[14,31,54] find a high concordance (45% or more). Kyritsis et al[54] suggest that concordance is high when the percentage of p53 immunoreactive cells within the tumor is greater than 5%. Anyway, this problem has a difficult solution: it is necessary to study bigger series to obtain valid conclusions. It is also necessary to use more refined methods for selection of tumor cells in tissues (as new microdissection procedures), mainly in small samples with a high percentage of normal cells.

p53 and bcl.2 Coexpression: Results and Implications

No relation was found between bcl-2 overexpression and p53 immunodetection. It seems that DNA damage could increase p53 levels, and it has been proved that overexpression of normal p53 protein can induce apoptosis.[55,56] Overexpression of bcl-2 is probably one of the most important mechanisms by which tumor cells escape p53 mediated-apoptosis. So there should be a relation between overexpressed (mutated) p53 and bcl-2, because both of them could act as antiapoptotic factors. Our statistical study did not confirm the relation. The same happened when we compared cases with overexpressed and nonmutated p53 with cases positive for bcl-2. However, Alderson et al[20] found, in their study of 28 gliomas, that bcl-2-positive tumors were frequently immunoreactive for wild-type p53, using the antibody Pab 1801, which reacts only with wild-type p53. They suggested that the functional nature of p53, and not its level, was the factor that determined the need to block apoptosis. The absence of this correlation leads us to suggest that p53 and bcl-2 overexpression may not act at the same time in the apoptosis blockade in gliomas. This fact has also been pointed by Ehrmann et al.[57] For these authors, p53 and bcl-2 would be important events in astroglial tumors survival, but p53 should be a prognostic factor only in glioblastomas and bcl-2 only in low-grade astrocytomas. In addition, Carrol et al[58] described the absence of correlation between bcl-2 expression and apoptosis in their study of 59 gliomas: whereas apoptotic indices were higher in glioblastomas, bcl-2 expression was similar in all grades of astrocytic tumors. Although p53 overexpression probably indicates a damage to DNA, there should be other factors different to p53 mutations or overexpression that intervene also with bcl-2 to make cells escape from the apoptosis mediated by p53. In contrast to Alderson et al,[20] we think that p53 and bcl-2 overexpression follow different pathways in the process of apoptosis in glial tumors: bcl-2 overexpression should be an early fact (as the frequent and similar distribution between different types of gliomas indicates), whereas p53 overexpression should be a late event (its frequency increases with tumor grade), demonstrating the damage and molecular alterations that happen in cellular DNA when a tumor increases its malignancy. Therefore, these 2 antiapoptotic factors would not act together in the progression of gliomas. Future investigations of new oncogenes and tumor suppressor genes (such as P-TEN studies that are been carried out in glioblastomas[59, 60]) will improve our knowledge of the mechanisms, consequences, and clinical implications of the apoptosis alterations in these tumors.

References

[1.] Kerr JFR, Wyllie AH, Currie AR. Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer. 1972;26:239-257.

[2.] Ashwell J. Coming to terms with death: apoptosis in cancer and immune development. Immunol Today. 1994; 15:147-151.

[3.] Harris CC. p53 tumor suppressor gene: from the basic research laboratory to the clinician abridged historical perspective. Carcinogenesis. 1996;17:11871198.

[4.] Levine AJ, Momand J, Finlay CA. The p53 tumor suppressor gene. Nature. 1991; 351:453-456.

[5.] Montenarh M. Biochemical properties of the growth suppressor/oncoprotein p53. Oncogene. 1993;7:1673-1680.

[6.] Selvakumaran M, Lin HK, Miyoshita T, et al. Immediate early up-regulation of bax expression by p53 but not TGF[Beta]1: a paradigm for distinct apoptotic pathways. Oncogene. 1994;9:1791-1798.

[7.] Polyak K, Xia Y, Zweler JL, Kinzler KW, Vogelstein B. A model for p53induced apoptosis. Nature. 1997;389:300-305.

[8.] Von Deimling A, Eibl RH, Ohgaki H, et al. P53 mutations are associated with 17p allelic: loss in grade II and grade III astrocytoma. Grocer Res. 1992;52: 2987-2990.

[9.] Aka K, Brunet JM, Bondy ML, et al. Detection of p53 alterations in human astrocytomas using frozen tissue sections for PCR. J Neurooncol. 1993;16:125-133.

[10.] Karamitopoulou E, Perentes E, Diamantis Y. P53 protein expression in central nervous system tumors: an immunohistochemical study with CM1 polyvalent and DO-7 monoclonal antibodies. Acta Neuropathol. 1993;85:611-616.

[11.] Ng HK, Lo SY, Huang DP, Poon WS. Paraffin section P53 protein immunohistochemistry in neuroectodermal tumors. Pathology 1994;26:1-5.

[12.] Ellison DW, Gatter KC, Steart PV, et al. Expression of the P53 protein in a spectrum et astrocytic tumors. J Pathol. 1992;168:38:1-386.

[13.] Soini Y, Niemela A, Kamel D, et al. P53 immunohistochemical positivity as a prognostic marker in intracranial tumors. APMIS. 1994;102:786-792.

[14.] Van Meyel DJ, Ramsay DA, Casson AG, et al. P53 mutation, expression, and DNA ploidy in evolving gliomas: evidence for two pathways of progression. J Natl Cancer Inst. 1994;86:1011-1017.

[15.] Jaros E, Perry RH, Adam L, et al. Prognostic implications of P53 protein, epidermal growth factor receptor, and Ki-67 labelling in brain tumors. Br J Cancer. 1992;66:373-375.

[16.] Tsujimoto Y, Finger RL, Yunis J, et al. Cloning of the chromosomal breakpoint of neoplastic B-cells with the (14-18) chromosome translocation. Science. 1984;226:1097-1099.

[17.] Hanada M, Aime-Sempe C, Sate T, et al. Structure-function analysis of bcl-2 protein. Identification of conserved domains important for homodimerization with bcl-2 and heterodimerization with bax. J Biol Chem. 1995;270:11962-11969.

[18.] Weller M, Malipiero U, Aguzzi A, et al. Protooncogene bcl-2 gene transfer abrogates Fas/APO1 antibody-mediated apoptosis of human malignant glioma and confers resistance to chemotherapeutic drugs and therapeutic irradiation. J Clin Invest. 1995;95:2633-2643.

[19.] Krishna M, Smith TW, Recht LD. Expression of bcl-2 in reactive and neoplastic astrocytes: lark of correlation with presence or degree of malignancy. J Neurosurg. 1995;83:1017-1022.

[20.] Alderson LM, Castleberg RL, Harsh GR. Human gliomas with wild-type p53 express bcl-2. Cancer Res. 1995;55:999-1001.

[21.] Wang Y, Szekely L, Okan Y, Klein G, et al. Wild type p53-triggered apoptosis is inhibited by bcl-2 in a v-myc-induced T cell lymphoma line. Oncogene.

[22.] Kleihues P, Burger PC, Scheithauer BW. Histological Typing of Tumors of the Central Nervous System. 2nd ed. Berlin: Springer-Verlag; 1993:2-20.

[23.] Frank TS, Svoboda-Newman SM, Hsi DE. Comparison of methods for extracting DNA from formalin-fixed paraffin sections for nonisotopic PCR. Diagn Mol Pathol. 1996;5:220-224.

[24.] Heukeshoven J, Dernick R. Simplified methods for silver staining of proteins in polyacrylamide gels and the mechanism of silver staining. Electrophoresis. 1985;6:103-112.

[25.] Nourusis MJ. SPSS for Windows. SPSS Base System Release 6.0. Chicago, Ill: SPSS Inc; 1993.

[26.] Nakasu S, Nakasu Y, Nioka H, et al. Bcl-2 protein expression in tumors of the central nervous system. Acta Neuropathol. 1994;88:520-526.

[27.] Krajewski S, Krajewska M, Ehrmann J, et al. Immunohistochemical analysis of bcl-2, bcl-X, Mcl-1 and Bax in tumors of central and peripheral nervous system origin. Am J Pathol. 1997;150:805-814.

[28.] Ahmed Rasheed BK, Maclendon RE, Herndon JE, et al. Alterations of the TP53 in human gliomas. Cancer Res. 1994;54:1324-1330.

[29.] Pollack IF, Hamilton RL, Finkelstein SD, et al. The relationship between TP53 mutations and overexpression of P53 and prognosis in malignant gliomas of childhood. Cancer Res. 1997;57:304-309.

[30.] Bruner JM, Saya H, Moser RP. Immunocytochemical detection of p53 in human gliomas. Mod Pathol. 1991;4:671-674.

[31.] Haapasalo H, Isola J, Sallinen P, et al. Aberrant p53 expression in astrocytic neoplasms of the brain; association with proliferation. Am J Pathol. 1993;142: 1347-1351.

[32.] Koga H, Zhang S, Kumanishi T, et al. Analysis of p53 gene mutations in low and high grade astrocytomas by PCR-SSCP and immunohistochemistry. Acta Neuropathol. 1994;87:225-232.

[33.] Montine TJ, Bruner JM, Vandersteenhoven JJ, et al. Prognostic significance of p53 immunoreactivity in adult patients with supratentorial fibrillary astrocytic neoplasms. Diagn Mol Pathol. 1994;3:240-245.

[34.] Kordek R, Bratosiewicz J, Biernat W, et al. Expression of P53 protein, EGFR and proliferating cell antigens in human gliomas. Folia Neuropathol. 1994;32: 227-228.

[35.] Yaziji H, Massarani-Wafai R, Gujrati M, et al. Role of p53 immunohistochemistry in differentiating reactive gliosis from malignant astrocytic lesions. Am J Surg Pathol. 1996;20:10136-1090.

[36.] Fults D, Brockmeyer D, Tullous MW, et al. P53 mutation and loss of heterozygosity on chromosomes 17 and 10 during human astrocytoma progression. Cancer Res. 1992;52:674-679.

[37.] Wu JK, Ye Z, Darras BT. Frequency of p53 tumor suppressor gene mutations in human primary brain tumors. Neurosurgery. 1993;3:824-830.

[38.] Cunningham JM, Kimmel DW, Scheithauer BW, et al. Analysis of proliferation markers and p53 expression in gliomas of astrocytic origin: relationships and prognostic value. J Neurosurg. 1997;86:121-130.

[39.] Bhattacharjee MB, Brunet JM. p53 protein in pediatric malignant astrocytomas: a study of 21 patients. J Neurooncol. 1997;32:225-233.

[40.] Kraus JA, Bolln C, Wolf HK, et al. TP53 alterations and clinical outcome in low grade astrocytomas. Genes Chromosomes Cancer. 1994;10:143-149.

[41.] Louis DN, Von Deimling A, Chung RY, et al. Comparative study of p53 gene and protein alterations in human astrocytic tumors. J Neuropathol Exp Neurol. 1993;52:31-38.

[42.] Mashiyama S, Murakami Y, Yoshimoto T, et al. Detection of p53 gene mutations in human brain tumors by single-strand conformation polymorphism analysis of polymerase chain reaction products. Oncogene. 1991;6:1313-1318.

[43.] Sarkar FH, Kupsky WJ, Li YW, et al. Analysis of p53 gene mutations in human gliomas by PCR-SSCP and DNA sequencing. Diagn Mol Pathol. 1994;3:2-8.

[44.] Tsuzuki T, Tsunoda S, Sakaki T, et al. Alterations of retinoblastoma, p53, p16(CDKN2), and p15 genes in human astrocytomas. Cancer. 1996;78:287-293.

[45.] Greer CE, Wheeler CL, Manes MM. Sample preparation and PCR amplification from paraffin-embedded tissues. PCR Methods Appl. 1994;23:113-122.

[46.] Del Arco A, Garcia J, Arribas C, et al. Timing of p53 mutations during astrocytoma tumorigenesis. Hum Mol Genet. 1993;2:1687-1690.

[47.] Li J, Yen C, Liaw D, et al. P-TEN: a putative protein tyrosine phosphatase gene mutated in human brain, breast and prostate cancer. Science. 1997;275: 1943-1947.

[48.] Steck PA, Pershouse MA, Jasser SA, et al. Identification of a candidate tumor suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet. 1997;15:356-362.

[49.] Bartek J, Iggo R, Gannon J, et al. Genetic and immunohistochemical analysis of mutant P53 in human breast cancer lines. Oncogene. 1990;5:893-899.

[50.] Hall PA, Lane DP. p53 in tumor pathology: can we trust immunohistochemistry? revisited! J Pathol. 1994;172:1-4.

[51.] Wynford-Thomas D. p53 in tumor pathology: can we trust immunocyto-chemistry? J Pathol. 1992;166:329-330.

[52.] Rubio MP, Von Deimling A, Yandell DW, et al. Accumulation of wild type P53 protein in human astrocytomas. Cancer Res. 1993;53: 3465-3467.

[53.] Yahanda AM, Bruner JM, Donehower LA, Morrison RS. Astrocytes derived from p53-deficient mice provide a multistep in vitro model for development of malignant gliomas. Mol Cell Biol. 1995;15:4249-4259.

[54.] Kyritsis AP, Xu R, Bondy ML, et al. Correlation of P53 immunoreactivity and sequencing in patients with glioma. Mol Carcinog. 1996;15:1-4.

[55.] Shaw P, Bovey R, Tardy S, et al. Induction of apoptosis by wild-type p53 in a human colon tumor derived cell line. Proc Natl Acad Sci U S A. 1992;89: 4495-4499.

[56.] Yonish-Rouach E, Resnitzky D, Lotem J, et al. Wild-type p53 induces apoptosis of myeloid leukemic cells that is inhibited by interleukin-6. Nature. 1991; 352:345-347.

[57.] Ehrmann J Jr, Kolar Z, Vojtesek B, et al. Prognostic factors in astrocytomas: relationship of p53, MDM-2, bcl-2 and PCNA immunohistochemical expression to tumor grade and overall patient survival. Neoplasma. 1997;44:299-304.

[58.] Carroll RS, Zhang J, Chauncey BW, et al. Apoptosis in astrocytic neoplasms. Acta Neurochir Wien. 1997; 139:845-850.

[59.] Furnari FB, Lin H, Huang HS, Cavanee WK. Growth suppression of glioma cells by PTEN requires a functional phosphatase catalytic domain. Proc Natl Acad Sci U S A. 1997;94:12479-12484.

[60.] Chiariello E, Roz L, Albarosa R, et al. PTEN/MMAC1 mutations in primary glioblastomas and short term cultures of malignant gliomas. Oncogene. 1998;16: 541-545.

Accepted for publication September 1, 2000.

From the Departments of Pathology (Drs Rodriguez-Pereira, Suarez-Penaranda, and Forteza), Molecular Medicine (INGO-SERGAS) (Dr Barros), and Neurology (Dr Sobrido), Complejo Hospitalario Universitario de Santiago, Santiago, Spain; and Department of Preventive Medicine, Hospital General del Insalud, Soria, Spain (Dr Vazquez-Salvado). Dr Rodriguez-Pereira is currently with the Department of Pathology, Hospital General de Castellon, Castellon, Spain.

Reprints: Carlos Rodriguez-Pereira, MD, PhD, Servicio de Anatomia Patologica, Hospital General de Castellon, Av. de Benicassim, s.n., 12004 Castellon, Spain (e-mail: [e-mail]).