Printer Friendly
The Free Library
14,537,391 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Acute tick-borne rickettsiosis caused by Rickettsia heilongjiangensis in Russian Far East.


An acute tick-borne rickettsiosis tick-borne rickettsiosis A tick-borne rickettsial infection–eg, north Asian tick-borne rickettsiosis, Queensland tick typhus, and African tick typhus–fiévre boutonneuse, etc, which is similar to RMSF, but less severe, with fever, a small ulcer at  caused by Rickettsia rickettsia (rĭkĕt`sēə), any of a group of very small microorganisms, many disease-causing, that live in vertebrates and are transmitted by bloodsucking parasitic arthropods such as fleas, lice (see louse), and ticks.  heilongjiangensis was diagnosed in 13 patients from the Russian Far East Russian Far East, formerly Soviet Far East, federal district (1989 est. pop. 7,941,000), c.2,400,000 sq mi (6,216,000 sq km), encompassing the entire northeast coast of Asia and including the Sakha Republic, Maritime Territory (Primorsky Kray),  in 2002. We amplified and sequenced four portions of three rickettsial rickettsial /rick·ett·si·al/ (ri-ket´se-al) pertaining to or caused by rickettsiae.

rick·ett·si·al
adj.
Relating to, or caused by a member of the genus Rickettsia.
 genes from the patients' skin biopsy Skin Biopsy Definition

A skin biopsy is a procedure in which a small piece of living skin is removed from the body for examination, usually under a microscope, to establish a precise diagnosis.
 results and blood samples and showed that the amplified rickettsial genes belong to R. heilongjiangensis, which was recently isolated from Dermacentor sylvarum ticks in nearby regions of China. This rickettsia, belonging to subgroup of R. japonica japonica (jəpŏn`əkə): see quince; camellia. , was previously suggested to be pathogenic for humans on the basis of serologic se·rol·o·gy  
n. pl. se·rol·o·gies
1. The science that deals with the properties and reactions of serums, especially blood serum.

2.
 findings. We tested serum samples with different rickettsial antigens from 11 patients and confirmed increasing titers of immunoglobulin (Ig) G and IgM to spotted fever spot·ted fever
n.
A tick typhus caused by Rickettsia rickettsii, such as Rocky Mountain spotted fever.


spotted fever Rocky Mountain spotted fever, see there
 group rickettsiae, including R. heilongjiangensis. Clinical and epidemiologic data on these patients show that this disease is similar to other tick-borne rickettsioses Rickettsioses

Often severe infectious diseases caused by several diverse and specialized bacteria, the rickettsiae and rickettsia-like organisms. The best-known rickettsial diseases infect humans and are usually transmitted by parasitic arthropod vectors.
.

**********

Russian Far East is a geographic, economic, and political unit within the Russian Federation Russian Federation: see Russia. . It consists of the smaller administrative areas (regions) located on or close to the Asian Pacific coast. The southern portion of Khabarovsk region, where this study was carried out, is situated alongside the Amur River Amur River
 Chinese Heilong Jiang or Hei-lung Chiang

River, northeastern Asia. The Amur proper begins at the confluence of the Shilka and Argun rivers and is 1,755 mi (2,824 km) long.
 down to the sea (Figure 1) and is characterized by peculiar combinations of subtropical sub·trop·i·cal  
adj.
Of, relating to, or being the geographic areas adjacent to the Tropics.


subtropical
Adjective

of the region lying between the tropics and temperate lands

 and boreal bo·re·al  
adj.
1. Of or relating to the north; northern.

2. Of or concerning the north wind.

3. Boreal
 biologic niches. Local experience suggests that tick-borne encephalitis encephalitis (ĕnsĕf'əlī`təs), general term used to describe a diffuse inflammation of the brain and spinal cord, usually of viral origin, often transmitted by mosquitoes, in contrast to a bacterial infection of the meninges , Siberian tick typhus Siberian tick typhus

a disease of humans and many species of feral mammals, especially rodents, caused by Rickettsia siberica and transmitted by the ticks Dermacentor and Haemaphysalis.
, and, more recently, Lyme disease Lyme disease, a nonfatal bacterial infection that causes symptoms ranging from fever and headache to a painful swelling of the joints. The first American case of Lyme's characteristic rash was documented in 1970 and the disease was first identified in a cluster at  are prevalent in this territory, with marked seasonal disease peaks (1). In 2002, serologic evidence for acute granulocytic granulocytic

pertaining to granulocytes.


granulocytic leukemia
see myelocytic leukemia.

granulocytic sarcoma
extramedullary growth of multiple, focal granulocytic neoplasm. They may be neutrophilic or eosinophilic.
 ehrlichiosis was found in the region (2).

[FIGURE 1 OMITTED]

In 1932, a disease described as tick-borne fever tick-borne fever Relapsing fever, see there  (tick typhus tick typhus
n.
Any of various tick-borne rickettsial diseases identified by their immunological reactions and, in some cases, by their pathogenicity.
) was identified in the Russian Far East (3). In Central Siberia in 1935, the agent of tick-borne fever, Rickettsia sibirica, was isolated and described (4-6), and several rickettsial isolates from the ticks from the Far Eastern Russia Eastern Russia is the region of Russia between the Ural Mountains and the Pacific Ocean.
  • Siberia
  • Russian Far East
 have also been identified as this new species (7). Since 1935, the cause of acute tick-borne spotted fever in the Russian Far East (including Khabarovsk Region) is thought to be R. sibirica, and the antigen of R. sibirica has been used for serologic studies in clinical laboratories. Nevertheless, differences between clinical pictures of tick-borne fever and differences in serologic cross-reactivity of sera from patients with tick-borne rickettsiosis have been reported in Siberia and the Russian Far East (8). Dermacentor sylvarum ticks have been identified as a vector. In 1990s, several strains of R. sibirica were also isolated from ticks in Primorye Region, south of Khabarovsk Region (9).

In Siberia and China, several new rickettsiae were found. R. mongolotimonae found in inner Mongolia Inner Mongolia
 Chinese Nei Mongol or Nei-meng-ku

Autonomous region (pop., 2002 est.: 23,790,000), China. Stretching some 1,800 mi (2,900 km) across north-northeastern China, it has an area of 454,600 sq mi (1,177,500 sq km); its capital is Hohhot.
 is closely related to R. sibirica (10) and causes acute disease in humans. Clinical cases have now been described in France (11,12). R. heilongjiangensis (strain 054) was first isolated from D. sylvarum ticks collected around Suifenhe in the Heilongjiang Province of China in 1982 (13). Serologic studies indicated that the organism was the probable cause Apparent facts discovered through logical inquiry that would lead a reasonably intelligent and prudent person to believe that an accused person has committed a crime, thereby warranting his or her prosecution, or that a Cause of Action has accrued, justifying a civil lawsuit.  of an acute tick-borne disease Tick-borne disease
A disease that is spread to animals by the bite of an infected tick.

Mentioned in: Ehrlichiosis
 in humans (14). R. hulinensis (strain HL-93) was isolated in 1993 from Haemaphysalis concinna ticks collected in Hulin County, Heilongjiang Province (10). The pathogenicity of this agent in humans is unknown. By using molecular evolutionary genetic analyses, these rickettsiae were shown to form a well-defined clade clade Cladus, subtype Genetics A branch of biological taxa or species that share features inherited from a common ancestor; a single phylogenetic group or line. See Inheritance, Species.  distinct from other spotted fever group rickettsiae, including R. japonica (15). Both D. sylvarum and H. concinna ticks inhabit the Russian Far East, although D. sylvarum is quite rare (1). In this study, we identify the cause of an acute, febrile febrile /feb·rile/ (feb´ril) pertaining to or characterized by fever.

feb·rile
adj.
Of, relating to, or characterized by fever; feverish.
, tick-transmitted disease in the Russian Far East and describe the clinical picture in these cases.

Patients and Methods

Sample Collection

During this study in 2002, we screened almost all patients who were suspected clinically to have a tick-borne rickettsiosis and who were hospitalized in the infectious diseases infectious diseases: see communicable diseases.  department of Khabarovsk Municipal Hospital No. 10. Five to 20 days before onset of the disease, most patients reported tick bites or tick exposure. Some had typical eschars on the skin without a history of a tick bite. The illness was acute, febrile, and usually involved a macular macular adjective Related to 1. A macule 2. The macula  or maculopapular rash Maculopapular rash
A rash characterized by raised, spotted lesions.

Mentioned in: Scrub Typhus

maculopapular rash Dermatology Any rash characterized by minibumps overlying macules, which may be caused by drug allergy, West
. All patients were successfully treated with a 14-day course of doxycycline doxycycline /doxy·cy·cline/ (dok?se-si´klen) a semisynthetic broad-spectrum tetracycline antibiotic, active against a wide range of gram-positive and gram-negative organisms; used also as d. calcium and d. hyclate. . Patients with clinically evident features of tick-borne encephalitis (neurologic signs) or Lyme disease (erythema migrans Erythema migrans (EM)
A red skin rash that is one of the first signs of Lyme disease in about 75% of patients.

Mentioned in: Lyme Disease
) were excluded from the study. In total, samples from 65 patients were investigated, 64 blood samples and 17 skin biopsy results. Paired sera from most of the patients were tested with conventional serologic methods. The first serum sample was taken immediately after admission to the hospital, usually 1-9 days after the onset of the disease. The second serum sample was taken 4-18 days later.

DNA Extraction DNA extraction is a routine procedure to collect DNA for subsequent molecular or forensic analysis. Outline of a DNA extraction
There are three basic steps in a DNA extraction, the details of which may vary depending on the type of sample and any substances that may
, PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
, and Sequencing

Bully coats were separated from fresh blood specimens immediately after collection at patient's admission. DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 was extracted from the buffy coat buf·fy coat
n.
The upper, lighter portion of the blood clot occurring when coagulation is delayed or when blood has been centrifuged.


Buffy coat 
 and skin biopsies samples with QIAmp DNA Blood Mini Kit and DNeasy Tissue Kit (Qiagen, Tokyo, Japan) according to according to
prep.
1. As stated or indicated by; on the authority of: according to historians.

2. In keeping with: according to instructions.

3.
 manufacturer's instructions.

Oligonucleotide primers used in this study and annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  temperatures are shown in Table 1. We used the nested polymerase chain reaction Nested polymerase chain reaction is a modification of polymerase chain reaction intended to reduce the contaminations in products due to the amplification of unexpected primer binding sites.  (PCR) method for primary detection of the rickettsial DNA in human samples. The gltA (citrate synthase) gene was chosen as the target for amplification because of its genus specificity and conservativeness. The primer CS1d (16), which is used traditionally to amplify the full-length gltA gene, is complementary to the ultimate 5'-end of the open reading frame for this gene of R. prowazekii. Since we expected to find DNA of the spotted fever group rickettsiae, we modified the primer to be completely homologous homologous /ho·mol·o·gous/ (ho-mol´ah-gus)
1. corresponding in structure, position, origin, etc.

2. allogeneic.


ho·mol·o·gous
adj.
1.
 to the corresponding portion of the gene of R. conorii (Table 1). R. conorii has been chosen as a template to design primer CS2d as the only spotted fever group rickettsia having a completely sequenced genome at the time of investigation. Comparison of these two primers indicated that the newly designed primer (CS2d) was at least 100 times more sensitive than CS1d in the amplification of the serially diluted DNA of R. montanensis, which was used as a positive control (data not shown). Primers CS2d and CSendR amplify the full-length of the gltA gene. Primers CS877f and CS1258r were used in the nested PCR assay. To amplify the full-length of the gltA gene, we used PCR followed by hemi-nested PCR using the product of the first PCR as a template. Two conservative regions of the outer membrane protein A (ompA) gene were amplified (base positions 91-680 and 3,608-6,789 with respect to the sequence published for R. rickettsii) by using previously described primers (17). Initial amplification of the 3,182-bp longer region was achieved with primers 190-3588f and 190-5044r and with primers 190-4859f and 190-6808r. Products of this reaction were used later in the nested and hemi-nested PCR reactions with corresponding primers. The ompB gene was amplified from clinical samples and DNA by using standard primers (18), except for the ultimate forward primer 120-M59, which was found to produce nonspecific nonspecific /non·spe·cif·ic/ (non?spi-sif´ik)
1. not due to any single known cause.

2. not directed against a particular agent, but rather having a general effect.


nonspecific

1.
 amplicons with the human DNA in clinical samples. Instead, for clinical specimens, we used a newly designed primer, 120-M36. As with the ompA, the DNA from clinical samples was amplified in two steps. In the first step, we amplified two halves of the gene, with a small overlapping region with primers 120-M36 with 120-2988 and 120-2788 with 120-4879. The products of these reactions were used as templates for each of the specific nested or heminested reactions for seven regions. All primers were purchased from Eurogentec (4102 Seraing, Belgium).

Amplification has been carried out by routine methods in a final volume of 50 [micro]L with appropriate negative controls (10,17). In all reactions, as a positive control, we used a mixture of DNA of the following microorganisms: Anaplasma phagocytophilum, Neorickettsia sennetsu, Wolbachia pipientis, Francisella tularensis Francisella tu·la·ren·sis
n.
A bacterium of the genus Francisella that causes tularemia in humans.
, Bartonella henselae Bartonella henselae Rochalimaea henselae Infectious disease A slender, fastidious coccobacillary bacterium of the normal flora of cats associated with bacteremia, endocarditis, cat-scratch disease, bacillary angiomatosis, peliosis hepatis; it may affect , Borrelia Borrelia

A genus of spirochetes that have a unique genome composed of a linear chromosome and numerous linear and circular plasmids. Borreliae are motile, helical organisms with 4–30 uneven, irregular coils, and are 5–25 micrometers long and 0.
 garinii, Coxiella burnetii Coxiella burnetii Infectious disease The single species of genus Coxiella, family Rickettsiaceae, a short, rod-shaped bacterium; it is global in distribution, causes Q fever, spreads by aerosol, primarily infects cattle, sheep, goats, multiplies well in the , and R. montanensis. We found that the cocktail of DNA of tick-borne or phylogenetically phy·lo·ge·net·ic  
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history: a phylogenetic classification of species.
 close to tick-borne bacteria is convenient to use in PCR with potentially polyinfected human samples.

We checked all samples for other possible tick-borne bacterial and pathogens with the following primers under conditions suggested in published references: SL primers for ospA gene of Borrelia (19); BhCS.781p and BhCS.1137n primers for Bartonella citrate synthase (20); HE1, HE3, and HE4 primers for 16S rDNA of Ehrlichia chaffeensis (21); GE3A, GE10r, GE9f, and GE2 primers for 16S rRNA gene of A. phagocytophilum (22); and P3708 and p4257 primers for the gene encoding p44 protein Of A. phagocytophilum (23) [data not shown]. No positive results have been obtained among patients described here.

The PCR products were purified for DNA sequencing with the QIAquick PCR purification kit (Qiagen) and then directly sequenced by using PCR primers. Sequencing reactions were carried out with a D-rhodamine terminator cycle DNA sequencing kit (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. Sequencing reaction products were resolved by electrophoresis with an ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 Prism 377 sequencer See MIDI sequencer.

(music) sequencer - Any system for recording and/or playback of music via a programmable memory which stores music not as audio data, but as some representation of notes.
 (Applied Biosystems). The results obtained were processed into sequence data with AutoAssembler software (Applied Biosystems). The sequences of the gltA, both regions of the ompA gene, and the ompB genes were aligned by using the software Genetix-Win 5.1 (Software Development Co., Ltd., Japan). Sequences in the ompB genes of R. heilongjiangensis and R. hulinensis were not available in the GenBank database so we amplified and sequenced the gene. The sequences used for comparison were obtained from the GenBank database, aligned, and then corrected manually to preserve codon codon: see nucleic acid.  alignment and conserved motifs. Sites with ambiguous alignments were removed before phylogenetic phy·lo·ge·net·ic
adj.
1. Of or relating to phylogeny or phylogenetics.

2. Relating to or based on evolutionary development or history.
 analysis. The phylogenetic tree was calculated by using neighbor-joining method with MEGA2 Version 2.1 software (available from http://megasoftware.net). Internal node support was verified by using the bootstrap See boot.

(operating system, compiler) bootstrap - To load and initialise the operating system on a computer. Normally abbreviated to "boot". From the curious expression "to pull oneself up by one's bootstraps", one of the legendary feats of Baron von Munchhausen.
 method with 100 replicates.

Serologic Studies

Two serologic tests were performed in Khabarovsk Plague Control Station: immunofluorescence Immunofluorescence

A technique that uses a fluorochrome to indicate the occurrence of a specific antigen-antibody reaction. The fluorochrome labels either an antigen or an antibody.
 studies with a combined antigen consisted of two local strains of B. garinii and one local strain of B. afzelii, and an enzyme-linked immunosorbent assay enzyme-linked immunosorbent assay
n.
ELISA.


Enzyme-linked immunosorbent assay (ELISA)
A diagnostic blood test used to screen patients for AIDS or other viruses.
 detected antibodies against tick-borne encephalitis virus tick-borne encephalitis virus
n.
An arbovirus of the genus Flavivirus that occurs in two subtypes, Central European and Eastern, causing two forms of encephalitis; it is transmitted by ticks.
 (24). For further investigations, sera were dried on blotting papers as described previously (25) and transported to Marseilles, where microimmunofluorescence testing (26) was performed by using in-house prepared antigens of R. heilongjiangensis (strain 054, ATCC ATCC American Type Culture Collection, see there  VR-1524), R. hulinensis (strain HL-93, ATCC VR-1527), R. sibirica (strain 246, ATCC VR-151), R. conorii (strain Moroccan ATCC VR-141), C. burnetii (strain Nine Mile, ATCC VR-615), Orientia tsutsugamushi Orientia tsutsugamushi

obligately intracellular bacteria that cause scrub typhus in humans and many small feral mammals, especially rodents and occasionally dogs.
 (strains Gilliam, Karp, Kato, and Kawazaki), E. chaffeensis (strain Arkansas), A. phagocytophilum (strain Webster), Bartonella henselae (Houston-1, ATCC-49882), and B. quintana (strain Oklahoma). Antigens were applied by pen point to 18-well microscope slides, dried for 30 min, and fixed. Appropriate positive- and negative-control serum samples were tested on each slide together with twofold dilutions of patients' serum samples made in 3% nonfat dry milk Noun 1. nonfat dry milk - dehydrated skimmed milk
dried milk, dry milk, milk powder, powdered milk - dehydrated milk
 in phosphate-buffered saline (PBS PBS
 in full Public Broadcasting Service

Private, nonprofit U.S. corporation of public television stations. PBS provides its member stations, which are supported by public funds and private contributions rather than by commercials, with educational, cultural,
). Slides were incubated in a moist chamber for 30 min at 37[degrees]C, washed twice in PBS and once in distilled water (10 min each); reactive antibodies showed fluorescein fluorescein /flu·o·res·ce·in/ (fldbobr-res´en) a fluorescing dye; its sodium salt is used as a tracer in retinal angiography and as a diagnostic aid for revealing corneal trauma and fitting contact lenses.  isothiocyanate-conjugated goat anti-human [gamma] chain and [micro]-chain immunoglobulins (BioMerieux, Marcy l'Etoile, France). After the conjugate conjugate /con·ju·gate/ (kon´jdbobr-gat)
1. paired, or equally coupled; working in unison.

2. a conjugate diameter of the pelvic inlet; used alone usually to denote the true conjugate diameter; see
 was added, slides were incubated for 30 min at 37[degrees]C, washed in two PBS for 10 min and for 5 min in distilled water, and mounted in buffered glycerol glycerol, glycerin, glycerine, or 1,2,3-propanetriol (prō`pāntrī'ŏl), CH2OHCHOHCH2OH, colorless, odorless, sweet-tasting, syrupy liquid. . Endpoints for each antigen were the lowest concentrations of serum that definitely conferred fluorescence on bacteria.

Nucleotides Accession Numbers

Nucleotide sequences obtained during this study were deposited in GenBank under the following numbers: AY260451 for ompB gene of R. heilongjiangensis, strain 054; AY260452 for ompB gene for R. hulinensis; AY280712 for ompB gene; AY280711 for previously tandemly repeated region portion of ompA gene; AY280710 for another portion; and AY280709 for gltA gene of Rickettsia heilongjiangensis found in this study.

Results

We amplified and sequenced DNA of R. heilongjiangensis in samples from 16 patients. Serum samples from 11 were available for serologic studies, and clinical and epidemiologic data have been analyzed for 13 patients, including all patients with investigated serum samples.

Ten of 17 samples of DNA extracted from skin eschars and seven of 64 samples of DNA extracted from buffy coats were positive in the nested PCR for the gltA gene. In one patient, both the skin biopsy and the buffy coat were positive and had the same DNA sequence DNA sequence Genetics The precise order of bases–A,T,G,C–in a segment of DNA, gene, chromosome, or an entire genome. See Base pair, Base sequence analysis, Chromosome, Gene, Genome. . Because we had limited amounts of extracted DNA, we attempted to amplify both the ompA and ompB genes from six samples (three skin biopsies and three blood samples), which were previously positive in nested PCR with primers for citrate synthase gene. All positive samples were also screened by PCR for other possible bacterial tick-borne pathogens and were found to be negative. Results from testing, serologic or PCR, that suggested double infection were excluded from the study. Clinical picture of the disease was analyzed in patients with R. heilongjiangensis infection to describe the disease associated with this organism.

All 17 nested PCR amplicons of amplified gltA gene were directly sequenced and showed 100% homology homology (hōmŏl`əjē), in biology, the correspondence between structures of different species that is attributable to their evolutionary descent from a common ancestor. . Six amplicons of ompA and ompB genes of corresponding samples were also identical with each other. We obtained full-length gltA gene sequence, 590 bp and 3,182 bp (excluding primer sequences) of 5'- and 3'-regions of the ompA gene, respectively, and a 4,852-bp length sequence of the ompB gene. A BLAST search showed that all sequences were completely homologous to correspondent genes of R. heilongjiangensis. Figure 2 shows the phylogenetic relationships of this Rickettsia and other species based on the analysis of both concatenated portions of the ompA gene.

[FIGURE 2 OMITTED]

Serum samples from 11 of 16 patients were studied; data are presented in Tables 2 and 3. None of the samples had serologic evidence of any other nonrickettsial acute, tick-borne disease. One previously vaccinated patient had a low titer titer /ti·ter/ (ti´ter) the quantity of a substance required to react with or to correspond to a given amount of another substance.  of immunoglobulin (Ig) G against tick-borne encephalitis virus, and two had low titers to both B. henselae and B. quintana (data not shown). In 9 of 11 available paired sera from PCR-positive patients, we found serologic evidence for acute rickettsial infection rickettsial infection Rickettsial disease, rickettsiosis Any infection by Rickettsiae Groups 1. Typhus group–epidemic typhus, Brill-Zinsser disease, murine–endemic typhus, scrub typhus; 2. , e.g., the presence of IgM antibodies, seroconversion seroconversion /se·ro·con·ver·sion/ (-con-ver´zhun) the change of a seronegative test from negative to positive, indicating the development of antibodies in response to immunization or infection. , or a fourfold rise in antibody titer antibody titer The amount of a specific antibody present in the serum, usually as a result of an acquired infection; titers for IgM usually rise abruptly at the time of infection–acute phase and fall slowly; during the 'convalescent' phase, IgG ↑ and is  against rickettsial antigens. In samples from two patients, IgG and IgM antibody titers to R. heilongjiangensis were highest. In samples from five patients, the same titers were present against R. conorii and R. heilongjiangensis. In samples from one patient, we found the same levels of antibodies to all rickettsial antigens. Levels of antibodies against R. sibirica in all cases, except one, were lower than against R. heilongjiangensis. In four of nine cases, titers were identical against antigens of R. hulinensis and R. sibirica. Absence of specific antibodies against rickettsiae in patients 2 and 3 could be explained either by early treatment with a specific antimicrobial drug or probable errors in serum sample collection and treatment.

Epidemiologic, clinical, and laboratory data available in 13 of 16 PCR-positive patients are given in Table 4. Before the onset of the disease in the summer 2002 (from June to August), all patients had a history of tick bite, tick exposure, or a stay in an epidemiologically suspected location. After an incubation period incubation period
n.
1. See latent period.

2. See incubative stage.


Incubation period 
 of 4 to 7 days, the patient had a sudden onset with fever, but no specific symptoms appeared during the first several days. In 12 patients, a macular or maculopapular rash appeared but was usually faint. Twelve patients had a primary lesion (eschar eschar /es·char/ (es´kahr)
1. a slough produced by a thermal burn, by a corrosive application, or by gangrene.

2. tache noire.


es·char
n.
) at the site of tick attachment (Figure 3). The eschar consisted of a necrotic central region (50-150 mm in diameter) surrounded by infiltrated and inflamed tissue (70-400 mm in diameter), and a zone of hyperemia hyperemia /hy·per·emia/ (-e´me-ah) engorgement; an excess of blood in a part.hypere´mic

active hyperemia , arterial hyperemia that due to local or general relaxation of arterioles.
 (250-500 mm in diameter). The eschars were found on the waist and buttocks buttocks /but·tocks/ (but´oks) the two fleshy prominences formed by the gluteal muscles on the lower part of the back.  region (four); lower extremities (two); upper extremities and axillar ax·il·lar   or ax·il·lar·y
n. pl. axillars or ax·il·lar·ies
One of the feathers in the axilla of a bird's wing.
 region (two); and back, chest, neck, and abdomen (one case each). In two patients, we noticed subcutaneous lymphangitis lymphangitis /lym·phan·gi·tis/ (lim?fan-ji´tis) inflammation of a lymphatic vessel or vessels.lymphangi´tic

lym·phan·gi·tis or lym·phan·gi·i·tis
n.
Inflammation of the lymphatic vessels.
 and regional lymphadenopathy lymphadenopathy /lym·phad·e·nop·a·thy/ (-op´ah-the) disease of the lymph nodes.

angioimmunoblastic lymphadenopathy , angioimmunoblastic lymphadenopathy with dysproteinemia
. Initial conventional treatment at home, with a combination of antipyretics, analgesics Analgesics Definition

Analgesics are medicines that relieve pain.
Purpose

Analgesics are those drugs that mainly provide pain relief.
, and antibacterial antibacterial /an·ti·bac·te·ri·al/ (-bak-ter´e-al) destroying or suppressing growth or reproduction of bacteria; also, an agent that does this.

an·ti·bac·te·ri·al
adj.
 therapy (oral penicillins) did not result in improvement; 5-9 days after the onset of symptoms, all patients were admitted to the hospital. They received oral doxycycline for 14 days and antihistamine antihistamine (ăn'tĭhĭs`təmēn), any one of a group of compounds having various chemical structures and characterized by the ability to antagonize the effects of histamine.  therapy, and clinical symptoms resolved within 2 to 3 days. Laboratory tests in the hospital showed elevated levels of serum transaminases (alanine aminotransferase alanine aminotransferase /al·a·nine ami·no·trans·fer·ase/ (ah-me?no-trans´fer-as) alanine transaminase.

alanine aminotransferase
n. Abbr. ALT
See SGPT.
 and aspartate aminotransferase aspartate aminotransferase
n. Abbr. AST
See SGOT.



aspartate aminotransferase

an enzyme that catalyzes the reversible transfer of an amino group:

$$\eqalign $$
) in 46% and 15% of patients, respectively, and these remained elevated even during convalescence convalescence /con·va·les·cence/ (kon?vah-les´ins) the stage of recovery from an illness, operation, or injury.

con·va·les·cence
n.
1.
 but were normal at follow-up at 3 to 4 weeks.

[FIGURE 3 OMITTED]

Discussion

Our findings suggest that patients had an acute infection with R. heilongjiangensis. Clinical data were typical for acute rickettsial infections. We successfully amplified four portions of three different rickettsial genes from human blood and skin samples, which suggested the presence of this microorganism microorganism /mi·cro·or·gan·ism/ (-or´gah-nizm) a microscopic organism; those of medical interest include bacteria, fungi, and protozoa. . We did not amplify any of these genes in samples from healthy donors or from patients suffering from other infectious diseases (negative controls). The gltA gene is conservative, especially among Rickettsia species (16), and ompA and ompB genes encode main surface proteins of rickettsiae. These gene sequences were completely homologous to the spotted lever group R. heilongjiangensis. Previous GenBank sequences were recently corrected (Fournier PE et al., unpub. data). The identity of sequenced PCR products among patients, clinical data, and epidemiologic data suggest the locality of this rickettsiosis rickettsiosis /rick·ett·si·o·sis/ (ri-ket?se-o´sis) infection with rickettsiae.

rick·ett·si·o·sis
n.
Infection with Rickettsia bacteria.
.

The serologic data support PCR and sequencing findings. We showed that Rickettsia produces a clear immunologic response in patients. We studied paired sera from patients for reactivity with antigens of several species in the Rickettsia genus, including R. heilongjiangensis and R. hulinensis. Seroconversion, presence of IgM, or increasing antibody titers were observed in most patients. In seven cases, sera reacted at higher titers with antigen of R. heilongjiangensis when compared with R. sibirica, the only currently identified tick-borne rickettsia in the Russian Far East. In 77%, the titers were identical against R. heilongjiangensis and R. conorii antigens. Although serologic cross-reactions are common among rickettsiae of the spotted fever group (26), the finding of lower titers against the phylogenetically more closely related R. hulinensis than the relatively more distant R. conorii was unexpected.

Epidemiologic evidence of tick bite or exposure, rash, primary lesion (eschar) at the site of tick bite, and rapid recovery after doxycycline treatment support a rickettsial cause for the disease. Some peculiarities were noticed when signs were compared with infection caused by R. sibirica in the Central Siberia. Seasonal peak of infections is in the end of June and July. For Siberian tick typhus, the seasonal peak is the end of April and May. The rash that accompanies tick-borne rickettsiosis in the Russian Far East is less obvious, and the disease apparently affects older people than Siberian tick typhus. Only 1 of 13 patients was >45 years of age. Generally, the disease is mild, with no serious complications or death recorded.

The epidemiology of the disease remains mostly unknown. Recently, DNA of the Rickettsia described in our report was amplified from H. concinna ticks collected in Siberia (S. Shpynov, unpub. data).

PCR-based technologies and direct sequencing provide a fast and precise diagnosis or rickettsiosis. The preferable method may be PCR on eschar biopsy samples because this technique has high sensitivity and probability of finding rickettsial DNA (27). Serologic studies of samples from Russian Far East area should include tests with antigens of R. heilongjiangensis.

Results of our studies showed that acute febrile tick-borne disease caused by R. heilongjiangensis is prevalent in the Russian Far East. Molecular biology molecular biology, scientific study of the molecular basis of life processes, including cellular respiration, excretion, and reproduction. The term molecular biology was coined in 1938 by Warren Weaver, then director of the natural sciences program at the Rockefeller  approaches enabled us to identify the cause of an acute disease and to detect its bacterial origin. As no evidence of R. sibirica human infection was found in our study, further investigations are needed clarify its role in human pathology in the Russian Far East, especially the Khabarovsk Region.
Table 1. List of the primers used to detect rickettsial DNA

Gene for amplification   Primer name   Primer sequence 5'-3' (a)

gltA                        CS1d        ATGACT#AATGG#C#AATAATAA
                            CS2d       ATGACC#AATGA#A#AATAATAAT#
                           CSEndr         CTTATACTCTCTATGTACA
                          RpCS877p        GGGGACCTGCTCACGGCGG
                          RpCS1258n     ATTGCAAAAAGTACAGTGAACA

ompA, 5'- portion          190-70        ATGGCGAATATTTCTCCAAAA
                           190-701       GTTCCGTTAATGGCAGCATCT

ompA, 3'- portion         190-3588f      AACAGTGAATGTAGGAGCAG
                          190-3968r      TAGCAGCTGATTTAGTAGCT
                          190-4084f       CATCACCGATATTTCTAGC
                          190-4338f       TTCAGGAAACGACCGTACG
                          190-4406r      ACTATACCCTCATCGTCATT
                          190-4859f       GCGAAATCCAAGGTACAGG
                          190-5044r       AACTTGTAGCACCTGCCGT
                          190-5125f      GCGGTTACTTTAGCCAAAGG
                          190-5238r      ACTATTAAAGGCTAGGCTATT
                          190-5768f      CACCGCTACAGGAAGCAGAT
                          190-5831r      GTGTCGCTAGGTTTTACAAC
                          190-6228f        CGTTGAAGTATAGCATC
                          190-6427r      ATCTAAGCCCAGCTAGCGGT
                          190-6808r       CACGAACTTTCACACTACC

ompB                       120-M36      TTCTACAGCTACCATAGTAGCCA
                           120-607       AATATCGGTGACGGTCAAGG
                           120-807       CCTTTTAGATTACCGCCTAA
                          120-1378       TAAACTTGCTGACGGTACAG
                          120-1497        CCTATATCGCCGGTAATT
                          120-2113       CGATGCTAACGTAGGTTCTT
                          120-2339      CTTGTTTGTTTAATGTTACGGT
                          120-2778       AAACAATAATCAAGGTACTGT
                          120-2988       CCGGCTATACCGCCTGTAGT
                          120-3462       CCACAGGAACTACAACCATT
                          120-3599       TACTTCCGGTTACAGCAAAGT
                          120-4232      GGTTTCTCATTCTCTCTATATGG
                          120-4346       CGAAGAAGTAACGCTGACTT
                          120-4879      TTAGAAGTTTACACGGACTTTT

Gene for amplification   Primer name    Annealing temperature

gltA                        CS1d
                            CS2d             50[degrees]C
                           CSEndr
                          RpCS877p           54[degrees]C
                          RpCS1258n

ompA, 5'- portion          190-70            53[degrees]C
                           190-701

ompA, 3'- portion         190-3588f      46[degrees]C for the
                          190-3968r    first round 50[degrees]C
                          190-4084f       for the nested and
                          190-4338f       heminested rounds
                          190-4406r
                          190-4859f
                          190-5044r
                          190-5125f
                          190-5238r
                          190-5768f
                          190-5831r
                          190-6228f
                          190-6427r
                          190-6808r

ompB                       120-M36           50[degrees]C
                           120-607
                           120-807
                          120-1378
                          120-1497
                          120-2113
                          120-2339
                          120-2778
                          120-2988
                          120-3462
                          120-3599
                          120-4232
                          120-4346
                          120-4879

(a) Differences between primers CS1d and CS2d are indicated by
bold letters.

Note: Differences between primers CS1d and CS2d are indicated with #.

Table 2. Serologic data of 11 patients with Rickettsia infection (a)

                                           PCR

          Disease
Patient    onset    Antimicrobial   gltA    ompA and
no.        date     treatment (b)   gene   ompB genes

1          6/18         6/23         +         NI

2          6/20         6/23         +         +

3          6/21         6/24         +         NI

4          6/22         6/26         +         NI

5          6/22         6/28         +         NI

6          6/29          7/2         +         +

7          6/30          7/4         +         NI

8           7/1          7/8         +         NI

9           7/6         7/12         +         NI

10         7/23         7/28         +         +

11         7/25          8/1         +         NI

          Disease
Patient    onset    Antimicrobial          Collection
no.        date     treatment (b)   Sera      date

1          6/18         6/23         1        6/24
                                     2        6/28
2          6/20         6/23         1        6/24
                                     2         7/9
3          6/21         6/24         1         6/5
                                     2        7/12
4          6/22         6/26         1        6/26
                                     2         7/1
5          6/22         6/28         1        6/28
                                     2        7/16
6          6/29          7/2         1         7/3
                                     2         7/8
7          6/30          7/4         1         7/5
                                     2        7/16
8           7/1          7/8         1         7/8
                                     2        7/26
9           7/6         7/12         1        7/15
                                     2        7/31
10         7/23         7/28         1        7/29
                                     2        8/13
11         7/25          8/1         1         8/2
                                     2        8/15

                                                IgM tests

          Disease
Patient    onset    Antimicrobial          R.
no.        date     treatment (b)   heilongjiangensis   R. hulinensis

1          6/18         6/23                0                 0
                                          1/32              1/32
2          6/20         6/23                0                 0
                                            0                 0
3          6/21         6/24                0                 0
                                            0                 0
4          6/22         6/26              1/32              1/16
                                          1/64              1/64
5          6/22         6/28                0                 0
                                          1/128             1/32
6          6/29          7/2                0                 0
                                          1/64              1/64
7          6/30          7/4                0                 0
                                         1/1,024           1/1,024
8           7/1          7/8                0                 0
                                          1/512             1/126
9           7/6         7/12              1/64              1/64
                                          1/128             1/128
10         7/23         7/28                0                 0
                                          1/32              1/32
11         7/25          8/1              1/256             1/256
                                          1/256             1/256

                                            IgM tests

          Disease
Patient    onset    Antimicrobial
no.        date     treatment (b)   R. sibirica   R. conorii

1          6/18         6/23             0            0
                                       1/32          1/32
2          6/20         6/23             0            0
                                         0            0
3          6/21         6/24             0            0
                                         0            0
4          6/22         6/26           1/16          1/32
                                       1/64          1/64
5          6/22         6/28             0            0
                                       1/32         1/128
6          6/29          7/2             0            0
                                       1/64          1/64
7          6/30          7/4             0            0
                                       1/256       1/1,024
8           7/1          7/8             0            0
                                       1/126        1/512
9           7/6         7/12           1/64          1/64
                                       1/128        1/128
10         7/23         7/28             0            0
                                       1/16          1/16
11         7/25          8/1           1/64          1/64
                                       1/64          1/64

(a) PCR, polymerase chain reaction; Ig, immunoglobulin;
NI, not investigated.

(b) Date of beginning of antimicrobial drug therapy.

Table 3. Serologic data of 11 patients with Rickettsia infection

                                 PCR

Disease
onset     Antimicrobial   gltA    ompA and
date      treatment (b)   gene   ompB genes   Sera

6/18          6/23         +         NI        1
                                               2
6/20          6/23         +         +         l
                                               2
6/21          6/24         +         NI        1
                                               2
6/22          6/26         +         NI        1
                                               2
6/22          6/28         +         NI        1
                                               2
6/29           7/2         +         +         l
                                               2
6/30           7/4         +         NI        1
                                               2
7/1            7/8         +         NI        1
                                               2
7/6           7/12         +         NI        1
                                               2
7/23          7/28         +         +         1
                                               2
7/25           8/1         +         NI        1
                                               2

                                           IgG tests

Disease
onset     Antimicrobial   Collection          R.
date      treatment (b)      date      heilongjiangensis

6/18          6/23           6/24              0
                             6/28           1/1024
6/20          6/23           6/24              0
                             7/9               0
6/21          6/24           6/5               0
                             7/12              0
6/22          6/26           6/26            1/64
                             7/1            1/2,048
6/22          6/28           6/28              0
                             7/16            1/128
6/29           7/2           7/3               0
                             7/8             1/128
6/30           7/4           7/5               0
                             7/16            1/256
7/1            7/8           7/8               0
                             7/26              0
7/6           7/12           7/15           1/1,024
                             7/31           1/1,024
7/23          7/28           7/29              0
                             8/13           1/1,024
7/25           8/1           8/2             1/256
                             8/15            1/256

                                         IgG tests

Disease
onset     Antimicrobial
date      treatment (b)   R. hulinensis   R. sibirica   R. conorii

6/18          6/23              0              0            0
                              1/512          1/512       1/1,024
6/20          6/23              0              0            0
                                0              0            0
6/21          6/24              0              0            0
                                0              0            0
6/22          6/26            1/64           1/64          1/64
                              1/512          1/512        1/2048
6/22          6/28              0              0            0
                              1/128          1/128        1/128
6/29           7/2              0              0            0
                              1/64           1/64         1/128
6/30           7/4              0              0            0
                              1/128          1/256        1/256
7/1            7/8              0              0            0
                                0              0            0
7/6           7/12           1/1,024        1/1,024      1/1,024
                             1/1,024        1/1,024      1/1,024
7/23          7/28              0              0            0
                             1/1,024         1/256        1/256
7/25           8/1            1/256          1/128        1/128
                              1/256          1/128        1/128

(a) PCR, polymerase chain reaction; Ig, immunoglobulin;
NI, not investigated.

(b) Date of beginning of antimicrobial drug therapy.

Table 4. Epidemiologic, clinical and laboratory data of 13 patients
with rickettsiosis.

Feature or sign                                     Value (n = 13)

Sex, male/female                                         8/5
Age, y, mean                                          52 (18-66)
Mean period between onset and hospitalization, d         4.6
Mean stay at the hospital, d                             5.7
Primary diagnosis of rickettsiosis at admission           9
History of tick bite                                      6
Incubation period, d, median (range)                  5.5 (4-7)
Antibiotics taken before hospitalization                  2
Chills                                                    13
Malaise                                                   13
Headache                                                  13
Dizziness                                                 11
Myalgias, arthralgias                                     13
Nausea                                                    2
Anorexia                                                  13
Maculopapular rash                                        12
Rash appearance after onset of disease, d, median        3.6
Duration of rash, d, median (range)                   5.5 (4-7)
Presence of eschar                                        12
Lymphadenopathy regional to the eschar                    10
Subcutaneous lymphangitis, leading to regional            2
  lymph nodes
Hepatomegaly                                              5
Splenomegaly                                              2
Sleep disturbances                                        7
Leukocytosis at admission, (>9,000/[mm.sup.3])            6
Leukopenia at admission, (<4,000/[mm.sup.3])              2
Increased ESR (>15 mm/h for men, >20 mm/h                12
  for women)
Thrombocytopenia, (<150,000/[mm.sup.3])                   3
Proteinuria ([greater than or equal to]                   1
  0.033 g/L)
Increased ALT activity, >1.5 times                        6
Increased AST activity, >1.5 times                        2
Doxycycline treatment, 100 mg twice                       13
  daily for 14 d

(a) ESR, erythrocyte sedimentation rate; ALT, alanine
aminotransferase; AST, asparate aminotransferase.


Acknowledgments

We are grateful to S. Dumler and M.M. Eremeeva for worthy advice, G.S. Tomilka and V.I. Zholondz for assistance in samples collection, and P. Kelly for thoroughly reviewing this manuscript.

References

(1.) Yastrebov VK. Transmissible transmissible /trans·mis·si·ble/ (trans-mis´i-b'l) capable of being transmitted.

trans·mis·si·ble
adj.
Capable of being conveyed from one person to another.
 and natural infections in Siberia and the Far East. Probl Sotsialnoi Gig Istor Med 1995;5:16-9.

(2.) Sidelnikov YN, Mediannikov OY, Ivanov LI, Zdanovskaya NI. Clinical and laboratory features of human granulocytic ehrlichiosis human granulocytic ehrlichiosis: see ehrlichiosis.  in the south of Russian Far East. Epidemiologia i Infectsionnye Bolezni 2002;3:28-31.

(3.) Mill EI. Tick-borne fever in Primorye. Far Eastern Medical Journal 1936;3:54-6.

(4.) Shmatikov MD, Velik MA. Tick-borne spotted fever. Klinicheskaya medicina 1939;7:124-6.

(5.) Korshunova OS. Etiology of tick-borne typhus typhus, any of a group of infectious diseases caused by microorganisms classified between bacteria and viruses, known as rickettsias. Typhus diseases are characterized by high fever and an early onset of rash and headache.  in Krasnoyarsk region. Zh Mikrobiol Epidemiol Immunobiol 1943;1-2:9-64.

(6.) Zdrodovski PF, Galinevich EM. The Rickettsial diseases. London: Pergamon Press; 1960.

(7.) Savitskaya EM. On etiology of tick-borne typhus in Khabarovsk region. Zh Mikrobiol Epidemiol Immunobiol 1943;10-11:87.

(8.) Mayevsky MM Recent news and findings in rickettsiology. Zh Mikrobiol Epidemiol Immunobiol 1947;4:3-14.

(9.) Balayeva NM, Eremeeva ME, Ignatovich VE, Rudakov NV, Reshetnikova TA, Samoilenko IE, et al. Biological and genetic characterization of Rickettsia sibirica strains isolated in the endemic area Endemic area
A geographical region where a particular disease is prevalent.

Mentioned in: Leprosy, Scrub Typhus
 of the North Asian tick typhus. Am J Trop Med Hyg 1996;55:685-92.

(10.) Yu X, Jin Y, Fan M, Xu G, Liu Q, Raoult D. Genotypic and antigenic identification of two new strains of spotted fever group rickettsiae isolated from China. J Clin Microbiol 1993;31:83-8.

(11.) Raoult D, Brouqui P, Roux Roux , Pierre Paul Émile 1853-1933.

French bacteriologist. His work with the diphtheria bacillus led to the development of antitoxins to neutralize pathogenic toxins.
 V. A new spotted-fever group rickettsiosis. Lancet 1996;348:412.

(12.) Fournier PE, Tissot-Dupont H, Gallais H, Raoult D. Rickettsia mongolotimonae, a rare pathogen in France. Emerg Infect Dis 2000;6:290-2.

(13.) Fan MY, Zhang JZ, Chen M, Yu XJ. Spotted fever group rickettsioses in China. In: Raoult D, Brouqui P, editors. Rickettsiae and rickettsial diseases at the turn of the third millennium. Paris: Elsevier; 1999. p. 247-57.

(14.) Lou D, Wu YM, Wang B, Wang W, Zhang Z, Zhang XW. Confirmation of patients with tick-borne spotted fever caused by Rickettsia heilongjiangi. Chinese Journal of Epidemiology 1989;10:128-32.

(15.) Zhang JZ, Fan Y, Wu YM, Fournier PE, Roux V, Raoult D. Genetic classification of "Rickettsia heilongjiangii" and "Rickettsia hulinii," two Chinese spotted fever group rickettsiae. J Clin Microbiol 2000;38:3498-501.

(16.) Roux V, Rydkina E, Eremeeva M, Raoult D. Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. Int J Syst Bacteriol 1997;47:252-61.

(17.) Fournier PE, Roux V, Raoult D. Phylogenetic analysis of spotted fever group rickettsiae by study of the outer surface protein rOmpA. Int J Syst Bacteriol 1998;48:839-49.

(18.) Roux V, Raoult D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int J Syst Evol Microbiol 2000;50:1449-55.

(19.) Demaerschalck I, Ben Messaoud A, De Kesel M, Hoyois B, Lobet Y, Hoet P, et al. Simultaneous presence of different Borreliu burgdorferi genospecies in biological fluids of Lyme disease patients. J Clin Microbiol 1995;33:602-8.

(20.) Norman AF, Regnery R, Jameson P, Greene C, Krause DC. Differentiation of Bartonella-like isolates at the species level by PCR-restriction fragment length polymorphism polymorphism, of minerals, property of crystallizing in two or more distinct forms. Calcium carbonate is dimorphous (two forms), crystallizing as calcite or aragonite. Titanium dioxide is trimorphous; its three forms are brookite, anatase (or octahedrite), and rutile.  in the citrate synthase gene. J Clin Microbiol 1995;33:1797-803.

(21.) Anderson BE, Sumner JW, Dawson JE, Tzianabos T, Greene CR, Olson JG, et al. Detection of the etiologic agent of human ehrlichiosis by polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is . J Clin Microbiol 1992;30:775-80.

(22.) Massung RF, Slater K, Owens JH, Nicholson WL, Mather TN, Solberg VB, et al. Nested PCR assay for detection of granulocytic ehrlichiae. J Clin Microbiol 1998;36:1090-5.

(23.) Zhi N, Ohashi N, Rikihisa Y. Multiple p44 genes encoding major outer membrane proteins are expressed in the human granulocytic ehrlichiosis agent. J Biol Chem 1999;274:17828-36.

(24.) Vorobyeva NN, Korenburg EI, Grigoryan YV. Diagnostics of tick-borne diseases in the endemic region of Russia. Wien Klin Wochenschr 2002;114:610-2.

(25.) Fenollar F, Raoult D. Diagnosis of rickettsial diseases using samples dried on blotting paper. Clin Diagn Lab Immunol 1999;6:483-8.

(26.) La Scola B, Raoult D. Laboratory diagnosis of rickettsioses: current approaches to diagnoses of old and new rickettsial diseases. J Clin Microbiol 1997;35:2715-27.

(27.) Raoult D, Roux V. Rickettsioses as paradigms of new or emerging infectious diseases. Clin Microbiol Rev 1997;10:694-719.

Dr. Mediannikov is a postgraduate student in the Laboratory of Rickettsial Ecology, Gamaleya Research Institute of Epidemiology and Microbiology, Moscow, Russia. In 2002 to 2003, he spent 5 months in the Laboratory of Rickettsiology, Mediterranean University, Marseilles. His interests include the microbiology and epidemiology of tick-borne infections.

Address for correspondence: Oleg Y. Mediannikov, Unite des Rickettsies, Faculte de Medecine, CNRS CNRS Centre National de la Recherche Scientifique (National Center for Scientific Research, France)
CNRS Centro Nacional de Referencia Para El Sida (Argentinean National Reference Center for Aids) 
 UMR UMR Unite Mixte de Recherche (French: Mixed Unit of Research )
UMR University of Missouri - Rolla
UMR Upper Mississippi River
UMR Uniform Methods and Rules (US Department of Agriculture)
UMR Unit Manning Report
 6020 27, Universite de la Mediterranee, Bd Jean Moulin, 27, 13385 Marseille, Cedex 05, France; fax: +33-04-91-83-03 90; email: olegusss1@mail.ru

Oleg Y. Mediannikov, * ([dagger]) ([double dagger]) Yuri Sidelnikov, ([dagger]) Leonid Ivanov, ([section]) Eugenia Mokretsova, ([dagger]) Pierre-Edouard Fournier, ([double dagger]) Irina Tarasevich, * and Didier Raoult ([double dagger])

* Gamaleya Research Institute of Epidemiology and Microbiology, Moscow, Russia; ([dagger]) Far Eastern State Medical University, Khabarovsk, Russia; ([double dagger]) Universite de la Mediterranee, Marseille, France; and ([section]) Khabarovsk Plague Control Station of Ministry of Health of Russian Federation, Khabarovsk, Russia
COPYRIGHT 2004 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2004, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research
Author:Raoult, Didier
Publication:Emerging Infectious Diseases
Geographic Code:4EXRU
Date:May 1, 2004
Words:5473
Previous Article:Seasonal forecast of St. Louis encephalitis virus transmission, Florida.(Research)
Next Article:Clinical manifestations, laboratory findings, and treatment outcomes of SARS patients.(Research)
Topics:



Related Articles
Israeli spotted fever Rickettsia (Rickettsia conorii Complex) associated with human disease in Portugal.(Brief Article)
First isolation of Rickettsia slovaca from a patient, France. (Letters).
Fatal spotted fever rickettsiosis, Kenya.(Dispatches)
Rickettsia parkeri in Amblyomma triste from Uruguay.(Dispatches)
Human infection with Rickettsia honei, Thailand.(DISPATCHES)
Rickettsia massiliae human isolation.(LETTERS)
Rickettsia slovaca infection, France.(LETTERS)(Letter to the editor)
Rickettsia felis in fleas, Western Australia.
Rickettsia sibirica isolation from a patient and detection in ticks, Portugal.(RESEARCH)
Japanese spotted fever, South Korea.(DISPATCHES)(Rickettsia)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles