Printer Friendly
The Free Library
7,774,290 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

Accidental infection of laboratory worker with vaccinia virus. (Dispatches).


We report the accidental needlestick inoculation of a laboratory worker with vaccinia virus. Although the patient had previously been vaccinated against smallpox, severe lesions appeared on the fingers. Western blot and polymerase chain reaction--restriction fragment length polymorphism were used to analyze the virus recovered from the lesions. The vaccinia virus--specific immunoglobulin G levels were measured by enzyme-linked immunosorbent assay enzyme-linked immunosorbent assay
n.
ELISA.


Enzyme-linked immunosorbent assay (ELISA)
A diagnostic blood test used to screen patients for AIDS or other viruses.
. Our study supports the need for vaccination for laboratory workers that routinely handle orthopoxvirus.

**********

The smallpox vaccine, formulated with vaccinia virus, is a highly effective immunizing agent. In 1980, the World Health Organization certified that the world was free of naturally occurring smallpox, and smallpox immunization programs were subsequently discontinued (1). Vaccination is still recommended for particular groups, namely, healthcare workers who handle materials potentially infected with vaccinia virus or other orthopoxviruses that infect humans (2).

The use of vaccinia virus in laboratories is likely to increase as a consequence of international concerns about the potential use of variola variola /va·ri·o·la/ (vah-ri´o-lah) smallpox.vari´olarvari´olous

va·ri·o·la
n.
See smallpox.



va·ri
 (smallpox) virus as a bioterrorism weapon. The vaccine is considered safe but can produce mild to moderate disease in vaccinees and can be disseminated to their close contacts (1,3,4). Accidental infections have also been reported. In 1991, an accidental infection with recombinant vaccinia virus was described after a needlestick injury on the left thumb of a laboratory worker (5). A case of vaccinia keratouveitis has been reported after accidental ocular autoinoculation autoinoculation /au·to·in·oc·u·la·tion/ (-in-ok?u-la´shun) inoculation with microorganisms from one's own body.

au·to·in·oc·u·la·tion
n.
 from a recent vaccination site (6). We now report the accidental infection of a laboratory worker who manipulated vaccinia virus-infected cells.

Case Report

A 26-year-old healthy laboratory worker, previously vaccinated against smallpox in childhood, sought treatment in March 2002 with a history of pain followed by the appearance of erythema and a pustule pustule /pus·tule/ (pus´tul) a small, elevated, circumscribed, pus-containing lesion of the skin.pus´tular

pus·tule
n.
1.
 on the left thumb (Figure 1A). These symptoms appeared 3 days after she experienced an accidental needlestick while working with material from a vaccinia virus (strain WR--infected cell culture during a virus purification procedure. Local symptoms worsened, and on the days 5 and 6, respectively, she noticed new pustules on the fourth and fifth fingers of the same hand (Figure 1E). Axillary lymphadenopathy was noticed on the day 6 after the accident. On day 8, necrotic areas around the lesions and a large erythemathous lesion appeared on the left forearm. On day 9 after inoculation, the local lesions worsened and amoxicillin/clavunate (1,750/250 mg per day) was administered because of a clinical suspicion of secondary bacterial infection (Figure 1B, F). The hand lesions were surgically excised to remove the necrotic tissue, and pustular pus·tu·lar
adj.
Of, relating to, or consisting of pustules.



pustular

pertaining to or of the nature of a pustule; consisting of pustules.
 fluid was collected for analysis (Figure 1C, G). After the surgical procedure, the patient improved slowly until she made a full recovery (Figure 1D, H), and the lesions healed in approximately 3 weeks.

[FIGURE 1 OMITTED]

Results

Pustular fluid from the lesions was collected and tested for the presence of bacteria and virus. The Gram stain and cultures were negative for bacteria. When a diluted sample of the pustular fluid was added to BSC-40 (monkey kidney) cell culture, a poxviruslike cytopathic effect was evident after 48 h of infection (data not shown). Vaccinia virus proteins were detected in infected cells by 12% sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE SDS-PAGE

sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
), followed by Western Blot analysis West·ern blot analysis
n.
An electrophoretic procedure for separating proteins.
 with rabbit antiserum raised against total vaccinia virus proteins as described before (7). The protein profile was indistinguishable from that of the WR strain of vaccinia virus currently used in the laboratory (Figure 2A). The presence of vaccinia virus genome in the pustular fluid could be demonstrated by polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
), followed by restriction fragment length polymorphism restriction fragment length polymorphism
n. Abbr. RFLP
Intraspecies variations in the length of DNA fragments generated by the action of restriction enzymes and caused by mutations that alter the sites at which these enzymes act, changing
 (RFLP RFLP
abbr.
restriction fragment length polymorphism



RFLP

restriction fragment length polymorphism.

RFLP 
) of the phenol-chloroform-extracted DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 from BSC-40 cells infected with the clinical sample for 24 h at 37[degrees]C (8). Total DNA isolated from cells infected with the vaccinia virus-WR was used as reference. Two regions of the vaccinia virus genome were analyzed by using the following PCR primers: A24Rfwd 5'ATGAAAAAAAACACTGATTC and A24Rrev 5'TTACACCAGAAAAGACGGCT; B9Rfwd 5'GACTAAATATTCATAA and B 14Rrev 5'TACTAAAGTTCCGTCATC. The A24R gene was used as marker for the nonvariable region of the virus genome, and the PCR amplicons were digested with the endonucleases SspI and RsaI (New England Biolabs New England Biolabs (NEB) produces and supplies reagents for the life science industry. NEB offers a large selection of recombinant and native enzymes for genomic research. It also offers products in the areas related to proteomics and drug discovery. , Beverly, MA, USA), as recommended by the manufacturer. The variable region of vaccinia virus genome was investigated by amplifying the DNA segment from the B9R to B 14R genes and digestion of the amplicons with EcoR V and AluI (Life Technologies, Rockville, MD, USA), as recommended. The digestion products were analyzed by using 1.2% agarose gels. The restriction patterns obtained for both regions in the test sample were identical to the profiles observed with the genome of vaccinia virus-WR (Figure 2B).

[FIGURE 2 OMITTED]

Serum collected from the patient day 20 after the initial inoculation was tested for vaccinia virus-specific immunoglobulin (Ig) G response by enzyme-linked immunosorbent assay (ELISA ELISA (e-li´sah) Enzyme-Linked Immuno-Sorbent Assay; any enzyme immunoassay using an enzyme-labeled immunoreactant and an immunosorbent.

ELISA
n.
) as described (9,10). Purified vaccinia virus (1 [micro]g/mL in 0.05 M carbonate buffer, pH 9.6) was used as the antigen, and the serum samples were diluted 1/100. Bound antibodies were detected with peroxidase-labeled, anti-human IgG (Biolab Diagnostica, Sao Paulo, Brazil) dulated 1/8,000 as described (9,10). The optical density (OD) values were obtained with a microtiter plate spectrophotometer at 450 nm (BioRad, Model 3550 UV, Bio-Rad Laboratories, Hercules, CA, USA). The test serum specimen was compared to a panel of serum specimens from 22 unvaccinated persons and 11 persons who had been vaccinated some time previously, including a sample from the laboratory worker taken 6 years before the accident. When we compared the serum specimens collected before and after the accident, we observed an increase by a factor of 3.5 in the IgG-antibody response to vaccinia virus (Figure 2C). Furthermore, the vaccina virus-specific IgG levels in the test serum were 1.6 to 2.8 times higher than the levels in the panel of positive control samples and >5 times higher than levels in naive persons. Together, these results confirm that after the recent accident, a productive infection was found in the lesion and an immune response to vaccina virus was elicited.

Conclusions

Accidental infection with live pathogens by healthcare and laboratory workers has been frequently reported (11,12). The risk of infection cannot be avoided, although it can be prevented or minimized by safety measures. In some cases, vaccination of the workers is the best way to prevent the disease; however, vaccines are not always available.

We report the response of a laboratory worker to an accidental needlestick inoculation with vaccinia virus in 2002. After the accident, typical symptoms of vaccinia infection developed in the worker, followed by full recovery 4 weeks later. Vaccinia virus could be reisolated from the pustular fluid, and no major variation from the original seed virus was detected. Although the patient had been vaccinated against smallpox >20 years ago, a serum sample isolated 6 years before the accident showed a level of vaccina virus-specific IgG antibodies approximately 2 times higher than the level in naive persons. This level of humoral immunity was not able to prevent the progression of the infection as would be expected if she had been vaccinated recently. This result indicates that despite the high IgG levels induced after vaccina virus inoculation, persons vaccinated for >20 years are no longer fully protected against vaccina virus infection and could be vulnerable to variola virus or other orthopoxviruses that infect humans.

Nevertheless, we should consider some aspects of this accident that are not common in other situations (e.g., revaccination re·vac·ci·na·tion
n.
Vaccination of a person previously vaccinated.
). The amount of virus in the needle before the accident was approximately 1,000 times higher than the amount in the vaccine preparations used for smallpox vaccination (1). Even in a recently vaccinated person, a response to an infection of such high magnitude will most likely result in a local lesion. However, the question of whether a major reaction with severe symptoms would emerge in this hypothetical situation remains. Usually, a severe reaction has occurred only when a long period has elapsed after vaccination (1). Therefore, after a properly conducted risk assessment, laboratory workers vaccination should be considered as an occupational protection measure against accidental exposure to orthopoxviruses. The results of this study support the current Advisory Committee on Immunization Practices The Advisory Committee on Immunization Practices (ACIP) consists of fifteen advisors to the Centers for Disease Control and Prevention (CDC), selected by the Secretary of the United States Department of Health and Human Services, to provide advice and guidance on the most effective  guidelines that recommend a 1-year vaccination regimen for workers who handle low-virulence poxvirus poxvirus

Any of a group of viruses responsible for a wide range of pox diseases in humans and other animals. Poxvirus was the cause of smallpox. (Human chickenpox is caused by varicella-zoster virus.
 and a 3-year regimen for workers that handle high-virulence strains.

This work was partly supported by grants from Conselho Nacional de Desenvolvimento Cientifico e Tecnologico (CNPq) and Fundacao Carlos Chagas Filho Carlos Chagas Filho (b. September 19, 1910; d. February 16, 2000, Rio de Janeiro, Brazil) was a Brazilian physician, biologist and scientist active in the field of neuroscience.  de Amparo a Pesquisa do Estado do Rio de Janeiro Rio de Janeiro, city, Brazil
Rio de Janeiro (rē`ō də zhänā`rō, Port. rē` thĭ zhənĕē`r
 (FAPERJ) to C.D.; FAPERJ and CNPq to N.M., A.C., and B.N. were recipients of a fellowship from CNPq.

References

(1.) Fenner F, Henderson DA, Arita I, Jezek Z, Ladnyi ID. Smallpox and its eradication. Geneva Geneva, canton and city, Switzerland
Geneva (jənē`və), Fr. Genève, canton (1990 pop. 373,019), 109 sq mi (282 sq km), SW Switzerland, surrounding the southwest tip of the Lake of Geneva.
: World Health Organization; 1988.

(2.) Vaccinia (smallpox) vaccine, 2001: recommendations of the Advisory Committee on Immunization Practices (ACIP ACIP Cardiology A clinical trial–Asymptomatic Cardiac Ischemia Pilot Study that evaluated 3 therapeutic strategies2 for ↓ myocardial ischemia during exercise testing. ). MMWR MMWR Morbidity & Mortality Weekly Report Epidemiology A news bulletin published by the CDC, which provides epidemiologic data–eg, statistics on the incidence of AIDS, rabies, rubella, STDs and other communicable diseases, causes of mortality–eg,  Morb Mortal Wkly Rep 2001;50:1-25.

(3.) Spencer, RC, Lightfoot, NF. Preparedness and response to bioterrorism. J Infect 2001;43:104-10.

(4.) Centers for Disease Control and Prevention Centers for Disease Control and Prevention (CDC), agency of the U.S. Public Health Service since 1973, with headquarters in Atlanta; it was established in 1946 as the Communicable Disease Center. . Smallpox response plan and guidelines (version 3.0). October 28, 2002. Available from: URL URL
 in full Uniform Resource Locator

Address of a resource on the Internet. The resource can be any type of file stored on a server, such as a Web page, a text file, a graphics file, or an application program.
: http://www.bt.cdc.gov/agent/smallpox/response-plan/index.asp

(5.) Openshaw PJM, Alwan WH, Cherrie AH, Record FM. Accidental infection of laboratory worker with recombinant vaccinia virus. Lancet 1991;338:459.

(6.) Lee SF, Buller R, Chansue E, Hanika WC, Brunt EM, Aquino T, et al. Vaccinia keratouveitis manifesting as a masquerade syndrome. Am J Ophthalmol 1994; 117:480-7.

(7.) Damaso CRA See Community Reinvestment Act. , Esposito JJ, Condit RC, Moussatche N. An emergent poxvirus from humans and cattle in Rio de Janeiro State: Cantagalo virus may derive from Brazilian smallpox vaccine. Virology 2000; 277:439-49.

(8.) Damaso CRA, Oliveira MF, Massarani SM, Moussatche N. Azathioprine azathioprine: see metabolite.  inhibits vaccinia virus replication in both BSC-40 and RAG cell lines acting on different stages of virus cycle. Virology 2002;300:79-91.

(9.) Peralta RHS, Vaz AJ, Pardini A, Macedo HW, Machado LR, De Simone SG, et al. Evaluation of an antigen from Taenia crassiceps cysticercus Cysticercus /Cys·ti·cer·cus/ (-ser´kus) a former genus of larval forms of Taenia, including C. cellulo´sae, the larva of Taenia solium and C. bo´vis, the larval form of Taenia saginata.  for the serodiagnosis serodiagnosis /se·ro·di·ag·no·sis/ (-di?ag-no´sis) diagnosis of disease based on serologic tests.serodiagnos´tic

se·ro·di·ag·no·sis
n. pl.
 of neurocysticercosis. Acta Trop 2002;83:159-58.

(10.) Konya J, Thompson CH, De Zwart-Steffe RT. Enzyme-linked immunosorbent assay for measurement of IgG antibody to Molluscum contagiosum virus and investigation of the serological relationship of the molecular types. J Virol Methods 1992;40:183-94.

(11.) Herwaldt BL. Laboratory-acquired parasitic infections from accidental exposures. Clin Microbiol Rev 2001;14:659-88.

(12.) Zule WA, Desmond DP, Neff JA. Syringe type and drug injector risk for HIV infection: a case study in Texas. Soc Sci Med 2002;55:1103-13.

Address for correspondence: Nissin Moussatche, Laboratorio de Biologia Molecular de Virus, Instituto de Biofisica Carlos Chagas Filho, CCS. Av. Brigadeiro Trompovsky s/n., Universidade Federal do Rio de Janeiro The Federal University of Rio de Janeiro (Portuguese: Universidade Federal do Rio de Janeiro, UFRJ) is the largest federal university of Brazil, where state-owned universities are the best and most qualified institutions. , Ilha do Fundao, 21941-590, Rio de Janeiro, Brazil; fax: +55 (21) 2280-8193; email: nissin@biof.ufrj.br

Nissin Moussatche, * Mari Tuyama, ([dagger]) Sayuri E.M. Kato, * Ana Paula V. Castro, * Brian Njaine, * Regina H. Peralta, ([double dagger]) Jose M. Peralta, ([double dagger]) Clarissa R.A. Damaso, * and Paulo F. Barroso ([dagger])

* Instituto de Biofisica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro Brazil; ([dagger]) Hospital Universitario Clementino Fraga Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil; and ([double dagger]) Instituto de Microbiologia Prof. Paulo de Goes, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil

Dr. Moussatche is an associate professor at the Instituto de Biofisica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, and head of the Laboratorio de Biologia Molecular de Virus there. His main research interests include host-cell interactions and the molecular biology of Cantagalo virus (an emergent poxvirus isolated in Brazil) and general molecular aspects of vaccinia virus transcription and DNA replication.
COPYRIGHT 2003 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2003, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Barroso, Paulo F.
Publication:Emerging Infectious Diseases
Geographic Code:3BRAZ
Date:Jun 1, 2003
Words:1943
Previous Article:Human rabies: a reemerging disease in Costa Rica? (Dispatches).
Next Article:Anthroponotic cutaneous Leishmaniasis, Kabul, Afghanistan. (Dispatches).
Topics:



Related Articles
A vaccine for all seasons; genetic engineering is remodeling the smallpox vaccine to provide immunity against many other diseases. (includes related...
AIDS virus protein coat lethal.
Giving potential AIDS vaccines a 'boost.'
SMALLPOX VACCINES ORDERED BUSH TARGETS HOSPITAL STAFFERS, MILITARY.(News)
Smallpox vaccination begins in U.S.--precautions needed.
The vaccinia dilemma: smallpox shot poses modest danger, uncertain benefit.
DES6 INHIBITS SPREAD OF VACCINIA VIURUS IN TISSUE CULTURE.
Flow cytometry and T-cell response monitoring after smallpox vaccination.(Dispatches)
Frequency of revaccination against smallpox.(Commentary)
Ocular vaccinia infection in laboratory worker, Philadelphia, 2004.(DISPATCHES)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles