Printer Friendly
The Free Library
14,487,682 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

AP-1, NF[kappa]B, and ERK activation thresholds for promotion of neoplastic transformation in the mouse epidermal JB6 model. (Articles).


The promotion-sensitive mouse epidermal Epidermal
Referring to the thin outermost layer of the skin, itself made up of several layers, that covers and protects the underlying dermis (skin).

Mentioned in: Antiangiogenic Therapy, Histiocytosis X


epidermal
 JB6 cells (clone 41) have been used to identify the tumor-promoting activity of various compounds. Because treatment by tumor promoters [12-O-tetradecanoylphorbol-13-acetate (TPA (Transient Program Area) See transient area.

TPA - Transient Program Area
), epidermal growth factor Epidermal growth factor or EGF is a growth factor that plays an important role in the regulation of cell growth, proliferation and differentiation. Human EGF is a 6045 Da protein with 53 amino acid residues and three intramolecular disulfide bonds.  (EGF EGF
abbr.
epidermal growth factor
), or tumor necrosis factor tumor necrosis factor
n. Abbr. TNF
A protein that is produced in the presence of an endotoxin, especially by monocytes and macrophages, is able to attack and destroy tumor cells, and exacerbates chronic inflammatory diseases.
 alpha (TNF TNF
abbr.
tumor necrosis factor


TNF,
n an abbreviation for tumor
necrosis
f
[alpha])] transforms clone 41 cells to anchorage-independent and tumorigenic tu·mor·i·gen·ic
adj.
Capable of causing tumors.
 phenotypes, they are considered to be undergoing late-stage tumor promotion. Here we address the question of how much activation of transformation-relevant transcription factors [activator protein-1 (AP-1), ternary complex factors (TCFs), or nuclear factor [kappa]B (NF[kappa]B)] is required for transformation response and how much tumor promoter produces significant risk of transformation. Stable transfectants harboring a reporter construct with an AP-1 response element, serum-response element (SRE SRE Secretaría de Relaciones Exteriores (México)
SRE Sex and Relationship Education
SRE Serum Response Element (biochemistry)
SRE Software Reliability Engineering
SRe Seychelles Rupee
), or NF[kappa]B response element were established. We examined the relationship between concentration of tumor promoters, key signaling events, and activation of the transcription factors. A concentration of > 0.2 nM TPA or 0.12 ng/mL (0.02 nM) EGF produced a significant increase in transformation response as well as in extracellular signal-regulated protein kinase protein kinase /pro·tein ki·nase/ (pro´ten ki´nas) an enzyme that catalyzes the phosphorylation of serine, threonine, or tyrosine groups in enzymes or other proteins, using ATP as a phosphate donor.  (ERK ERK Extracellular Signal-Regulated Kinase
ERK Electronic Records Keeping
ERK Externally Regulated Kinases
), SRE, or AP-1 activation. Treatment with > 0.4 U/mL (2.35 pM) TNF[alpha] increased NF[kappa]B activity and transformation response in a dose-dependent manner. However, transformation response decreased at > 33 U/mL TNF[alpha] due to a cytotoxic response. These findings suggest that the signaling pathway leading to the activation of ERK, TCF See Trenton Computer Festival. , and AP-1 proteins constitutes a major factor determining the risk of tumor promotion by TPA or EGF. Cell toxicity in addition to NF[kappa]B activation should be considered in predicting TNF[alpha]-induced transformation response. Key words: activator protein-1, epidermal growth factor, nuclear factor [kappa]B, serum-response element, 12-O-tetradecanoylphorbol-13-acetate, transformation, tumor necrosis tumor necrosis Death of tumor tissue, a common event in aggressive CAs in which the tumor rapidly outgrows its blood supply, resulting in tumor cell death. Cf Apoptosis.  factor-[alpha]. Environ Health Perspect 110:865-870 (2002). [Online 18 July 2002] http://ehpnet1.niehs.nih.gov/docs/2002/110p865-870suzukawa/abstract.html

**********

Multistage carcinogenesis multistage carcinogenesis A general term referring to the development of cancer through multiple steps of oncogene activation and tumor suppressor inactivation. See One-hit, two-hit model, p53, Tumor.  consists of initiation, promotion, and progression. Tumor promotion is a stepwise stepwise

incremental; additional information is added at each step.


stepwise multiple regression
used when a large number of possible explanatory variables are available and there is difficulty interpreting the partial regression
 process: It occurs with comparatively low frequency, requires the chronic action of tumor promoters, and does not necessarily involve genotoxic genotoxic /ge·no·tox·ic/ (je´no-tok?sik) damaging to DNA: pertaining to agents known to damage DNA, thereby causing mutations, which can result in cancer.

ge·no·tox·ic
adj.
 damage. The mouse skin model is an excellent example of multistage carcinogenesis. The concentration of initiator (typically dimethylbenz[a]anthracene anthracene (ăn`thrəsēn), C14H10, solid organic compound derived from coal tar. It melts at 218°C; and boils at 354°C;. ; DMBA DMBA 9,10-Dimethylbenz-A-Anthracene ) can be decreased to produce genotoxic damage in the absence of tumor formation. Sequential exposure of initiated cells to various tumor promoters (e.g., 12-O-tetradecanoyl-phorbol-13-acetate; TPA) at an optimal concentration results in a robust tumor response. Because tumor initiation occurs rapidly and tumor promotion requires several months (i.e., 20-40% of a mouse lifetime), tumor promotion is considered a rate-limiting step (1). In vivo in vivo /in vi·vo/ (ve´vo) [L.] within the living body.

in vi·vo
adj.
Within a living organism.



in vivo adv.
 studies support a dose threshold for skin papilloma papilloma /pap·il·lo·ma/ (pap?il-o´mah) a benign tumor derived from epithelium.papillo´matous

fibroepithelial papilloma  a type containing extensive fibrous tissue.
 formation in response to TPA (2,3). Therefore, defining molecular thresholds in transformation-related signal transduction pathways is expected to provide a scientific basis to improve cancer risk assessment.

Although in vivo data are significant to whole organisms, in vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment.

in vi·tro
adj.
In an artificial environment outside a living organism.
 systems are more readily manipulated and have advantages in terms of cost and time. The JB6 mouse epidermal cell model of genetic variants is unique in that it allows a detailed investigation of the molecular events specific to tumor promotion. Promotion-sensitive clones of the mouse epidermal cell line JB6 (clone 41) respond irreversibly to tumor promoter treatment with colony growth under anchorage-independent conditions and induced tumor formation (1,4). Anchorage-independent transformation has been observed in clone 41 cells treated with TPA, epidermal growth factor (EGF), tumor necrosis factor alpha (TNF[alpha]) (5), and other tumor promoters (6). Molecular events implicated im·pli·cate  
tr.v. im·pli·cat·ed, im·pli·cat·ing, im·pli·cates
1. To involve or connect intimately or incriminatingly: evidence that implicates others in the plot.

2.
 as required for tumor promotion or tumor maintenance in the JB6 model have proved to be predictive for initiation-promotion mouse skin carcinogenesis car·ci·no·gen·e·sis
n.
The production of cancer.



carcinogenesis

production of cancer.


biological carcinogenesis
viruses and some parasites are capable of initiating neoplasia.
 in vivo (7) and for human keratinocyte keratinocyte /ke·rat·i·no·cyte/ (ker-at´in-o-sit) the epidermal cell that synthesizes keratin, known in its successive stages in the layers of the skin as basal cell, prickle cell, and granular cell.  progression (8,9). Therefore, the JB6 model provides a common framework to directly compare transformation-related signal transduction induced by diverse tumor promoters acting through different modes of action.

In particular, the mitogen-activated protein kinases ERK-1 and ERK-2 (extracellular signal-regulated protein kinases 1 and 2) are acutely activated by many extracellular stimuli and by oncogene oncogene

Gene that can cause cancer. It is a sequence of DNA that has been altered or mutated from its original form, the proto-oncogene (see mutation). Proto-oncogenes promote the specialization and division of normal cells.
 products (10). Overexpression of ERK-2 converts transformation-resistant cells to a transformation-sensitive phenotype (11), and inhibition of ERK activity converts sensitive cells to a transformation-resistant phenotype (12). The ERK-deficient JB6 cells are characterized as deficient in inducible activator protein-1 (AP-1) transcriptional activity, a response that is rescued by ERK-2 expression (7,13-15). Because oncogenic oncogenic /on·co·gen·ic/ (-jen´ik) giving rise to tumors or causing tumor formation; said especially of tumor-inducing viruses.

on·co·gen·ic or on·cog·e·nous
adj.
 activation of several signal transduction pathways can increase AP-1 activity (16,17), these findings indicate that activation of ERK-1 and ERK-2 is essential for activation of AP-1 and for transformation by TPA or EGF in the JB6 model.

In addition, the serum-response element (SRE) mediates activation of c-fos transcription by growth factors, cytokines Cytokines
Chemicals made by the cells that act on other cells to stimulate or inhibit their function. Cytokines that stimulate growth are called "growth factors.
, and other extracellular stimuli that activate mitogen-activated protein kinase (MAPK MAPK Mitogen-Activated Protein Kinase
MAPK Map Kinase
) pathways. SRE is recognized by a dimer dimer /di·mer/ (di´mer)
1. a compound formed by combination of two identical molecules.

2. a capsomer having two structural subunits.


di·mer
n.
1.
 of the serum response factor (SRF SRF
abbr.
somatotropin-releasing factor
), whose binding recruits the monomeric ternary complex factors (Elk1, Sap-1a, and Sap-2) that cannot bind SRE alone. Whereas Sap-1a is activated only by ERK and p38 phosphorylation phosphorylation, chemical process in which a phosphate group is added to an organic molecule. In living cells phosphorylation is associated with respiration, which takes place in the cell's mitochondria, and photosynthesis, which takes place in the chloroplasts. , Elk-1 is activated by ERKs, JNK/Sapk, and p38 MAP kinase (18-21). Thus, ERK-dependent phosphorylation of Elk-1 and Sap-1a regulate gene transcription Gene transcription
The process by which genetic information is copied from DNA to RNA, resulting in a specific protein formation.

Mentioned in: Gene Therapy
 through the SRE, and SRE activation is therefore a reliable, alternative indicator of ERK activation.

Nuclear factor kappa B (NF[kappa]B) has been implicated in gene regulation related to cell proliferation, apoptosis, adhesion, immune, and inflammatory responses (22). NF[kappa]B, like AP-1 (13), is required for tumor promoter-induced transformation of JB6 cells (14,15).

The available data with JB6 cells support the existence of thresholds in pathways required for the transformation response, consistent with putative thresholds for tumor-promoting agents in vivo (3). To determine if there is an activation threshold for promoter-induced transformation and to determine how much activation of transformation-relevant transcription factors is required, we established stable reporter clones. Dose-response relationships of transformation, AP-1, SRE, and NF[kappa]B activation by TPA, EGF, or TNF[alpha] revealed activation levels above which there was risk of neoplastic neoplastic /neo·plas·tic/ (ne?o-plas´tik)
1. pertaining to a neoplasm.

2. pertaining to neoplasia.


neoplastic

pertaining to neoplasia or a neoplasm.
 transformation.

Materials and Methods

Cell culture and reagents. Promotion-sensitive mouse epidermal JB6 cells, clone 41, were as previously described and were maintained accordingly (23,24). In brief, JB6 cells were cultured in Eagle's minimal essential medium Eagle's minimal essential medium (EMEM) is a cell culture medium by Harry Eagle that can be used to maintain cells in tissue culture.

It contains:
  • amino acids
  • salts (potassium chloride, magnesium sulfate, sodium chloride, and sodium dihydrogen phosphate)
 (EMEM; BioWhittaker, Walkersville, MD) supplemented with 4% fetal bovine serum Fetal bovine serum ( or foetal bovine serum) is serum taken from the fetuses of cows. Fetal Bovine Serum (or FBS) is the most widely used serum in the culturing of cells. In some papers the expression foetal calf serum is used.  (FBS FBS
abbr.
fasting blood sugar


FBS Fasting blood sugar. See Fasting glucose.
), 2 mM L-glutamine and 25 mg/mL gentamicin gentamicin /gen·ta·mi·cin/ (jen?tah-mi´sin) an aminoglycoside antibiotic complex isolated from bacteria of the genus Micromonospora,  (Life Technologies/Gibco, Gaithersburg, MD). TPA was purchased from LKT LKT Lookout  Laboratories, Inc. (St. Paul, MN). EGF (receptor grade) was purchased from Upstate Biotechnology (Lake Placid, NY, lot 19319). All other cell culture reagents were purchased from BioWhittaker or Life Technologies/Gibco. TNF[alpha] was purchased from PeproTech Inc. (Rocky Hill, NJ). Specific activity is [greater than or equal to] 1 x [10.sup.7] U/mg.

Plasmids and stable transfection trans·fec·tion
n.
Infection of a bacterium or cell with DNA or RNA isolated from a bacteriophage or from an animal or a plant virus, resulting in replication of the complete virus.
. SRE-luciferase reporter construct containing five tandem SRE sequences (AGGATGTCCATATTAGGACATCT) was purchased from Stratagene (La Jolla, CA). AP-1 or NF[kappa]B luciferase luciferase
(loosif´rās´),
n an enzyme present in certain luminous organisms that act to bring about the oxidation of luciferins; energy produced in the
 reporter plasmids consisting of luciferase reporter gene driven by the promoter harboring the appropriate element were described previously (13,14). The AP-1 reporter plasmids consist of firefly luciferase genes driven by an AP-1-responsive promoter containing four copies of flanked AP-1 consensus sequence (TCGACTATGATGAGTCATGGGGC) from GCN GCN Government Computer News
GCN Gamecube Nintendo (gaming)
GCN GIG (Global Information Grid) Computing Nodes
GCN GRB Coordinates Network
GCN Gospel Communications Network
4 and a minimal albumin promoter region with TATA box TATA box

a eukaryotic DNA sequence usually TATAAATA, similar to the Pribnow box of Escherichia coli, occurring in the promoter region 25 to 35 bases upstream from the transcriptional start site that binds the general transcription factor TFIID which begins the formation of
:

AAGCTTAGAATCTAGTATATTAGAGCGAGTCTTTCTGCACACAGAT -CACCTTTCCTATCAACCCCACTACCA TACCCTTCCTCCATCTATACCACCCTACTCTGCAGGTCGAC.

The NF[kappa]B reporter plasmids consisted of firefly luciferase reporter genes driven by a minimal NF[kappa]B-responsive region from an interleukin-6 (IL-6) promoter containing two copies of NF[kappa]B-responsive elements in a sense orientation: GACTCTAGAGGATCAAATGTGGGATTTTCCCAT -GTGGGATTTTCACATGATCATGGGA AAATCCCACATGAAAATCCAATTTCCGGCC.

Because there are no other known responsive cis-elements identified in the above sequences, any cross-family activation should occur at the level of protein-protein, not at the level of protein--DNA interaction.

We performed transfections according to the Fugene6 protocol from Roche molecular biologicals (Indianapolis, IN). In brief, 1 x [10.sup.5] cells were seeded in 10-cm dishes. The next day, 15 [micro]L of Fugene6, 4 [micro]g of reporter DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
, and 1-0.5 [micro]g of pcDNA empty vector were added to 0.5 mL of complete medium. After 10 min of incubation, transfection mixture was added to cell culture dishes. Cells were incubated for 48 hr. G418 selection was started on the transfected population with 500 [micro]g/mL.

Luciferase assay of reporters. We seeded 1 x [10.sup.4] cells/well of reporter cells in 24-well plates. On the next day the cells were starved in EMEM with 0.2% FBS for more than 24 hr to lower the basal transcription factor activation. We treated the resulting cells with various concentrations of TPA, EGF, or TNF[alpha] in EMEM with 0.2% FBS for 3 hr. We observed little or no cell detachment. The stimulated cells were collected and lysed at 3 hr of treatment. The cells were lysed directly on the plate after a single wash with phosphate-buffered saline. We assayed the resulting cell lysates for luciferase activity using the Luciferase Assay Kit (Promega, Madison, WI) and DYNEX Luminometer (DYNEX Technologies, Chantilly, VA). Three independent wells were used for each condition in each experiment. We calculated percent activation of each reporter by the following equation: % activation = [sample relative luciferase units (RLU RLU Relative Light Unit
RLU Relative Luminescence Units
RLU Report Layout Utility (IBM)
RLU Remote Line Unit
RLU Registered Linux User
RLU Raised Leg Urination (wolves)
RLU Rack Location Unit
)--basal RLU]/(maximum RLU--basal RLU) x 100. We used the average RLU of three wells as sample RLU.

Western blots. We seeded 1 x [10.sup.5] cells/well of cells in six-well plates. Cells were starved as described under luciferase assay. Cells were treated with TPA or EGF for 30 min, washed with ice-cold phosphate-buffered saline once, then lysed with lysis buffer (2% SDS 1. (company) SDS - Scientific Data Systems.
2. (tool) SDS - Schema Definition Set.
, 50 mM Tris-HCl pH 7.5). Western immunoblotting immunoblotting,
n the immunologic methods for isolating and quantitatively measuring immunoreactive substances. When used with immune reagents such as monoclonal antibodies, the process is known generically as
Western blot analysis.
 was performed according to the ECL (Emitter-Coupled Logic) A digital circuit composed of bipolar transistors in which the emitter ends are wired together. ECL gates switch faster than TTL gates, but consume more power. See TTL, I2L and bipolar.

1.
 protocol from Amersham Pharmacia Biotech, Inc. (Piscataway, NJ). Anti-ERK-1/2 (p44/42 MAP Kinase) and anti-phosphoERK-1/2 antibodies were purchased from Cell Signaling Technology, Inc. (Beverly, MA). In brief, 20-40 [micro]g of whole-cell lysates were boiled and denatured de·na·ture  
tr.v. de·na·tured, de·na·tur·ing, de·na·tures
1. To change the nature or natural qualities of.

2.
 in sample buffer containing SDS and dithiothreitol (NOVEX, San Diego, CA) followed by gel electrophoresis using NuPAGE 10% Bis-Tris prepacked gel (NOVEX) in 4-morpholine-propanesulfonic acid buffer. The proteins were electro-transferred to nitrocellulose nitrocellulose, nitric acid ester of cellulose (a glucose polymer). It is usually formed by the action of a mixture of nitric and sulfuric acids on purified cotton or wood pulp.  membrane (Schleicher & Schuell, Keene, NH) using a semidry sem·i·dry  
adj.
1. Partially dry.

2. Moderately dry. Used of wine.
 transfer blotting system from Enprotech Co. (Hyde Park, MA). The resulting protein-bound membrane was blotted with selected antibodies and visualized using ECL reagents (Amersham Pharmacia Biotech, Inc., Piscataway, NJ) and X-OMAT AR film (Kodak, Rochester, NY). The band intensities were monitored by Kodak digital camera (DC120) and analyzed by its image-analyzing program (Kodak 1D). We determined the lowest and highest intensity as 0% and 100% activation, respectively. Although the peak activation was observed at 30 min, ERK activation was sustained for at least 6 hr (data not shown).

Anchorage-independent transformation assay. We performed promotions of neoplastic transformation assays as described previously (25). In a 60-mm tissue culture dish, 10,000 JB6 cells were resuspended in 1.5 mL of 0.33% agar in EMEM with 10% FBS and layered over 7 mL of 0.5% agar in EMEM with 10% FBS. Both layers of agar were supplemented with DMSO DMSO dimethyl sulfoxide.

DMSO
n.
Dimethyl sulfoxide; a colorless hygroscopic liquid obtained from lignin, used as a penetrant to convey medications into the tissues.


DMSO,
n.
, phosphate-buffered saline, or various concentrations of tumor promoter TPA, EGF, or TNF[alpha]. The cells were cultured at 36[degrees]C for 14 days, and the resulting colonies were counted by an automated image analysis system supported by Image Pro-Plus (version 3.0.1) software (Media Cybernetics cybernetics [Gr.,=steersman], term coined by American mathematician Norbert Wiener to refer to the general analysis of control systems and communication systems in living organisms and machines. , Silver Spring, MD). We scored colonies > 8 cells. The transformation responses are presented as number of colonies per 10,000 cells per 60-mm tissue culture dish.

Results

To assess activation response to small-molecule inducers (tumor promoters), we generated stably transfected reporter cell lines. Such stable reporter cell lines offer the advantage of eliminating the variability that arises with repeated transient transfections. Nine, six, and three clonal transfectants harboring AP-1-, SRE-, and NF[kappa]B-luciferase reporter constructs were isolated, respectively. All of them were sensitive to tumor promoter-induced transformation and exhibited basal and tumor promoter-induced luciferase activity. Among them, we selected two clones of each harboring a luciferase reporter for further analysis.

Activation of MAP kinase ERK-1, -2, and SRE-dependent transcription by TPA or EGF. Using anti-phospho-ERK-1/2 antibody, we measured the amount of phospho-ERK-1/2, an activated form of ERK, in SRE-luciferase reporter (S13) cells treated with varying concentrations of TPA or EGF. Treatment of cells with 0.023-16 nM TPA and 0.030-20 ng/mL (5.0 pM-3.3 nM) EGF produced a dose-dependent increase of ERK activity (Figure 1A, C). Parallel measurements of SRE activation by TPA or EGF are shown in Figure 1B and D. To facilitate the comparison, the optical densities of phospho-ERK shown in Figure 1A and C are plotted with the SRE reporter activation shown in Figure 1B and D. TPA treatment yielded similar dose-response curves for SRE and ERK activation, suggesting that SRE activation is a legitimate, alternative indicator of ERK activation under defined conditions. We observed a significant increase of SRE activation at the EGF concentration needed to produce detectable activation of ERK-2. The dose-response curve of ERK activation by EGF did not completely coincide with the one of SRE-Luciferase activation (Figure 1D). This suggests that other MAP kinases such as Jun N-terminal kinase and/or p38 kinase might be involved in the activation of SRE at progressively higher concentrations of EGF (26). Two SRE reporter clones (S12 and S13) showed different basal luciferase activity and produced 3.3- and 2.9-fold increase of luciferase activity by 5.3 nM TPA, respectively (data not shown). When the data are plotted as percent of maximum activation, the two clones show similar dose response to TPA or EGF treatment (Figure 2A, B). Concentrations > 0.2 nM TPA or > 0.12 ng/mL (0.02 nM) EGF produced a significant increase in SRE activation.

[FIGURES 1-2 OMITTED]

Activation of AP-1-dependent gene expression and transformation response by TPA or EGF. Two independent AP-1 reporter clones (A3 and A9) also showed concentration-dependent activation of AP-1-dependent transcription in response to TPA or EGF treatment (Figure 3A, B). Apparent threshold concentrations for producing significant activation of AP-1 are 0.2 nM TPA and 0.12 ng/mL (19.8 pM) EGF. We determined anchorage-independent transformation response to TPA or EGF at varying concentrations. More than 0.2 nM TPA or 0.12 ng/mL (0.02 nM) EGF--concentrations that produced significant activation of SRE or AP1--also produced a significant increase in transformation response (Figure 4A, B).

[FIGURES 3-4 OMITTED]

Activation of NF[kappa]B-dependent gene expression and transformation response by TNF. NF[kappa]B reporter clones N3 and N5 showed concentration-dependent NF[kappa]B activation by TNF[kappa] (Figure 5). Significant NF[kappa]B activation occurred at 0.4 U/mL, and maximal activation occurred at 33 U/mL. Determination of the transformation response to TNF[alpha] revealed that although the number of colonies increased up to 11 U/mL TNF[alpha], it sharply decreased with higher doses (Figure 6A). This dose-response curve is consistent with our previous report (5). The number of total objects (colonies plus single cells) at the time of soft agar assay decreased at more than 11 U/mL TNF[alpha] (Figure 6B, lower panel). This suggests that the decreased transformation response at high dose is caused by TNF[alpha] induced cell toxicity (27,28). A comparison of TNF[alpha]-induced NF[kappa]B activation and transformation response for clone N3 is shown in Figure 6B (top panel). The most noteworthy feature of this comparison is the dissociation of TNF[alpha]mediated NF[kappa]B activation from the transformation response at progressively higher doses. The slight shift in the TNF[alpha] dose response for transformation of N3 clonal cells, relative to the parental clone 41 cell line, indicates that we selected clones with greater sensitivity to the cytotoxicity response.

[FIGURES 5-6 OMITTED]

We chose to focus on the correlation between second messenger activation and inducible ([greater than or equal to] 2-fold) transcriptional activities. Less than a 2-fold induction does not provide sufficient separation from background signal standard deviation In statistics, the average amount a number varies from the average number in a series of numbers.

(statistics) standard deviation - (SD) A measure of the range of values in a set of numbers.
 to provide meaningful comparisons. Because TPA or EGF produced < 2-fold maximal induction of NF[kappa]B activation, and because TNF[alpha] produced less than 2-fold maximal AP-1 activation, dose-response analyses for the respective ligand-induced transcriptional activities were not pursued using the respective cloned reporter cell lines.

Discussion

These results establish that there are thresholds of activation of ERK-1, ERK-2, AP-1, or NF[kappa]B above which there is risk of transformation by TPA, EGF, or TNF[alpha]. Concentrations > 0.2 nM (0.12 ng/mL) TPA (Figure 4A), 0.12 ng/mL (0.02 nM) EGF (Figure 4B), or 1 U/mL TNF[alpha] (Figure 6A) produced significant increases in transformation response by mouse epidermal JB6 cells, while responses to lower concentrations were comparable to background. Fifty percent of maximal response to TPA was seen at 0.69 [+ or -] 0.19 nM for SRE activation, AP-1 activation, and transformation response (Figure 7). Fifty percent of maximal response to EGF was seen at 1.4 [+ or -] 0.6 ng/mL (229 pM) for SRE activation, AP-1 activation, and transformation response (Figure 8). A concentration of 10 ng/mL TPA and 10 ng/mL EGF are equal to 1.6 nM and 0.17 nM, respectively. These relatively high concentrations, which produce maximal response, are typical concentrations used in previous reports (11,29). The magnitude of AP-1 activation thus predicts transformation response by TPA or EGF. Because AP-1 activation is required for TPA- or EGF-induced transformation of JB6 cells (13) and for tumor promotion in mouse skin (7), AP-1 activation is a good predictor of transformation response by TPA or EGF. This finding allows one to do 3-hr assays instead of time-consuming 14-day assays to assess promotion of transformation response to TPA or EGF.

[FIGURES 7-8 OMITTED]

Regression analysis In statistics, a mathematical method of modeling the relationships among three or more variables. It is used to predict the value of one variable given the values of the others. For example, a model might estimate sales based on age and gender.  shows the close relationship between SRE activation, AP-1 activation, and transformation responses to TPA or EGF. The magnitude of AP-1 activation! by TPA or EGF shows a linear relationship to the magnitude of SRE activation with a slope close to 45 [degrees] (Figure 9A). Moreover, the magnitude of transformation response is linearly related to the magnitude of AP-1 activation by TPA or EGF, again with a slope close to 45 degrees (Figure 9B). This indicates that the magnitude of either SRE activation or AP-1 activation constitutes a reliable predictor of the magnitude of transformation risk in response to TPA or EGF. The amount of SRE activation indicates the amount of ERK activation by TPA or EGF (Figure 1B). Consistent with previous findings (11,12), ERK activation not only is essential but is also a major determinant of AP-1 activation, which in turn is a major determinant of transformation response to TPA.

[FIGURE 9 OMITTED]

SRE activation leading to c-fos transcription, although a good risk indicator, is not sufficient for transformation because promotion-resistant cells can induce c-fos expression in response to TPA or EGF (24). Thus, the tight correlation between ERK and SRE activity in the initial 3 hr with the transformation response suggests that these acute molecular readouts are also good alternative indicators of subsequent transformation response to TPA and EGF.

EGF and TNF[alpha] are biologically more significant tumor promoters than TPA because these are endogenous growth factors/cytokines produced in response to many stimuli. In vivo studies with TNF[alpha] knockout mice showed TNF[alpha] is required for TPA-induced tumor promotion (30,31). The present study indicates that TNF[alpha] has a concentration range for producing transformation response. At TNF[alpha] concentrations associated with maximal transformation response (11 U/mL), NF[kappa]B activation is approximately 70% of maximum. Moreover, NF[kappa]B activation continues to increase at progressively higher TNF[alpha] concentrations, despite the sharp switch from transforming activity to cytotoxicity. This dissociation suggests that, although activation of ND[kappa]B plays a role in producing risk, other factors must also be important in determining risk of TNF[alpha]-induced transformation. Low levels spanning the concentration range that precedes the cytotoxic response are predictive for transformation risk due to TNF[alpha] exposure, whereas high levels of NF[kappa]B activation associated with cytotoxicity have no predictive value pre·dic·tive value
n.
The likelihood that a positive test result indicates disease or that a negative test result excludes disease.



predictive value

a measure used by clinicians to interpret diagnostic test results.
.

In practical situations, multiple tumor promoters might be applied sequentially or simultaneously. Assaying an unknown agent in parallel with tumor promoter TPA, EGF, or TNF[kappa] at their threshold concentrations for promotion of transformation will allow one to determine whether exposure to the unknown agent alone activates transcription factor at levels that exceed transformation-relevant thresholds. The unknown agent can also be used in combination with one of the known tumor promoters, and the incremental activation due to the unknown can be compared with transformation-relevant levels of activation. Because the JB6 model has proved to be predictive for revealing molecular events that drive or prevent tumor promotion or maintain tumor phenotype in vivo (7) or in a human keratinocyte model (8,9), this model can be used as a sensitive and rapid initial screen to identify agents likely to present risk of tumor promotion.

The 3-hr transcription factor activation assays are reliable predictors of 14-day transformation outcomes in the JB6 model and of mouse skin tumor promotion. Activation of AP-1 and NF[kappa]B at 3 and 18 hr is required for transformation in the JB6 model (13,15). This is true for multiple classes of agents (6, 32-39). An agent that does not activate AP-1 or ND[kappa]B is unlikely to act as a tumor promoter. Although activation of AP-1 or NF[kappa]B is not sufficient for promotion of transformation, stimulated activation of either transcription factor increases the risk of tumor promotion. It is also known that the elevated AP-1 activation seen at 6 hr is sustained in mouse epidermis after 2 weeks of twice-weekly tumor promotion, and that, when dominant negative jun expression inhibits tumor promotion, it also inhibits the 2-week induction as well as the 6-hr induction of AP-1 (7).

Previous studies revealed that magnetic field exposure does not affect TPA-induced transformation response of JB6 cells (40,41). Defining molecular events that are required for cell transformation and thresholds in signaling pathways associated with the transformation response will allow for flexibility in the application of in vitro model systems directed at defining relative cancer risks at low-dose exposures. Molecular responses in cells cotreated with known tumor promoters and unknown environmental contaminants (physical or chemical) can rapidly be quantitated to determine whether transformation-related signal transduction is induced by the unknown contaminant contaminant /con·tam·i·nant/ (kon-tam´in-int) something that causes contamination.

contaminant

something that causes contamination.
 over a rationally selected range of TPA, EGF, or TNF[alpha] concentrations. Because the molecular response to TPA, EGF, and TNF[alpha] can be directly correlated with transformation response in the agar assay, the results can provide rapid analysis of relative risks. Within this context, we are particularly interested in the cancer risk associated with low-dose radiation exposures. It is difficult to unambiguously define the biological consequences of low-dose radiation exposures due primarily to low signal-to-noise ratio The ratio of the power or volume (amplitude) of a signal to the amount of unwanted interference (the noise) that has mixed in with it. Measured in decibels, signal-to-noise ratio (SNR or S/N) measures the clarity of the signal in a circuit or a wired or wireless transmission channel. . We are optimistic that a cotreatment strategy using low-dose radiation and known tumor promoters will allow a robust measure of the effects of radiation on transformation-related signal transduction. If successful, this work will have broader applications in environmental health concerns, concerns that invariably in·var·i·a·ble  
adj.
Not changing or subject to change; constant.



in·vari·a·bil
 involve low-dose exposures.

REFERENCES AND NOTES

(1.) Cmarik JL, Colburn NH. Use of mouse JB6 cells to identify molecular targets and novel agents for prevention of carcinogenesis. In: International Conference on Food Factors: Chemistry and Cancer Prevention (Ohigashi H, ed). Tokyo:Springer-Verlag, 1997:67-76.

(2.) Kitchin KT, Brown JL, Setzer RW. Dose-response relationship in multistage carcinogenesis: promoters. Environ Health Perspect 102(suppl 1):255-264 (1994).

(3.) Lutz WK, Beland PE, Candrian R, Fekete T, Fischer WH. Dose-time response in mouse skin tumor induction by 7, 12-dimethylbenz[a]anthracene and 12-O-tetradecanoyl-phorbol-13-acetate. Regul Toxicol Pharmacol 23:44-48 (1996).

(4.) Takahashi K, Heine UI, Junker JL, Colburn NH, Rice JM. Role of cytoskeleton cytoskeleton

System of microscopic filaments or fibres, present in the cytoplasm of eukaryotic cells (see eukaryote), that organizes other cell components, maintains cell shape, and is responsible for cell locomotion and for movement of the organelles within it.
 changes and expression of the H-ras oncogene during promotion of neoplastic transformation in mouse epidermal JB6 cells. Cancer Res 46:5923-5932 (1986).

(5.) De Benedetti F, Colburn NH, Oppenheim JJ, Faltynek CR Tumor necrosis factor induces anchorage independent growth of two murine murine /mu·rine/ (mur´en) pertaining to, derived from, or characteristic of mice or rats.

mu·rine
adj.
 non-transformed cell lines. New York New York, state, United States
New York, Middle Atlantic state of the United States. It is bordered by Vermont, Massachusetts, Connecticut, and the Atlantic Ocean (E), New Jersey and Pennsylvania (S), Lakes Erie and Ontario and the Canadian province of
:Wiley-Liss, Inc. 1990.

(6.) Hsu TC, Young MR, Cmarik J, Colburn NH. Activator protein 1 (AP-1)- and nuclear factor kappaB (NF-kappaB)-dependent transcriptional events in carcinogenesis. Free Radic Biol Med 28:1338-1348 (2000).

(7.) Young MR, Li JJ, Rincon M, Flavell RA, Sathyanarayana BK, Hunziker R, Colburn N. Transgenic mice demonstrate AP-1 (activator protein-1) transactivation Transactivation is an increased rate of gene expression triggered either by endogenous cellular or viral proteins - transactivators. These protein factors act in trans (i.e., intermolecularly).  is required for tumor promotion. Proc Natl Aced Sci USA 96:9827-9832 (1999).

(8.) Li JJ, Rhim JS, Schlegel R, Vousden KH, Colburn NH. Expression of dominant negative Jun inhibits elevated AP-1 and NF-kappaB transactivation and suppresses anchorage independent growth of HPV HPV human papillomavirus.

HPV
abbr.
human papilloma virus


Human papilloma virus (HPV) 
 immortalized human keratinocytes Keratinocytes
Cells found in the epidermis. The keratinocytes at the outer surface of the epidermis are dead and form a tough protective layer. The cells underneath divide to replenish the supply.
. Oncogene 16:2711-2721 (1998).

(9.) Li JJ, Cao Y, Young MR, Colburn NH. Induced expression of dominant-negative c-jun downregulates NFkappaB and AP-1 target genes and suppresses tumor phenotype in human keratinocytes. Mol Carcinog 29:159-169 (2000).

(10.) Cobb MH, Hepler JE, Cheng M, Robbins D. The mitogen-activated protein kinases, ERK1 and ERK2. Semin Cancer Biol 5:261-268 (1994).

(11.) Huang C, Ma WY, Young MR, Colburn N, Dong Z. Shortage of mitogen-activated protein kinase is responsible for resistance to AP-1 transactivation and transformation in mouse JB6 cells. Proc Natl Aced Sci USA 95:156-161 (1998).

(12.) Watts RG, Huang C, Young MR, Li JJ, Dong Z, Pennie WD, Colburn NH. Expression of dominant negative Erk2 inhibits AP-1 transactivation and neoplastic transformation. Oncogene 17:3493-3498 (1998).

(13.) Dong Z, Birrer MJ, Watts RG, Matrisian LM, Colburn NH. Blocking of tumor promoter-induced AP-1 activity inhibits induced transformation in JB6 mouse epidermal cells. Proc Natl Acad Sci U S A 91:609-613 (1994).

(14.) Li JJ, Westergaard C, Ghosh P, Colburn NH. Inhibitors of both nuclear factor-kappaB and activator protein-1 activation block the neoplastic transformation response. Cancer Res 57:3569-3576 (1997).

(15.) Hsu TC, Nair R, Tulsian P, Camalier CE, Hegamyer GA, Young MR, Colburn NH. Transformation nonresponsive cells owe their resistance to lack of p65/nuclear factor-kappaB activation. Cancer Res 61:4160-4168 (2001).

(16.) Angel P, Karin M. The role of Jun, Fos and the AP-1 complex in cell-proliferation and transformation. Biochim Biophys Acta 1072:129-157 (1991).

(17.) Ransone LJ, Verma IM. Nuclear proto-oncogenes fos and jun. Annu Rev Cell Biol 6:539-557 (1990).

(18.) Gille H, Strahl T, Shaw PE. Activation of ternary complex factor Elk-1 by stress-activated protein kinases. Curr Biol 5:1191-1200 (1995).

(19.) Whitmarsh AJ, Shore P, Sharrocks AD, Davis RJ. Integration of MAP kinese signal transduction pathways at the serum response element. Science 269:403-407 (1995).

(20.) Price MA, Cruzalegui FH, Treisman R. The p38 and ERK MAP kinase pathways cooperate to activate ternary complex factors and c-fos transcription in response to UV light. Embo J 15:6552-6563 (1996).

(21.) Janknecht R, Hunter T. Convergence of MAP kinase pathways on the ternary complex factor Sap-1a. Embo J 16:1620-1627 (1997).

(22.) May M J, Ghosh S. Rel/NF-kappa B and I kappa B proteins: an overview. Semin Cancer Biol 8:63-73 (1997).

(23.) Bernstein LR, Colburn NH. AP1/jun function is differentially induced in promotion-sensitive and resistant JB6 cells. Science 244:566-569 (1989).

(24.) Ben-Ari ET, Bernstein LR, Colburn NH. Differential c-jun expression in response to tumor promoters in JB6 cells sensitive or resistant to neoplastic transformation. Mol Carcinog 5:62-74 (1992).

(25.) Colburn NH, Former BF, Nelson KA, Yuspa SH. Tumour promoter induces anchorage independence irreversibly. Nature 281:589-591 (1979).

(26.) Nakamura S, Takahashi H, Kinouchi M, Manabe A, Ishida-Yamamoto A, Hashimoto Y, lizuka H. Differential phosphorylation of mitogen-activated protein kinase families by epidermal growth factor and ultraviolet B irradiation in SV40-transformed human keratinocytes. J Dermatol Sci 25:139-149 (2001).

(27.) Singh N, Sun Y, Nakamura K, Smith MR, Colburn NH. c-Jun/AP-1 as possible mediators of tumor necrosis factor-induced apoptotic response in mouse JB6 tumor cells. Oncology Res 7:353-362 (1995).

(28.) Leverkus M, Neumann M, Mengling T, Rauch CT, Brocker EB, Krammer PH, Walczak H. Regulation of tumor necrosis factor-related apoptosis-inducing ligand sensitivity in primary and transformed human keratinocytes. Cancer Res 60:553-559 (2000).

(29.) Li JJ, Dong Z, Dawson MI, Colburn NH. Inhibition of tumor promoter-induced transformation by retinoids Retinoids
A derivative of synthetic Vitamin A.

Mentioned in: Ichthyosis

retinoids (reˑ·t
 that transrepress AP-1 without transactivating retinoic acid retinoic acid /ret·i·no·ic ac·id/ (ret?i-no´ik) an oxidized derivative of retinol, believed to be the form of vitamin A that plays a role in the development and growth of bone and in the maintenance of normal epithelial structures.  response element. Cancer Res 56:483-489 (1996).

(30.) Moore RJ, Owens DM, Stamp G, Arnott C, Burke F, East N, Holdsworth H, Turner L, Rollins B, Pasparakis M, et al. Mice deficient in tumor necrosis factor-alpha Tumor necrosis factor (TNF, cachexin or cachectin and formally known as tumor necrosis factor-alpha) is a cytokine involved in systemic inflammation and is a member of a group of cytokines that all stimulate the acute phase reaction.  are resistant to skin carcinogenesis. Nat Med 5:828-831 (1999).

(31.) Suganuma M, Okabe S, Marino MW, Sakai A, Sueoka E, Fujiki H. Essential role of tumor necrosis factor alpha (TNF-alpha) in tumor promotion as revealed by TNF-alpha-deficient mice. Cancer Res 59:4516-4518 (1999).

(32.) Huang C, Ma WY, Dong Z. The extracellular-signal-regulated protein kinases (Erks) are required for UV-induced AP-1 activation in JB6 cells. Oncogene 18:2828-2835 (1999).

(33.) Huang C, Ma WY, Li J, Goranson A, Dong Z. Requirement of Erk, but not JNK JNK Jun N-terminal Kinase
JNK Junk (File Name Extension) 
, for arsenite-induced cell transformation. J Biol Chem 274:14595-14601 (1999).

(34.) Lu YP, Chang RL, Lou YR, Huang MT, Newmark HL, Reuhl KR, Conney AH. Effect of curcumin on 12-O-tetradecanoylphorbol-13-acetate- and ultraviolet B light-induced expression of c-Jun and c-Fos in JB6 cells and in mouse epidermis. Carcinogenesis 15:2363-2370 (1994).

(35.) Dong Z, Huang C, Brown RE, Ma WY. Inhibition of activator protein 1 activity and neoplastic transformation by aspirin. J Biol Chem 272:9962-9970 (1997).

(36.) Dong Z, Ma W, Huang C, Yang CS. Inhibition of tumor promoter-induced activator protein 1 activation and cell transformation by tea polyphenols, (-)-epigallocatechin gallate gallate

antioxidant used in food preservation, especially in foods containing oils and fats. Includes propyl, octyl and dodecylgallate.
, and theaflavins. Cancer Res 57:4414-4419 (1997).

(37.) Liu G, Chen N, Keji A, Bode AM, Ryan CA, Dong Z. Proteinase proteinase /pro·tein·ase/ (pro´ten-as?) endopeptidase.

pro·tein·ase
n.
A protease that begins the hydrolytic breakdown of proteins usually by splitting them into polypeptide chains.
 inhibitors I and II from potatoes block UVB-induced AP-1 activity by regulating the AP-1 protein compositional patterns in JB6 cells. Proc Natl Aced Sci USA 98:5786-5791 (2001).

(38.) Bode AM, Ma WY, Surh Y J, Dong Z. Inhibition of epidermal growth factor-induced cell transformation and activator protein 1 activation by [6]-Gingerol. Cancer Res 61:850-853 (2001).

(39.) Liu G, Bibus DM, Bode AM, Ma WY, Holman RT, Dong Z. Omega 3 but not omega 6 fatty acids inhibit AP-1 activity and cell transformation in JB6 cells. Proc Natl Aced Sci USA 98:7510-7515 (2001).

(40.) Saffer JD, Chen G, Colburn NH, Thurston SJ. Power frequency magnetic fields do not contribute to transformation of JB6 cells. Carcinogenesis 18:1365-1370 (1997).

(41.) Snawder JE. Effect of magnetic field exposure on anchor-age-independent growth of a promoter-sensitive mouse epidermal cell line (JB6). Environ Health Perspect 107:195-198 (1999).

Kazumi Suzukawa, (1) Thomas J. Weber, (2) and Nancy H. Colburn (1)

(1) Gene Regulation Section, Basic Research Laboratory, National Cancer Institute, Frederick, Maryland, USA; (2) Molecular Biosciences, Pacific Northwest National Laboratory The Pacific Northwest National Laboratory (PNNL) is one of nine United States Department of Energy (DOE) multiprogram national laboratories. The laboratory
PNNL is located in Richland, Washington, and operates a marine research facility in Sequim, Washington.
, Richland, Washington, USA

Address correspondence to N.H. Colburn, Gene Regulation Section, National Cancer Institute, Bldg. 560, Room 21-89, Frederick, MD 21702-1201 USA. Telephone: (301) 846-1342. Fax: (301) 846-6093. E-mail: Colburn@ncifcrf.gov

This research was supported by a grant from the Low Dose Radiation Research Program, Office of Biological and Environmental Research, U.S. Department of Energy (DOE). Pacific Northwest National Laboratory is operated for the DOE by Battelle Memorial Institute The Battelle Memorial Institute is a private not-for-profit applied science and technology development company headquartered in Columbus, Ohio. The institute opened in 1929 but traces its origins to the 1923 will of Ohio industrialist Gordon Battelle which provided for its  under contract DEACO6-76RLO RLO Reusable Learning Object
RLO Resident Liaison Officer (UK)
RLO Records Liaison Officer
RLO Regional Liaison Office
RLO Reserve Liaison Officer
RLO Richland Operations (US DOE) 
 1830. K. Suzukawa was supported by a Japan Society for Promotion of Science Fellowship for Japanese Biomedical bi·o·med·i·cal
adj.
1. Of or relating to biomedicine.

2. Of, relating to, or involving biological, medical, and physical sciences.
 and Behavioral Researchers at the National Institutes of Health.

Received 19 June 2001; accepted 15 February 2002.
COPYRIGHT 2002 National Institute of Environmental Health Sciences
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2002, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Colburn, Nancy H.
Publication:Environmental Health Perspectives
Date:Sep 1, 2002
Words:5174
Previous Article:The effect of weather on respiratory and cardiovascular deaths in 12 U.S. cities. (Articles).
Next Article:Long-term, low-dose lead exposure alters the gonadotropin-releasing hormone system in the male rat. (Articles).



Related Articles
Acacia-tree extract fights cancer in mice.(chemicals, called avicins, from the Australian Acacia tree, may be effective against cancer)(Brief Article)
Mitogen-activated protein kinase activation by oxidative and bacterial stress in an amphibian cell culture model. (Research Articles).
Synergism between rhinovirus infection and oxidant pollutant exposure enhances airway epithelial cell cytokine production. (Research Articles).
Transcription factor activation following exposure of an intact lung preparation to metallic particulate matter. (Articles).
DDT and its metabolites alter gene expression in human uterine cell lines through estrogen receptor-independent mechanisms.
Arsenic exposure accelerates atherogenesis in apolipoprotein [E.sup.-/-] mice.(Article)
Arsenic-induced enhancement of ultraviolet radiation carcinogenesis in mouse skin: a dose-response study.
Turmeric component kills cancer cells.(Biomedicine)(Brief Article)
Xenoestrogen-induced ERK-1 and ERK-2 activation via multiple membrane-initiated signaling pathways.(Research / Article)
Distinct gene expression profiles in immortalized human urothelial cells exposed to inorganic arsenite and its methylated trivalent...

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles