Printer Friendly

A new source of male sterility in onion (allium cepa l.).

Introduction

Onion is preferred as a commercial vegetable crop all over the world, since it ranks second in value in the list of cultivated vegetable crops. Area under its cultivation is 3.44 million hectares and its total annual production in the world is 61.6 million tonnes (FAO, 2006).

The most important qualitative genes in the edible alliums are those that cause male sterility. In onion, male sterility was first exploited by Jones and Clarke (1943) using a male sterile specimen of cultivar Italian Red, which they found in breeding plots at Davis, California, in 1925. Fortunately, when this plant was prevented from being cross pollinated, bulbils were produced in the flower head and it could be propagated. Jones and Clarke (1943) published this classical work describing the genetics of male sterility and indicating how it could be used to produce hybrid cultivars. On the basis of this technique, originally developed in onion, male sterility has since been exploited in hybrid breeding of more than 150 crop species (Kale and Munjal, 2005).

The genetic basis of the cytoplasmic male sterility (CMS) in Italian Red is simple: a sterility inducing cytoplasm (S) and a nuclear restorer locus with two alleles, Ms and ms. Male fertility is restored by the dominant allele. The fertility restorer genes were later found extensively in onions collected from various countries (Davis, 1957).

In the 1960s, another CMS cytoplasm, namely T-cytoplasm, was discovered (Berninger, 1965; Schweisguth, 1973). This source of male sterility was found in the French cultivar Jaune Paille de Vertus. The T-cytoplasm is restored by two independently operating restorer systems. The first restorer system comprised of a single locus, A, with two alleles, in which male fertility is restored by the dominant allele. The second restorer system is comprised of two loci, B and C, with complementary gene action. Male fertility in this restorer system is restored only when a dominant allele is present on both B and C loci. Meer van der and Van bennekom (1969) observed thermolability, when analyzing a CMS line, which originated from Polish cultivar Wolska, which is a source of T-cytoplasm. They found 93% male sterile plants at 14 0C and only 10% at 23 0C. This complex fertility restoration has resulted in negligible use of T-cytoplasm for hybrid development. The majority of hybrid onion cultivars produced upto date are using S cytoplasm (Havey, 1995; 2000) as a source of male sterility. This source of male sterile cytoplasm traces back to a single onion plant identified in Davis, California, in 1925 (Jones and Emsweller, 1936). Cytoplasmic male sterility is found to have ascribed to mitochondrial genomes. Many scientists (Courcel et al., 1989; Holford et al., 1991; Havey 1993, 1995; Satoh et al., 1993; Sato, 1998) have identified molecular markers that distinguish normal (N) male-fertile and (S and T) sterile cytoplasms of onions.

In 1970, T-cytoplasm carrying maize hybrids suffered heavy losses due to epidemic of southern corn leaf blight (Pring and Lonsdale, 1989, Levings, 1993). This single incidence has forced plant scientists to think seriously about cytoplasmic uniformity and genetic vulnerability of crop plants (Anonymous,1972).So far, only one type of male sterile cytoplasm (CMS S) has been found useful. Newer types of male sterility needs to be studied which will reduce genetic vulnerability of onions and also useful for commercial production of bulb and seed onions at lesser costs (Gokce et al., 2002).

In our study, we have screened onion population for occurrence of male sterile plant/s, tissue cultured them, studied using molecular markers and by making crosses with other onion varieties.

Materials and Methods

All of the genotypes mentioned in Table 1 were planted in the field during Rabi 2003. After harvesting, the bulbs of these varieties were preserved in cold storage for six months at 40C and 65 % relative humidity. Bulbs were taken out during 1st week of November. Planting of all these bulbs was done in Rabi 2004. All the genotypes bolted and flowered in January 2005. Umbels of these genotypes were checked physically and by acetocarmine treatment for assessing their male sterility.

Genomic DNA was extracted from all the genotypes mentioned in Table 1. A systematic study of cytoplasms of all the genotypes was undertaken using polymerase chain reaction (PCR) and primers as described by Sato (1998) and Engelke and Tatlioglu (2002). The PCR-marker which anchors in the upstream region to the mitochondrial gene cob is referred to as 5' cob-marker (Sato, 1998). These markers are able to distinguish between S and N cytoplasm. T cytoplasm which was not studied by Sato(1998) shows the same amplified product as N cytoplasm. Therefore, Engelke and Tatlioglu (2002) developed a new orfA501-marker that amplifies in S and T cytoplasm of onion, but not in N cytoplasm. The combination of the 5' cob-marker with the orfA501-marker allows to distinguish between these three cytoplasm types in individual plants.

Markers used for classification of cytoplasms are tabulated in Table 2.

PCR reaction mixture used for amplification is shown in Table 3.

Table 3: PCR reaction mixture used for amplification PCR was carried out using Mastercycler gradient from Eppendorf, using amplification conditions (Table 4).

The crosses were made involving suspected male sterile plant as female parent and other varieties (Arka Kirtiman,Arka Pitambar, Udaipur 102, Pusa White Round, Pusa White Flat, Punjab White, Gujarat Local, Phule Safed) as male parent. All these crosses were made in Rabi 2005 and seeds of these crosses were planted in Rabi 2006. Bulbs of these crosses were stored in cold storage until planting in Rabi 2007.

Results and Discussion

Field screening

All the onion genotypes were screened for presence of male sterility. Results of screening are summarized in Table 1.

All the genotypes have shown male fertility, except V7 and Indam, while JISL5 has shown segregation for male sterility. While screening these genotypes for male sterility, we have got one plant in Agrifound white population which was showing male sterility. We have tissue cultured it and planted 100 plantlets in late kharif 2005. All of these plants flowered subsequently and found out to be male sterile. Subsequently, these plants have been again planted in the next season i.e. late kharif 2006 and confirmed their male sterility.

Molecular studies

Results of PCR based analyses of cytoplasm are given in Table 5.

Table 5: PCR based analyses of cytoplasm

Results of Table 5 show that genotypes V7, Arka Kirtiman and Arka Pitambar and Indam possess S cytoplasm, while rest of the genotypes possess N cytoplasm. JISL5 is the only genotype with T cytoplasm. Agrifound White A was showing male sterility in the field, but to our great surprise its cytoplasm was found to be male fertile.

[ILLUSTRATION OMITTED]

Samples: 1. V7, 2. Agrifound White, 3. Phule Safed, 4.Punjab White, 5. Udaipur 102, 6. Pusa White Flat, 7. Pusa White Round, 8. Gujarat Local, 9 to 15. Agrifound White A plants, 16.Arka Kirtiman, 17. JISL5, M- 100bp ladder.

Inheritance studies

Genotype Agrifound White A was showing male sterility in the field, while its PCR based molecular character indicated it to have N type cytoplasm. In order to understand the nature of male sterility, crosses have been made involving Agrifound White A as female parent and other varieties (Arka Kirtiman,Arka Pitambar, Udaipur 102, Pusa White Round, Pusa White Flat, Punjab White, Gujarat Local, Phule Safed) as male parent. All these crosses were made in Rabi 2005 and seeds of these crosses were planted in Rabi 2006. Bulbs of these crosses were preserved in cold storage until planting in Rabi 2007. Results of these crosses are presented in Table 6.

Crosses involving Agrifound White A as female parent were made in order to study the nature and dominance of male sterility. Results of these crosses in Table 6 show male fertility of these hybrids. Interestingly, all the crosses irrespective of their cytoplasm and nuclear background, restored fertility in Agrifound White A. Analysis of sterility observed in Agrifound White A indicated that it is probably of GMS ( Genetic male sterility) type and the male fertility is dominant over male sterility and is a new source of male sterility in onion. Genetic male sterility is of very wide occurrence in flowering plants and as many as 60 genes for maize, 55 in tomato, 10 in cotton and 60 in rice are known (Horner and Palmer, 1995).

References

[1] Anonymous,1972, "Genetic vulnerability of major crops,"National Academy of Sciences, USA, Washington DC.

[2] Berninger, E., 1965, "Contribution a l'etude de la sterilite male de l'oignon (Allium cepa L.)," Ann Amelior Plant (Paris), 23, pp.183-199.

[3] Courcel, A. de, Veder F., and Boussac, J., 1989, "DNA polymorphism in Allium cepa cytoplasms and its implications concerning the origin of onions," Theor. Appl. Genet., 77, pp.793-798.

[4] Davis, E.W., 1957, "The distribution of the male sterility gene in onion," Proc. Am. Soc. Hort. Sci., 20, pp.316-318.

[5] Engelke, T., and Tatlioglu, T., 2002, "A PCR-marker for the CMS inducing cytoplasm in chives derived from recombination events effecting the mitochondrial gene atp9," Theor. Appl. Genet., 104, pp.698-702.

[6] FAO, 2006, Agrostata database, updated annually: http://apps.fao.org/

[7] Gokce, A.F., McCallum, J., Sato, Y., and Havey, M.J., 2002, "Molecular tagging of the Ms locus in onion," J. Amer. Soc. Hort. Sci., 127, pp.576-582.

[8] Havey, M., 1993, "A putative donor of S Cytoplasm and its distribution among open-pollinated populations of onion," Theor. Appl. Genet., 86, pp.128-134.

[9] Havey, M., 1995, "Cytoplasmic determinations using the polymerase chain reaction to aid in the extraction of maintainer lines from open-pollinated populations of onion," Theor. Appl. Genet., 90, pp.263-268.

[10] Havey, M., 2000, "Diversity among male-sterility-inducing and male-fertile cytoplasms of onion," Theor. Appl. Genet., 101, pp.778-782.

[11] Holford, P., Croft, J., and Newbury, H., 1991, "Differences between, and possible origins of, the cytoplasms found in fertile and male-sterile onions (Allium cepa L.)," Theor. Appl. Genet., 82, pp.737-744.

[12] Horner, H.T., and Palmer, R.G., 1995, "Mechanisms of genic male sterility," Crop Sci., 35, pp.1527-1535.

[13] Jones, H., and Clarke, A., 1943, "Inheritance of male sterility in the onion and the production of hybrid seed," Proc. Amer. Soc. Hort. Sci., 43, pp.189-194.

[14] Jones, H., and Emsweller, S., 1936, A male-sterile onion," Proc Am. Soc. Hort. Sci., 34, pp.582-585.

[15] Kale, A.A., and Munjal, S.V., 2005, "Molecular analysis of mitochondrial DNA of lines representing a specific CMS-fertility-restorer system of pearl millet [Pennisetum glaucum (L.) R.Br.] by RAPD markers," Indian J. Genet., 65(1), pp.1-4.

[16] Levings, C.S. III, 1993, "Thoughts on cytoplasmic male sterility in CMS-T maize," Plant Cell, 5, pp.1285-1290.

[17] Meer van der, Q.P., and Van bennekom, J.L., 1969, "Effect of temperature on the occurrence of male sterility in onion (Allium cepa L.)," Euphytica, 18, pp.389-394.

[18] Pring, D., and Lonsdale, M.,1989, "Cytoplasmic male sterility and maternal inheritance of disease susceptibility in maize," Ann. Rev. Phytopathol., 27, pp.483-502.

[19] Satoh, Y., Nagai, M., Mikami, T., and Kinoshita, T., 1993, "The use of mitochondrial DNA polymorphism in the classification of individual plants by cytoplasmic genotypes," Theor. Appl. Genet., 86, pp. 345-348.

[20] Sato, Y., 1998, "PCR amplification of CMS-specific mitochondrial nucleotide sequences to identify cytoplasmic genotypes of onion (Allium cepa L.)," Theor. Appl. Genet., 96, pp.367-370.

[21] Schweisguth, B., 1973, "Etude d'un nouveau type de sterilite male chez l'oignon, Allium cepa L.," Ann. Amelior Plant, 23, pp.221-233.

G.G. Adsul, D.G. Patil, A.V. Dhake, U.B. Pandey, P.V. Sane and R.M. Kothari

Jain Hi-tech Agri. Institute (JHAI), Jalgaon, Maharashtra, 425 00, India
Table 1: Profile of genotypes and sterility/fertility of plants
analyzed.

Sr. No.    Genotype            No. of plants analyzed  Male sterile/
                                                       Male fertile

   1       Agrifound White               50            Male fertile
   2       Phule Safed                   50            Male fertile
   3       Punjab White                  50            Male fertile
   4       Udaipur 102                   50            Male fertile
   5       Arka Kirtiman                 50            Male fertile
   6       Arka Pitambar                 50            Male fertile
   7       Pusa White Flat               50            Male fertile
   8       Pusa White Round              50            Male fertile
   9       V7                           100            Male sterile
   10      Gujarat Local                 50            Male fertile
   11      Agrifound White A             50            Male sterile
   12      JISL5                         50            35 Male fertile
                                                       :15 Male sterile
   13      Indam                         50            Male sterile

Table 2: Molecular markers used for classification of cytoplasms.

Sr.    Primer                    Sequence
No.

1      PCR primers as per Sato
       (1998)
       Gene--cob
       S--specific               5'-GTCCAGTTCCTATAGAACCTATCACT-3'
       N- specific               5'-TCTAGATGTCGCATCAGTGGAATCC-3'
       Common primer             5'-CTTTTCTATGGTGACAACTCCTCTT-3'
2      PCR primers as per
       Engelke and Tatlioglu
       (2002)
       orfA 501                  5'ATGGCTCGCCTTGAAAGAGAGC3'
                                 5'CCAAGCATTTGGCGCTGAC3'

Table 3 : PCR reaction mixture used for amplification

Component          Concentration    Amount ([micro]l)

Taq polymerase      5u/[micro]l            0.1
10 X PCR buffer         --                 1.5
dNTP                   0.1mM               1.2
Primer             0.5 [micro]M            0.6
[Mgcl.sub.2]       0.1mM               0.9
Template DNA      20 ng/[micro]l           1.0
Distilled water         --                 9.7
Total volume            --                  15

Table 4 : Amplification conditions for PCR

        Stage             Temperature ([degrees]C)     Duration (min)

Initial denaturation                94.0                   2 min.
    Denaturation                    94.0                  30 sec.
      Annealing           53.0 for primers as per          1 min.
                           Sato (1998) and 60.0
                             for primers as per
                        Engelke and Tatlioglu (2002)
      Extension                     72.0                   2 min.
   Final extension                  72.0                   7 min.
       Storage                      04.0                     --

        Stage           Cycle /s

Initial denaturation        1
    Denaturation           40
      Annealing

      Extension
   Final extension          1
       Storage

Table 5: PCR based analyses of cytoplasm

Sr. No.   Genotype               No. of        N cytoplasm
                                 plants
                                analyzed

   1      Agrifound White           5               5
   2      Phule Safed               5               5
   3      Punjab White              5               5
   4      Udaipur 102               5               5
   5      Arka Kirtiman             5               -
   6      Arka Pitambar             5               -
   7      Pusa White Flat           5               5
   8      Pusa White Round          5               5
   9      V7                        5               -
  10      Gujarat Local             5               5
  11      Agrifound White A         5               5
  12      JISL5                     5               -
  13      Indam                     5               -

Sr. No.    S cytoplasm     T cytoplasm

   1           --              --
   2           --              --
   3           --              --
   4           --              --
   5            5              --
   6            5              --
   7           --              --
   8           --              --
   9            5              --
  10           --              --
  11           --              --
  12           --               5
  13            5              --

Table 6: Male sterility/ male fertility analysis of crosses

Sr.    Name of cross        No. of plants   Male fertile /
No.                           analyzed       Male sterile

 1     Agrifound White A         50          Male fertile
       X Gujarat Local
 2     Agrifound White A         50          Male fertile
       X Phule Safed
 3     Agrifound White A         50          Male fertile
       X Pusa White Flat
 4     Agrifound White A         50          Male fertile
       X Punjab White
 5     Agrifound White A         50          Male fertile
       X Udaipur 102
 6     Agrifound White A         50          Male fertile
       X Pusa White Round
 7     Agrifound White A         50          Male fertile
       X Arka Kirtiman
 8     Agrifound White A         50          Male fertile
       X Arka Pitambar
COPYRIGHT 2008 Research India Publications
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2008 Gale, Cengage Learning. All rights reserved.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Adsul, G.G.; Patil, D.G.; Dhake, A.V.; Pandey, U.B.; Sane, P.V.; Kothari, R.M.
Publication:International Journal of Biotechnology & Biochemistry
Article Type:Report
Date:May 1, 2008
Words:2426
Previous Article:A novel protein coding region identifying tool using cellular automata classifier with trust-region method and parallel scan algorithm (NPCRITCACA).
Next Article:Analysis of pulmonary and extrapulmonary tuberculosis cases by indirect and sandwich elisa using ES-31 antigen and affinity purified anti ES-31...
Topics:


Related Articles
Health check: Hay fever time again.
Reduce genetic vulnerability of onions.
Helping to fight cancer and cardiovascular disease.
Homeopathy: highly effective for hay fever.
Toxicity evaluation of pesticide waste leachate by Allium cepa Root (growth and cytogenetic) assay.

Terms of use | Copyright © 2014 Farlex, Inc. | Feedback | For webmasters