Printer Friendly
The Free Library
14,487,682 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

A new invertebrate member of the p53 gene family is developmentally expressed and responds to polychlorinated biphenyls. (Articles).


The cell-cycle checkpoint protein p53 both directs terminal differentiation and protects embryos from DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 damage. To study invertebrate invertebrate (ĭn'vûr`təbrət, –brāt'), any animal lacking a backbone. The invertebrates include the tunicates and lancelets of phylum Chordata, as well as all animal phyla other than Chordata.  p53 during early development, we identified three differentially expressed p53 family members (p53, p97, p120) in the surf clam, Spisula solidissima. In these mollusks, p53 and p97 occur in both embryonic and adult tissue, whereas p120 is exclusively embryonic. We sequenced, cloned, and characterized p120 cDNA. The predicted protein, p120, resembles p53 across all evolutionarily conserved regions and contains a C-terminal extension with a sterile alpha motif (SAM) as in p63 and p73. These vertebrate forms of p53 are required for normal inflammatory, epithelial, and neuronal development. Unlike clam p53 and p97, p120 mRNA and protein levels are temporally expressed in embryos, with mRNA levels decreasing with increasing p120 protein ([R.sup.2] = 0.97). Highest surf clam p120 mRNA levels coincide with the onset of neuronal growth. In earlier work we have shown that neuronal development is altered by exposure to polychlorinated biphenyls polychlorinated biphenyls, (pol´ēklôr´nā´tid bīfē´n  (PCBs), a neurotoxic neurotoxic

pertaining to or emanating from a neurotoxin.


neurotoxic state
a case of poisoning by a neurotoxin.


neurotoxic adjective
 environmental contaminant contaminant /con·tam·i·nant/ (kon-tam´in-int) something that causes contamination.

contaminant

something that causes contamination.
. In this study we show that PCBs differentially affect expression of the three surf clam p53 family members, p120 mRNA and protein are reduced the most and earliest in development, p97 protein shows a smaller and later reduction, and p53 protein levels do not change. For the first time we report that unlike p53 and p97, p120 is specifically embryonic and expressed in a time-dependent manner. Furthermore, p120 responds to PCBs by 48 hr when PCB-induced suppression of the serotonergic se·ro·to·ner·gic or se·ro·to·ni·ner·gic
adj.
Activated by or capable of liberating serotonin, especially in transmitting nerve impulses.



serotonergic

containing or activated by serotonin.
 nervous system occurs. Key words: neurotoxicology, p63, p73, PCBs, surf clam, Spisula solidissima. Environ Health Perspect 110:377-385 (2002). [Online 7 March 2002]

http://ehpnet1.niehs.nih.gov/does/2002 /110p377-385jessen-eller/abstract.html

**********

Protein 53 (p53) is a critical regulator of cell cycle progression that is stabilized in response to DNA damage by phosphorylation phosphorylation, chemical process in which a phosphate group is added to an organic molecule. In living cells phosphorylation is associated with respiration, which takes place in the cell's mitochondria, and photosynthesis, which takes place in the chloroplasts.  at the N-terminus [reviewed in Levine (1)]. This stabilization enables p53 to form homotetramers that bind to the promoters of several genes involved in the cell cycle, ultimately producing either cell-cycle arrest or apoptosis. Loss of p53 function can cause unchecked cell growth and contribute to carcinogenesis car·ci·no·gen·e·sis
n.
The production of cancer.



carcinogenesis

production of cancer.


biological carcinogenesis
viruses and some parasites are capable of initiating neoplasia.
. Approximately 50% of all human cancers contain mutant p53 (2). p53 also appears to play a role in embryonic development [reviewed by Choi and Donehower (3)]. During embryogenesis Embryogenesis

The formation of an embryo from a fertilized ovum, or zygote. Development begins when the zygote, originating from the fusion of male and female gametes, enters a period of cellular proliferation, or cleavage.
 p53 levels positively correlate with proliferation and are relatively low in terminally differentiated cells, p53 also activates differentiation of many cell types in culture.

During murine murine /mu·rine/ (mur´en) pertaining to, derived from, or characteristic of mice or rats.

mu·rine
adj.
 development p53 levels and activity are highest in the nervous system (4), which is most sensitive to changes in p53 (3). A small percentage of mice lacking p53 have a neural tube defect neural tube defect

Congenital defect of the brain or spinal cord from abnormal growth of their precursor, the neural tube (see embryology), usually with spine or skull defects.
. The remaining p53-deficient mice grow normally, but cannot survive DNA damage or environmental stress, and tend to develop spontaneous tumors. Mice may compensate for a p53-deficiency during embryogenesis by employing functionally similar genes. Two p53-like genes, p63 (also known as KET, p40, p51, and p73L) and p73, have been identified and sequenced in a wide range of vertebrates, including mice and humans [reviewed by Kaelin (5), Levrero et al. (6), and Strano et al. (7)].

Both p63 and p73 can activate p53-regulated genes, and their overexpression induces apoptosis (6,7). Despite these similarities to p53, p63 and p73 perform different functions critical for early development. Whereas p63 maintains epithelial stem cells stem cells, unspecialized human or animal cells that can produce mature specialized body cells and at the same time replicate themselves. Embryonic stem cells are derived from a blastocyst (the blastula typical of placental mammals; see embryo), which is very young , p73 functions primarily in neurologic and inflammatory development. In addition, both p63 and p73 levels are high throughout vertebrate embryo development, whereas p53 expression decreases after the central nervous system matures. In addition, unlike p53, p63 and p73 contain a sterile alpha motif (SAM) within their C-terminal extensions. SAM is important for protein interaction and is involved in developmental regulation (8). Furthermore, not all DNA-damaging agents induce p73; mutations of either p73 or p63 in human cancers are infrequent; and p73-deficient mice are not prone to spontaneous tumors (6,7).

Thus far, two p53 family members (p53 and p73) have been sequenced in soft-shell clams (Mya arenaria) (9), and one (p73) in squid (Loligo forbesi) (10). Another larger homologue homologue /ho·mo·logue/ (hom´ah-log)
1. any homologous organ or part.

2. in chemistry, one of a series of compounds distinguished by addition of a CH2 group in successive members.
, p97, has also been identified in Mya using an antibody (11). One of the soft-shell clam homologues is expressed throughout gametogenesis Gametogenesis

The production of gametes, either eggs by the female or sperm by the male, through a process involving meiosis. In animals, the cells which will ultimately differentiate into eggs and sperm arise from primordial germ cells set aside from the
 (12). Both the squid and clam p73-like homologues contain a SAM domain, suggesting these proteins play a role in development.

We have previously conducted experiments linking environmental exposure to polychlorinated biphenyls (PCBs) with changes in molluscan mol·lus·can also mol·lus·kan  
adj.
Of or relating to the mollusks.

n.
A mollusk.
 p53 gene family members (13). PCBs are lipophilic lipophilic,
adj/n the ability to dissolve or attach to lipids.

lipophilic (lipōfil´ik),
adj 1. showing a marked attraction to, or solubility in, lipids.
2.
, environmentally pervasive chemicals that accumulate in plant, animal, and human tissues, promote tumor formation, can damage DNA (14,15), and induce neurotoxic effects during early development in clams (16,17) and humans (18). In vitro fertilization in vitro fertilization (vē`trō, vĭ`trō), technique for conception of a human embryo outside the mother's body. Several ova, or eggs, are removed from the mother's body and placed in special laboratory culture dishes (Petri dishes);  and subsequent developmental studies are easily conducted in the surf clam, Spisula solidissima (16,17,19-21), but to our knowledge are not successful in either soft-shell clam or squid. During investigation of these embryos we partially cloned, sequenced, and generated a multiple alignment for a new member of the p53 gene family that codes for an exclusively embryonic 120-kD protein. Because PCBs are particularly neurotoxic during embryonic development, we asked whether this clam p120 responds to PCB PCB: see polychlorinated biphenyl.
PCB
 in full polychlorinated biphenyl

Any of a class of highly stable organic compounds prepared by the reaction of chlorine with biphenyl, a two-ring compound.
 exposure.

For the first time we report the differential expression of three p53 members (p53, p97, and the new p120) during embryogenesis. Throughout early development p53 and p97 protein levels are unchanged, but p120 is temporally expressed and apparently regulated at the translational level. After treatment with PCBs, p120 expression is heavily suppressed, p97 is less so, and p53 is unaffected. With the Spisula model, our data reveal that a new member of the p53 family, p120, is intimately involved in early development and is highly susceptible to environmentally relevant doses of PCBs.

Materials and Methods

Animals and in vitro fertilization. Juvenile Spisula were kindly provided by Aquaculture aquaculture, the raising and harvesting of fresh- and saltwater plants and animals. The most economically important form of aquaculture is fish farming, an industry that accounts for an ever increasing share of world fisheries production.  Research (Dennis, MA). Spisula oocytes, embryos, and veliger ve·li·ger  
n.
A larval stage of a mollusk characterized by the presence of a velum.



[New Latin v
 larvae Larvae, in Roman religion
Larvae: see lemures.
 were derived from ripe adults collected from Martha's Vineyard, Massachusetts, by the Marine Biological Laboratory The Marine Biological Laboratory (MBL) is an international center for research and education in biology and ecology. Founded in 1888, the MBL is the oldest independent marine laboratory in the Americas, taking advantage of a coastal setting in the Cape Cod village of Woods Hole,  (MBL MBL Mobile
MBL Marine Biological Laboratory
MBL Macquarie Bank Limited
MBL Mannose-Binding Lectin
MBL Marine Boundary Layer
MBL Member Business Lending (credit unions)
MBL Movimiento Bolivia Libre
). All animals were maintained and handled in accordance with policies of the Institutional Animal Care and Use Committee Institutional Animal Care and Use Committees are of central importance to the application of laws to animal research in the United States. Most research involving laboratory animals is funded by the United States National Institutes of Health or other federal agencies.  at the MBL. Standard surf clam in vitro fertilization and culture methods were used (16). At the swimming blastula blastula /blas·tu·la/ (blas´tu-lah) pl. blas´tulae   [L.] the usually spherical structure produced by cleavage of a zygote, consisting of a single layer of cells (blastoderm) surrounding a fluid-filled cavity (blastocoele).  stage, embryos were transferred to 4-L aerated aer·ate  
tr.v. aer·at·ed, aer·at·ing, aer·ates
1. To supply with air or expose to the circulation of air: aerate soil.

2.
 tanks at a concentration of 100 mL. For the p53 protein analyses, larvae were cultured at a density of 1,000 mL in stirred, 250-mL containers as described in Kreiling et al. (17). Neither culture method caused significant stress or mortality.

RNA RNA: see nucleic acid.
RNA
 in full ribonucleic acid

One of the two main types of nucleic acid (the other being DNA), which functions in cellular protein synthesis in all living cells and replaces DNA as the carrier of genetic
 extraction. Whole juvenile (age 1 year) Spisula bodies were homogenized ho·mog·e·nize  
v. ho·mog·e·nized, ho·mog·e·niz·ing, ho·mog·e·niz·es

v.tr.
1. To make homogeneous.

2.
a. To reduce to particles and disperse throughout a fluid.

b.
 in Trizol (Life Technologies, Carlsbad, CA) with a tissue tearer (Biospec Products, Inc., Bartlesville, OK). Oocytes, embryos, and larvae were rinsed through cheesecloth cheese·cloth  
n.
A coarse, loosely woven cotton gauze, originally used for wrapping cheese.


cheesecloth
Noun

a light, loosely woven cotton cloth

Noun 1.
 or nitex nets, microcentrifuged at 10,000 rpm for 1 min, and placed in Trizol. Samples were snap frozen in liquid nitrogen and stored at -80 [degrees] C. After thawing on ice, samples were pulled through a needle and processed according to manufacturer's guidelines.

Reverse transcriptase-polymerase chain reaction. First-strand cDNA synthesis and polymerase chain reaction polymerase chain reaction (pŏl`ĭmərās') (PCR), laboratory process in which a particular DNA segment from a mixture of DNA chains is rapidly replicated, producing a large, readily analyzed sample of a piece of DNA; the process is  (PCR PCR polymerase chain reaction.

PCR
abbr.
polymerase chain reaction


Polymerase chain reaction (PCR) 
) were performed with the GeneAmp RNA PCR kit (Applied Biosystems, Foster City, CA) in a Perkin Elmer (Wellesley, MA) 9700 thermocycler according to manufacturer's instructions. Degenerate primers (DegF and DegR) (Table 1) were designed from alignments of squid (10) and soft-shell clam (22) p53 to obtain 163 bp of p53-like sequence from juvenile surf clam cDNA. Touchdown cycling parameters were 10 min at 95 [degrees] C; 14 cycles of 30 sec at 95 [degrees] C, 45 sec at 60 [degrees] C (decreasing by 1 [degrees] C per cycle), 30 sec at 72 [degrees] C; 21 cycles of 30 sec at 95 [degrees] C, 45 sec at 46 [degrees] C, 30 sec at 72 [degrees] C; and 7 min at 72 [degrees] C.

RACE polymerase chain reaction. Poly(A) RNA was purified from clam oocyte oocyte /oo·cyte/ (-sit) the immature female reproductive cell prior to fertilization; derived from an oogonium. It is a primary o. prior to completion of the first maturation division, and a secondary o.  total RNA (1 [micro]g) with an Oligotex mRNA kit (Qiagen, Inc., Valencia, CA). The 5' end of the p53 gene was obtained using GspR (Table 1) and the Marathon rapid amplification of cDNA ends (RACE) cDNA Amplification kit (Clontech Laboratories, Palo Alto, CA) as recommended by the manufacturer. To confirm the 5' sequence and obtain the 3' region, we used the SMART RACE cDNA Amplification kit (Clontech) and primers GspF and GspR (Table 1). New primers designed to amplify the entire consensus sequence were used to obtain a 1590 bp PCR product from 0.5 [micro]g Spisula veliger larvae total RNA. The reverse transcriptase-PCR (RT-PCR RT-PCR

reverse transcriptase-polymerase chain reaction. See PCR1.
) reaction conditions were the same as above except 0.5-[micro]M primers were used. Touchdown PCR amplification conditions were 10 min at 95 [degrees] C; 6 cycles of 30 sec at 95 [degrees] C, 45 sec at 68 [degrees] C (decreasing by 1 [degrees] C per cycle), 30 sec at 72 [degrees] C; 29 cycles of 30 sec at 95 [degrees] C, 45 sec at 62 [degrees] C, 30 sec at 72 [degrees] C; and 7 min at 72 [degrees] C. The last 185 bp were obtained with primer 4F (Table 1), new cDNA synthesized from oocyte poly(A) mRNA, and Clontech's SMART RACE kit. Step-down PCR conditions were modified to the following: 5 cycles of 30 sec at 94 [degrees] C, 3 min at 72 [degrees] C; 5 cycles of 30 sec at 94 [degrees] C, 30 sec at 70 [degrees] C, 3 min at 72 [degrees] C; and 25 cycles of 30 sec at 94 [degrees] C, 30 sec at 64 [degrees] C, and 3 min at 72 [degrees] C. The final contiguous 1774 bp sequence was obtained using the touchdown RT-PCR (above) with primers 1F and 5R (Table 1).

Cloning and sequencing. PCR products were separated on 1-2% agarose agarose

more highly purified form of agar with similar uses to agar and widely used in the separation of nucleic acid fragments.
 gels, excised, extracted (Quiaex II; Qiagen), and ligated into pCR2.1 (Invitrogen, Carlsbad, CA). E. coli E. coli: see Escherichia coli.
E. coli
 in full Escherichia coli

Species of bacterium that inhabits the stomach and intestines. E. coli can be transmitted by water, milk, food, or flies and other insects.
 INV INV
abbr.
in vitro fertilization
[alpha]F' cells (Invitrogen) were transformed with the ligation ligation /li·ga·tion/ (li-ga´shun) the application of a ligature.

tubal ligation  sterilization of the female by constricting, severing, or crushing the uterine tubes.
 reaction and selected on Luria broth (LB) agar containing kanamycin kanamycin /kan·a·my·cin/ (kan?ah-mi´sin) an aminoglycoside antibiotic derived from Streptomyces kanamyceticus, effective against aerobic gram-negative bacilli and some gram-positive bacteria, including mycobacteria; used as the  (50 [micro]g/mL) and Xgal (40 [micro]g/mL). Positive colonies identified by a PCR screen using primers DegF and DegR (Table 1) were grown in LB containing ampicillin ampicillin (ăm'pĭsĭl`ĭn), a penicillin-type antibiotic that is effective against both gram-negative microorganisms and gram-positive microorganisms such as Escherichia coli.  (50 [micro]g/mL. Plasmid DNA was prepared using a Qiaprep Miniprep kit (Qiagen) and sequenced on an ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 Prism 377 automated sequencer See MIDI sequencer.

(music) sequencer - Any system for recording and/or playback of music via a programmable memory which stores music not as audio data, but as some representation of notes.
 with M13 forward and reverse primers at the Tufts University Core Facility (Boston, MA). Multiple sequences were aligned by CLUSTAL W 1.7 (23) and the resulting consensus identified as a p53 homologue with a basic local alignment search tool (BLAST) search (24).

Probes. Probe I, synthesized with primers 2F and QuantR (Table 1), corresponded to nucleotides 406-907 within the conserved DNA-binding domain. Probe II, synthesized with primers 4F and 5R (Table 1) corresponded to nucleotides 1200-1774 and was specific for p120. Both probes were made by PCR amplification of the target sequence from a full-length p120 clone. The PCR products were gel purified (above) and digoxygenin-labeled with the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche Diagnostics, Rotkreuz, Switzerland).

Northern blots. We isolated mRNA from total RNA (above) using the MicroFastTrack 2.0 mRNA Isolation Kit (Invitrogen) according to the manufacturer's instructions, mRNAs (3.5 [micro]g/lane)were then separated on a formaldehyde agarose gel, transferred to a nitrocellulose nitrocellulose, nitric acid ester of cellulose (a glucose polymer). It is usually formed by the action of a mixture of nitric and sulfuric acids on purified cotton or wood pulp.  membrane, and hybridized with the probes at 50 [degrees] C overnight. Probes were detected chemiluminescently with the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche Diagnostics) by exposure to Kodak BioMax ML film (Eastman Kodak Co., Rochester, NY) for 3.5 hr at room temperature.

Quantitative RT-PCR. We designed an RNA internal standard for the surf clam p53-like sequence as described by Jessen-Eller et al. (25). The internal standard was made by ligating the 163 bp segment into pCR2.1 (Invitrogen) and using PCR with primers MutF and MutR (Table 1) to make a 12 bp deletion in the center of the fragment. We then used PCR (above) to isolate the internal standard from the vector with 0.2 [micro]M primers (IsF and IsR; Table 1) and 200 ng plasmid DNA. PCR conditions were as follows: 10 min at 95 [degrees] C, 30 cycles of 30 sec at 95 [degrees] C, 45 sec at 60 [degrees] C, 30 sec at 72 [degrees] C; and 7 min at 72 [degrees] C. The resulting 151 bp internal standard was gel purified, cloned, and sequenced as described above.

A T7 promoter sequence and poly(A) tail were added using PCR (above) with 4% of the internal standard PCR product, 3 mM Mg[Cl.sub.2], and 0.5 [micro]M Tprom and Tpoly primers (Table 1) to produce a 187 bp product. Cycling proceeded for 10 min at 95 [degrees] C; 14 cycles of 30 sec at 95 [degrees] C, 45 sec at 74 [degrees] C (decreasing by 1 [degrees] C per cycle), 30 sec at 72 [degrees] C; and 7 min at 72 [degrees] C. The product was gel extracted, diluted 1:100, reamplified as above, eluted and gel extracted again, cloned, and sequenced. The cloned internal standard was excised from the vector with EcoRI (Life Technologies) and purified with a poly(A) Qiaex II kit (Qiagen). This DNA (10 ng) was transcribed to RNA using MEGAscript In Vitro in vitro /in vi·tro/ (in ve´tro) [L.] within a glass; observable in a test tube; in an artificial environment.

in vi·tro
adj.
In an artificial environment outside a living organism.
 Transcription Kit (Ambion Inc., Austin, TX) and gel purified as instructed.

We quantified p120 mRNA levels as described by Vanden Heuvel et al. (26). Total RNA was normalized across all samples. Aliquots (10 or 25 ng) were placed into 3-4 tubes, spiked with a range of RNA internal standard (1 x [10.sup.3] to 1 x [10.sup.8] molecules), and reverse transcribed into cDNA. This step controlled for tube-to-tube variability during both the RT and PCR steps. PCR proceeded with half the cDNA, 4 mM Mg[Cl.sub.2], and 0.5 [micro]m forward (QuantF) and reverse (QuantR) primer (Table 1). Both target and internal standard were coamplified by incubating for 10 min at 95 [degrees] C; 29 cycles of 30 sec at 95 [degrees] C, 45 sec at 62 [degrees] C, 30 sec at 72 [degrees] C; and 7 min at 72 [degrees] C. PCR samples (24%) were run on 6% polyacrylamide gels (NOVEX) and stained in ethidium bromide. Bands were visualized on a UV transilluminator and digitized by Scion sci·on  
n.
1. A descendant or heir.

2. also ci·on A detached shoot or twig containing buds from a woody plant, used in grafting.
 Image 4.02 (Scion Corp, Frederick MD), and maximum optical density was determined with Gel-Pro (Media Cybernetics cybernetics [Gr.,=steersman], term coined by American mathematician Norbert Wiener to refer to the general analysis of control systems and communication systems in living organisms and machines. , Silver Spring, MD). We estimated the amount of target p120 mRNA from a simple linear regression Simple linear regression

A regression analysis between only two variables, one dependent and the other explanatory.
 as the point at which the ratio of target to internal standard equaled 1. Three to four replicate PCR reactions, each containing a different concentration of internal standard, were loaded on separate gels, and optical readings were taken simultaneously. We took the value of p53 mRNA as the average of this procedure repeated in triplicate.

Western blots. Spisula embryo samples were treated as described in Kreiling et al. (17), transferred to 8% Laemmli gels normalized to 2 or 4 [micro]g total protein per lane (unless otherwise cited), and transferred with Dunn carbonate/bicarbonate/methanol buffer onto nitrocellulose (27). One set of blots was probed with a goat polyclonal antibody (1:500 or 1:1,000 dilutions) made by New England Peptide (Fitchburg, MA) to a 24-amino acid peptide sequence generated from surf clam p120. This Spisula sequence (SQAGQVVPQTTPELRQDTQPFVSQ) is also identified in Figure 1. These blots were visualized with an alkaline phosphatase-conjugated, donkey antigoat antibody used at a 1:5,000-10,000 dilution (Promega Corp., Madison, WI). Replicate blots were probed with an affinity-purified rabbit polyclonal antibody (Map53/73) (9) to a peptide sequence of Mya p53 (CACPGRDRKADERGSLPPMVSGG) shown in Figure 1. Map53/73 antibody was used at 1:1,000 dilution and visualized with alkaline phosphatase-coupled goat antirabbit antibody at a 1:7,500 dilution (Promega). In both cases, nonspecific nonspecific /non·spe·cif·ic/ (non?spi-sif´ik)
1. not due to any single known cause.

2. not directed against a particular agent, but rather having a general effect.


nonspecific

1.
 binding was blocked with 5% nonfat dry milk Noun 1. nonfat dry milk - dehydrated skimmed milk
dried milk, dry milk, milk powder, powdered milk - dehydrated milk
. Immunoreactivity and sample quantification for Western blots probed with either antibody were determined as described in Kreiling et al. (17). The signals from four to five separate embryo cultures were integrated across each time point or treatment and normalized to the maximum signal in that culture as a percentage of the maximum (set at 100).

[FIGURE 1 OMITTED]

Experimental design for p120 expression. To characterize p120 mRNA expression using quantitative RT-PCR, we cultured surf clam larvae in three groups of 600,000. Each group came from a different pair of adult surf clams and was sampled at 12, 24, 36, 48, and 72 hr after fertilization. For p120 mRNA analysis following PCB exposure, 5 million fertilized fer·til·ize  
v. fer·til·ized, fer·til·iz·ing, fer·til·iz·es

v.tr.
1. To cause the fertilization of (an ovum, for example).

2.
 oocytes were produced by in vitro fertilization with two pairs of adults. Immediately after germinal vesicle breakdown, embryos (10,000/mL) were divided into glass petri dishes containing either controls (seawater or acetone acetone (ăs`ĭtōn), dimethyl ketone (dīmĕth`əl kē`tōn), or 2-propanone (prō`pənōn), CH3COCH3 ) or 100 ppm PCBs (Aroclor 1254; Ultra Scientific, North Kingstown, RI) dissolved in acetone. The high concentration of PCBs was necessary to ensure these lipophilic agents partition their way through the rapidly dividing cell membranes of the embryos. In nature PCBs also accumulate in tissues to saturation and are present at concentrations greater than 4,000 ppm in contaminated contaminated,
v 1. made radioactive by the addition of small quantities of radioactive material.
2. made contaminated by adding infective or radiographic materials.
3. an infective surface or object.
 sediments of Buzzard's Bay, Massachusetts (28). At 5 hr after fertilization, embryos were rinsed in artificial filtered seawater and placed in 4-L aerated culture tanks. Each tank was sampled up to three times per time point at 24, 48, 72, and 96 hr after fertilization. This experiment was duplicated. For the p53, p97, and p120 protein analyses, embryos were exposed to either controls (seawater or acetone) or PCBs (1, 10, or 100 ppm) after 2 hr of development, cultured in 250-mL flasks as described in Kreiling et al. (17), and sampled at 24, 48, 72, 96, and 120 hr after fertilization.

Results

Characterization of surf clam p120. A multiple alignment of 5' and 3' surf clam p120 RACE products pins the contiguous sequence produced a 1774 bp consensus sequence that had an apparent poly(A) tail (GenBank Accession No. AF285104; GenBank, National Center for Biotechnology Information The National Center for Biotechnology Information (NCBI) is part of the United States National Library of Medicine (NLM), a branch of the National Institutes of Health. The NCBI is located in Bethesda, Maryland and was founded in 1988. , Bethesda, MD). Residues 5-573 of the deduced open reading frame (588 amino acids) aligned with the full-length squid (Loligo forbesi) p53 sequence (Figure 1). However, where squid has a stop codon, surf clam p120 continues for another 15 amino acids, within which there are two out-of-frame stop codons before the presumed poly(A) tail.

Residues 5-573 were used in a BLAST comparison of surf clam predicted protein sequence with several p53 family members (Table 2). Overall, surf clam p120 shares the most identity with soft-shell clam p53 (73%), followed by squid p73 (53%), vertebrate p63 (36-43%), and then p73 (34%). It is similarly homologous to vertebrate p53 (35-43%), but the BLAST rank and p value were lower because p53 is shorter than the surf clam sequence.

p120 aligns with several functional domains of vertebrate p53 as well as the C-terminal extension of p63, p73, and molluscan homologues (Figure 1). All evolutionarily conserved domains for p53--including the N-terminal transcriptional-activation domain (region I) and four areas within the DNA-binding domain (regions II-V)--are identified. We also located a putative nuclear localization signal A nuclear localizing sequence (NLS) is an amino acid sequence which acts like a 'tag' on the exposed surface of a protein. This sequence is used to target the protein to the cell nucleus through the Nuclear Pore Complex and to direct a newly synthesized protein into the  (KKRK in mollusks) and an oligomerization domain. Out of 19 amino acids known to be critical for either the structure or function of each domain, 18 are identical and one is conserved.

In general, the surf clam sequence is more similar to p63 and p73 than to vertebrate p53 across all conserved regions. Within the oligomerization domain, identity is 50% with squid p73 and vertebrate p63, 31% with p73, and 25% with p53. Within the C-terminal extension, the surf clam sequence clearly aligns with the SAM identified in the squid homologue, p63, and p73 [reviewed in Levrero et al. (6)]. The final 24-29 amino acids of vertebrate p53 also share significant homology within this domain. We identified a new evolutionarily conserved region (surf clam residues 562-573 called "Homo. domain" in Figure 1) in which human p63 and p73 highly resemble the molluscan sequences.

We performed a more stringent phylogenic comparison by subjecting surf clam sequence that aligned with the DNA-binding domain (residues 142-316) to a BLAST search against equal-length p53 family members (Table 2). This analysis clearly shows that surf clam p120 is most similar to the soft-shell clam and squid p73 homologues (93 and 81%, respectively), followed by vertebrate p63 (60%) and p73 (57%). Among p53s, the Spisula sequence is most similar to fish and frog sequences, followed by chicken, mouse, cow, rat, and then human.

Northern blot analysis North·ern blot analysis
n.
An electrophoretic procedure used to separate and identify RNA fragments.
. Probe I, made from the conserved region of p120, identified three mRNAs (2.5, 3.5, and 5.5 kb) in 24-hr-old surf clam embryos (Figure 2). The largest of these mRNAs was specifically recognized by Probe II, made from the last 515 bp of the 3' end of p120. The sizes of these mRNAs are consistent with the observed sizes of p53 family proteins detected by our antibodies.

[FIGURE 2 OMITTED]

Quantitative RT-PCR analysis and mRNA expression. Separate bands were easily discernible for the quantitative RT-PCR techniques (Figure 3 inset). With the stringent quantitative RT-PCR method, p120 mRNA levels varied significantly at p [less than or equal to] 0.05 between 24 and 72 hr (Figure 3, F-ratio = 9.98). Scheffe pairwise comparisons revealed a 61% and 68% significantly lower level of p120 mRNA at 48 and 72 hr, respectively, than in the 24-hr group, but no significant difference from 12 or 36 hr (p [less than or equal to] 0.05, n = 7-9). Thus, as embryos develop, p120 mRNA peaks at approximately 24 hr.

[FIGURE 3 OMITTED]

Western blot analysis West·ern blot analysis
n.
An electrophoretic procedure for separating proteins.
 and protein expression during normal development. The most prominent band detected with the goat polyclonal antibody to the surf clam homologue migrated to 120 kD (Figure 4A). This protein, which was not discernible at 24 hr, appeared at 48 hr as a very faint band and then increased temporally. Other minor bands recognized by the primary antibody followed the same general pattern of expression. A barely discernible band smaller than 30 kD is an artifact of the secondary developing antibody. Figure 4B illustrates the temporal increase in p120 levels based on four blots. p120 protein levels increased by 29% between 48 and 72 hr after fertilization and by 72% and 70%, respectively, from 72 hr to 96 and 120 hr (S-N-K pairwise comparisons, p [less than or equal to] 0.05). p120 protein levels remained unchanged between 96 and 120 hr after fertilization.

[FIGURE 4 OMITTED]

Detected by the rabbit antibody Map53/73, surf dam p53 and p97 levels did not change during the developmental time course (see below). Map53/73 rabbit antibody did not detect a 73- or 120-kD band in surf clam embryos. Cross-reaction with p120 does not occur because the sequence used to generate Map53/73 differed significantly between the two clam species Mya and Spisula (Figure 1).

Western blot analysis and protein expression in adult tissue. We determined in separate experiments with the rabbit Map53/73 antibody that p73 is detected in adult surf clam striated muscle striated muscle
n.
Skeletal, voluntary, and cardiac muscle, distinguished from smooth muscle by transverse striations of the fibers.


Striated muscle 
, smooth muscle, and foot, but not in embryos (Figure 5). This antibody also recognized a protein at about 51 kD in adult surf dam gill and foot as well as one migrating at an even lower molecular weight in embryos. Using the goat surf clam p120 antibody, we found that p120 is expressed in embryos but not adults (Figure 5).

[FIGURE 5 OMITTED]

p120 responsiveness to PCB exposure. Early PCB exposure (100 ppm) significantly decreased p120 mRNA levels relative to the acetone control (Figure 6A; F-ratio = 6.73) for all time points except 24 hr (Scheffe test, p [less than or equal to] 0.05, n = 5-8). The decrease averaged 86% at 48 and 72 hr and 67% at 96 hr. The Western blot using the goat anti-Spisula p120 reagent shows that the p120 protein levels were not discernible at 24 hr after fertilization and remained unchanged with PCB treatment at 48 hr (Figure 6B). At 72 hr, p120 levels were a significant 60-70% lower at 10 or 100 ppm than at 0 or 1 ppm treatment (S-N-K comparison, p [less than or equal to] .05, n = 6). p120 levels did not, differ between 0 and 1 ppm or between 10 and 100 ppm. At 96 hr, p120 levels did not differ between 0 and 1 ppm and were not discernible at 10 and 100 ppm.

[FIGURE 6 OMITTED]

As Figure 6C shows, p53 protein levels remained constant throughout both the normal time course and after PCB exposure. p97 levels also remained constant throughout the normal development, but showed a significant dose-dependent decrease with PCB exposure at 96 hr after fertilization (F-ratio = 7.48). Relative to the acetone control, this decrease was 3.5% ([+ or -] 0.4%) at 1 ppm (insignificant), 45.2% ([+ or -] 3.8%) at 10 ppm, and 45.5% ([+ or -] 5.3%) at 100 ppm (S-N-K pairwise comparisons, [+ or -] standard deviation In statistics, the average amount a number varies from the average number in a series of numbers.

(statistics) standard deviation - (SD) A measure of the range of values in a set of numbers.
, n = 5). The latter two did not significantly differ from each other but both differed from the control and 1 ppm (p [less than or equal to] 0.05).

Relationship between p120 mRNA and protein. Average mRNA and protein levels taken from control groups used in the PCB experiments were compared with each other (Figure 7). A simple regression analysis revealed a strong and significant linear inverse relationship (y = -0.0005x [+ or -] 161.97, [R.sup.2] = 0.97), with mRNA decreasing as protein increased. Thus, p120 is probably regulated at the translational level.

[FIGURE 7 OMITTED]

Discussion

Differential expression of surf clam p53 family members. Based on protein expression patterns, we investigated three p53 family members (p53, p97, and p120) in surf clam embryos. We also sequenced, cloned, and characterized p120 and followed its mRNA expression during development, p73, which is detectable in soft-shell clams (Mya arenaria) (9,11), is not found in surf clam embryos, but is present in adults. Given the molecular and protein data, surf clams appear to have at least four p53 homologues (p53, p73, p97, and p120), p53 and p97 occur in both embryos and adults, whereas p73 is found only in adults and p120 is specifically embryonic (Figure 5). Because there is quite a bit of selective translation and adenylation of mRNAs during early development in surf clams (29,30), p120 mRNA may translate into a smaller homologue in adults. This remains to be determined, particularly in light of the protein migrating at 51 kD in some adult tissues and at an even lower molecular weight in embryos (Figure 5). Our assumption is that this protein, at least in adult tissue, is p51 (5).

Unlike surf clam p53, which remains at relatively high and constant levels throughout early development and following PCB exposure, embryonic p120 is temporally expressed and responds to PCBs as early as 48 hr after fertilization. In contrast, p97, like p53 is constitutively expressed, but unlike p53, responds to PCBs at 96 hr. Thus surf clam p53 family members are not only differentially expressed during normal development, but are also differentially responsive following exposure to an environmental stressor. In addition, the reduction in p120 at 48 hr and beyond corresponds with the phenotypic expression of PCB-induced toxicity in surf clams, a reduced serotonergic nervous system (17).

p53, p73, and p97 have been recently described in adult Mya tissue (9,11). Based on sequence information, Mya p53 appears to be a truncated form of p73, suggesting both are splice variants of the same gene. This is similar to vertebrate p63 and p73, both of which are alternatively spliced into several functional, differentially expressed isoforms (6,7). It is interesting to note that in human myeloid leukemia myeloid leukemia
n.
See myelogenous leukemia.
, only one p73 splice variant (p73 epsilon) is expressed in leukemia cells (31). Similarly, in soft-shell clams p73, but not p53, is upregulated in leukemia cells (9). We have yet to determine whether the three embryonic surf clam mRNAs identified by the Northern blots are the products of distinct genes or splice variants of one or more genes.

p120, a novel invertebrate p53 family member specifically expressed in embryos. This is the first study to characterize the expression of molluscan p53 homologues during embryogenesis. To do so, we cloned and partially sequenced p120. This surf clam homologue is the largest (5.5 kb) of three mRNAs expressed in embryos (Figure 2) and likely encodes a protein (p120) migrating at 120 kD. The significant inverse linear relationship ([R.sup.2] = 0.97) during development between the homologue's mRNA and p120 levels, the fact that the 5.5 kb mRNA translates into a 120-kD protein, and the significant depletion of both p120 mRNA and protein after PCB exposure provide compelling evidence that p120 is a product of the gene that we partially sequenced. Together, our data suggest that the full-length cDNA contains additional sequence at the 3' end.

Two distinct regions characterize surf clam p120 (Figure 1): a p53-like domain (residues 5-386) that is highly conserved across all homologues, and an extended C-terminus (residues 393-573) similar to that found in other mollusks as well as vertebrate p63 and p73. All p53 family members closely resemble each other across the DNA-binding domain (Figure 1). Within this region surf clam p120 is highly homologous with other molluscan p53-like proteins and more similar to vertebrate p63 and p73 than p53 (Table 2). Among vertebrates it most resembles frog and fish p53, followed by chicken, then mammals. These data support the hypothesis that vertebrate p53 more recently evolved from a p63-/p73-like relative and also suggests that p120 is a precursor to all three homologues. Studying the regulation of p120 and its function is therefore critically important in understanding how environmental contaminants interfere with embryo development.

The DNA-binding domain of p53 includes four evolutionarily conserved regions (II, III, IV, and V; Figure 1) that contain most hot spots hot spots

acute moist dermatitis.
 for p53 mutations in vertebrate tumors (32). These regions are similarly conserved in mollusks and all except one of the amino acids that contact the DNA are identical. Amino acids that help maintain the structure of the DNA-binding domain and coordinate the zinc atom (32) are the same in all molluscan and vertebrate p53 homologues. From this primary sequence information we predict that the p120 DNA-binding domain folds into a structure that resembles all p53 family members.

Several other domains important to p53 function are present. The N-terminal activation domain (also called region I) is highly conserved among vertebrate p53s and includes sequences that form a complex with Mdm2, a protein that negatively regulates p53 transcription (33). Amino acids identified as important for transcriptional activation and Mdm2 binding (34) are conserved across all three molluscan species and in both splice variants of the soft-shell clam homologue (Figure 1). This suggests that molluscan p120 transcription is activated and regulated similarly to vertebrate p53. However, to our knowledge an Mdm2 homologue has not yet been identified or sequenced in mollusks. In other invertebrates, a hypothetical protein that shares strong identity with mammalian Mdm2 has been sequenced in the nematode nematode
 or roundworm

Any of more than 15,000 named and many more unnamed species of worms in the class Nematoda (phylum Aschelminthes). Nematodes include plant and animal parasites and free-living forms found in soil, freshwater, saltwater, and even vinegar
 Caenorhabditis elegans (35) and in proteins that inhibit cell death, but do not share high homology with Mdm2 identified in fruit flies, Drosophila Drosophila: see fruit fly.
drosophila

Any member of about 1,000 species in the dipteran genus Drosophila, commonly known as fruit flies but also called vinegar flies. Some species, particularly D.
 melanogaster (36).

There is also a conserved nuclear localization signal, implying that p120 is a nuclear protein. In addition, surf clam p120 contains a conserved sequence required for oligomerization of p53 (37). The glycine glycine (glī`sēn), organic compound, one of the 20 amino acids commonly found in animal proteins. Glycine is the only one of these amino acids that is not optically active, i.e.  residue that stabilizes this structure is completely conserved across all analyzed molluscan and vertebrate homologues (Figure 1).

The functional divergence of p63 and p73 from p53 is most likely determined by sequences unique to the C-terminus. This hypothesis is supported by the recent discovery of a SAM within the C-terminal extensions of p63, p73, and molluscan p73 [reviewed by Levrero et al. (6)]. SAM is important for protein interaction and is involved in developmental regulation (8). Surf clam p120 and the recently described soft-shell clam p73 (9) also contain this motif (Figure 1). In addition, we have identified a new conserved region at the 3' end of all vertebrate and invertebrate homologues. Taken together, the high degree of similarity between surf clam p120, p63, and p73 across the DNA-binding and oligomerization domains and the presence of a SAM motif within an extended C-terminal region suggest that the surf clam gene product plays a role in regulating development.

p120 expression during normal development. Surf clam p120 mRNA levels are highest between 12 and 36 hr after fertilization and significantly decrease at 48 and 72 hr after fertilization (Figure 3). Between 24 and 96 hr after fertilization, p120 mRNA levels decrease, whereas those of the protein increase, leading to a significant inverse relationship (Figures 4 and 7). This suggests p120 levels are translationally regulated, as has been shown for other proteins important in development [e.g., sea urchin tubulin tubulin /tu·bu·lin/ (too´bu-lin) the constituent protein of microtubules.

tu·bu·lin
n.
A globular protein that is the structural constituent of microtubules.
, (38) and tetkin A (39)]. Interestingly, p120 is exclusively embryonic (Figure 5), and unlike p120, both p53 and p97 protein remain constant throughout early development (controls in Figure 6C). It is interesting to note that the p53 homologue in frogs (referred to as p53) has mRNA and protein levels that show the same inverse relationship as surf clam p120 during early development (40). Frog p53 mRNA levels are highest in developing oocytes and gradually decrease until they are undetectable at neurulation Neurulation

The process by which the vertebrate neural tube is formed. The primordium of the central nervous system is the neural plate, which arises at the close of gastrulation by inductive action of the chorda-mesoderm on the overlying ectoderm.
. Frogs rely on this oocyte mRNA to maintain constant protein levels, at least until the tadpole tadpole, larval, aquatic stage of any of the amphibian animals. After hatching from the egg, the tadpole, sometimes called a polliwog, is gill-breathing and legless and propels itself by means of a tail.  stage. A fruit fly p53 homologue also has a maternal component and is expressed at highest levels during early embryogenesis, but remains throughout development (41). A requirement for maternal p53 mRNA is not found in mice, in which p53 levels and activity are high in the nervous system until the CNS See Continuous net settlement.

CNS

See continuous net settlement (CNS).
 matures, after which there is a decline [reviewed by Choi and Donehower (3)].

High p53 mRNA levels in frog oocytes have led to the hypothesis that there is a stage early in frog development that differs from mice and requires p53 (42). We do not yet know whether surf clams rely on maternal p120 mRNA. However, there was a slight peak in p120 mRNA levels at 24 hr after fertilization (Figure 3B), which we have shown to be a critical stage in surf clam development. At this time the serotonergic and dopaminergic dopaminergic /do·pa·min·er·gic/ (do?pah-men-er´jik) activated or transmitted by dopamine; pertaining to tissues or organs affected by dopamine.

do·pa·mi·ner·gic
adj.
 systems first appear (17,21) and a ryanodine response develops (20). There is also a primitive neural plexus that coordinates mouth and velum velum /ve·lum/ (ve´lum) pl. ve´la   [L.] a covering structure or veil.ve´lar

velum interpo´situm ce´rebri  membranous roof of the third ventricle.
 movement, and the shell gland begins producing material for the bivalve bivalve, aquatic mollusk of the class Pelecypoda ("hatchet-foot") or Bivalvia, with a laterally compressed body and a shell consisting of two valves, or movable pieces, hinged by an elastic ligament.  shell (17,21).

Responsiveness to an environmental stressor (PCBs). Early PCB exposure significantly decreases p120 protein and mRNA levels as well as p97 protein, whereas p53 protein levels remain high and unchanged (Figure 6). Early PCB exposure also does not alter Hsp70 levels in Spisula embryos (17), indicating that the reduction in p120 does not reflect a general stress response. No change in p120 occurs at 24 hr after fertilization, but by 48 and 72 hr after fertilization there is a significant 86% decrease in p120 mRNA followed by a 67% decrease at 96 hr (Figure 6A). PCB-induced changes in p120 protein lagged behind the mRNA and were not significant until 72 hr (Figure 6B). At both 72 and 96 hr after fertilization, there was a significant reduction in p120 levels at both the 10 and 100 ppm level of exposure. Together, these data show that p120 responds to an environmental neurotoxin neurotoxin /neu·ro·tox·in/ (noor´o-tok?sin) a substance that is poisonous or destructive to nerve tissue.

neu·ro·tox·in
n.
See neurolysin.
 early in development, within 48 hr of fertilization, and that the protein levels are not compromised until 72 hr. Interestingly, p97 protein was also significantly reduced by PCB exposure, but not until 96 hr (Figure 6C).

PCBs are globally distributed environmental contaminants that collect in sediments to concentrations of 4,000 ppm or greater (28). These lipophilic chemicals easily accumulate in plant and animal tissues with filter feeders such as bivalves concentrating up to 100,000 times more PCBs than are present in water (43). A mutant form of p53 occurs in leukemic clams taken from PCB-contaminated sites (13). Developing larvae are particularly at risk because up to 50% of the PCB burden of an animal can be redistributed to the gonad gonad /go·nad/ (go´nad) a gamete-producing gland; an ovary or testis.gonad´algonad´ial

indifferent gonad  the sexually undifferentiated gonad of the early embryo.
 during oogenesis (44). In our study we exposed early embryos to Aroclor 1254, a defined mixture of ortho-substituted (noncoplanar) and coplanar co·pla·nar  
adj.
Lying or occurring in the same plane. Used of points, lines, or figures.



copla·nar
 PCBs. ortho-Substituted PCBs are thought to impact neuronal development by changing intracellular calcium levels released from either ryanodine or IP3-regulated stores, altering neurotransmitter concentrations in the brain [reviewed by Tilson and Kodavanti (45) and Seegal (46)]. Coplanar PCBs bind to the aromatic hydrocarbon receptor that can lead to a cascade of events resulting in free radical production and DNA damage (47). DNA damage contributes to the multifactorial multifactorial /mul·ti·fac·to·ri·al/ (mul?te-fak-tor´e-al)
1. of or pertaining to, or arising through the action of many factors.

2.
 process leading to cancer and may explain the high levels of leukemia in soft-shell clams from PCB-contaminated sites (48).

Chemical inducers of DNA damage normally increase p53 levels to induce apoptosis, whereas only a few (e.g., cisplatin cisplatin /cis·plat·in/ (sis´plat-in) DDP; a platinum coordination complex capable of producing inter- and intrastrand DNA crosslinks; used as an antineoplastic.

cis·plat·in
n.
, taxol) increase p73 expression [reviewed by Levrero et al. (6) and Strano et al. (7)]. However, recent evidence shows that at least one vertebrate p73 splice variant ([DELTA]N-p73) decreases with DNA damage in nerve cells to counter p53-mediated apoptosis (49). Furthermore, this decrease in [DELTA]N-p73 follows withdrawal of nerve growth factor nerve growth factor
n. Abbr. NGF
A protein that stimulates the growth of sympathetic and sensory nerve cells.


Nerve growth factor 
 (NGF NGF
abbr.
nerve growth factor



NGF

nerve growth factor.
). Molluscan nerve cells also respond to NGF (50). PCBs are known to alter the NGF neurotrophic system in pheochromocytoma Pheochromocytoma Definition

Pheochromocytoma is a tumor of special cells (called chromaffin cells), most often found in the middle of the adrenal gland.
 cells (51), suggesting that the PCB-induced decrease in surf clam serotonergic cells involves both p120 and NGF, and possibly p97.

The PCB data show that surf clam p120 responds to environmental perturbation perturbation (pŭr'tərbā`shən), in astronomy and physics, small force or other influence that modifies the otherwise simple motion of some object. The term is also used for the effect produced by the perturbation, e.g. . We have yet to determine if the two other mRNAs identified by Northern blot analysis arise from distinct p53 homologue genes or are shortened versions of p120. As in mammals, these homologues may perform distinct functions during development, following chemical exposure, and possibly after exposure to different types of PCB congeners. We also plan to determine whether decreased p120 levels and function are restricted to the nervous system. Because we have shown in separate experiments that PCBs target neuronal growth in surf clams (16, 17) and that the time course of this reduction is the same for both p120 and the serotonergic system, we hypothesize hy·poth·e·size  
v. hy·poth·e·sized, hy·poth·e·siz·ing, hy·poth·e·siz·es

v.tr.
To assert as a hypothesis.

v.intr.
To form a hypothesis.
 that the developing nervous system is most sensitive to changes in p120.
Table 1. Primers used to identify surf clam p120 (degenerate, RACE,
and contiguous), generate probes for Northern blot analysis, make
an internal RNA standard, and perform quantitative RT-PCR.

Primers                   Forward (5' to 3') (a)

Degenerate            DegF: CATGCIGGIWCWGARTGG
RACE                  GspF: CCTGTTCCAGTTCATGTGCCTTGG
Contiguous            1F: GGCTTCCAGGAAAAATGTCCG
Probes
  Probe I             2F: ATTACCCAGGCGATTATGGG
  Probe II            4F: CAGGTGGAAGTCCAAAGGC
Internal standard
  Mutation            MutF: CCACCAACACAAGAGCCAAGGC
  Isolation           IsF: CAGGCGGGGACTGAGTGG
  T7/Poly T tail      Tprom: TAATACGACTCACTATAGGCAG
                      GCGGGGACTCAGTGGGTC

Quantitative RT-PCR   QuantF: CAAACCTGTTCCAGTTCATGTG

Primers                   Reverse (5' to 3') (a)

Degenerate            DegR: GGRCAIGCRCAKATICKWACYTC
RACE                  GspR: CACAATCTGGAGTGGCCTTCTG
Contiguous            5R: GTCGGAGGGGACAGTTCTTG
Probes
  Probe I             QuantR (see below)
  Probe II            5R (see above)
Internal standard
  Mutation            MutR: AGGCCACTCCAGATTGTGTTCAC
  Isolation           IsR: GGGCAGGCGCAGATGCGTACCTC
  T7/Poly T tail      Tpoly: [T.sub.18]GCAGGCGCAGATGCGTACCTC

Quantitative RT-PCR   QuantR: CATCGTCTACCCAATACCTGG

Primers               Size (bp)

Degenerate                  163
RACE                         69
Contiguous                1,774
Probes
  Probe I                   501
  Probe II                  574
Internal standard
  Mutation                4,057
  Isolation                 163
  T7/Poly T tail            199

Quantitative RT-PCR   114 & 102

(a) W = A/T; R = A/G; K = G/T; Y = C/T; I = inosine.
Table 2. Comparison of the deduced surf clam p120 amino acid
sequence with other invertebrate p53 homologues and vertebrate
p53, p63, and p73.

                                                   Accession
Common name, species                    Length     number (a)

Invertebrates
  Soft-shell clam, Mya arenaria          621     AF253323 (G)

  Squid, Loligo forbesi                  564     AAA98563.1 (G)

Mammalian p63
  Human, Homo sapiens                    680     CAA76562 (E)

  Norwegian rat, Rattus norvegicus       680     CAB88216 (E)

  Mouse, Mus musculus                    586     AB010152 (G)

Vertebrate p73
  Human, H. sapiens                      636     AAD39696.1 (G)

  Barbel (fish), Barbus barbus           641     AF043641.1 (G)

  Mouse, M. musculus                     497     AF138873 (G)

Vertebrate p53
  Barbel (fish), B. barbus               369     AF071570.1 (G)

  Zebra fish, Danio rerio                373     AAB64176 (G)

  Chicken, Gallus gallus                 367     P10360 (S)

  African clawed frog, Xenopus laevis    361     CAA54672.1 (E)

  Mouse, M. musculus                     389     CAA25323 (G)

  Norwegian rat, R. norvegicus           391     P10361 (S)

  Cow, Bos taurus                        386     Q29628 (S)

  Human, H. sapiens                      393     AF135121 (G)

                                         Residues     Residues
                                        5-573 (b)    142-316 (c)
Common name, species                    (p-values)   (p-values)

Invertebrates
  Soft-shell clam, Mya arenaria            73%           93%
                                         p = 0.0      p = 9e-99
  Squid, Loligo forbesi                    53%           81%
                                        p = 3e-161    p = 3e-84
Mammalian p63
  Human, Homo sapiens                      36%           60%
                                        p = 3e-94     p = 3e-54
  Norwegian rat, Rattus norvegicus         36%           60%
                                        p = 5e-92     p = 3e-54
  Mouse, Mus musculus                      38%           60%
                                        p = 1e-87     p = 3e-54
Vertebrate p73
  Human, H. sapiens                        34%           57%
                                        p = 2e-86     p = 1e-52
  Barbel (fish), Barbus barbus             34%           57%
                                        p = 1e-82     p = 2e-52
  Mouse, M. musculus                       34%           57%
                                        p = 3e-64     p = 9e-48
Vertebrate p53
  Barbel (fish), B. barbus                 43%           50%
                                        p = 3e-59     p = 8e-41
  Zebra fish, Danio rerio                  40%           47%
                                        p = 2e-57     p = 9e-40
  Chicken, Gallus gallus                   39%           46%
                                        p = 7e-52     p = 4e-40
  African clawed frog, Xenopus laevis      38%           48%
                                        p = 3e-50     p = 9e-48
  Mouse, M. musculus                       36%           45%
                                        p = 1e-47     p = 2e-37
  Norwegian rat, R. norvegicus             36%           42%
                                        p = 3e-47     p = 1e-35
  Cow, Bos taurus                          38%           44%
                                        p = 7e-53     p = 6e-39
  Human, H. sapiens                        35%           41%
                                        p = 4e-46     p = 9e-36

(a) Accession numbers are from GenBank (G), EMBL (E), and
SwissProt (S).

(b) Align with the full-length squid transcript.

(c) Comprise the conserved DNA-binding domain and provide a
more stringent phylogenetic comparison because the sequences
were of the same length.


REFERENCES AND NOTES

(1.) Levine AJ. p53, the cellular gatekeeper for growth and division. Cell 88:323-331 (1997).

(2.) Nigro JM, Baker SJ, Preisinger AC, Jessup JM, Hostetter R, Cleary K, Bigner SH, Davidson N, Baylin S, Devilee P. Mutations in the p53 gene occur in diverse human tumour types. Nature 342:705-708 (1989).

(3.) Choi J, Donehower LA. p53 in embryonic development: maintaining a fine balance. Cell Mol Life Sci 55:38-47 (1999).

(4.) Komarova EA, Chernov MV, Franks R, Wang K, Armin G, Zelnick CR, Chin DM, Bacus SS, Stark GR, Gudkov AV. Transgenic mice with p53-responsive lacZ: p53 activity varies dramatically during normal development and determines radiation and drug sensitivity in vivo in vivo /in vi·vo/ (ve´vo) [L.] within the living body.

in vi·vo
adj.
Within a living organism.



in vivo adv.
. EMBO J 16(6):1391-1400 (1999).

(5.) Kaelin WG Jr. The p53 gene family. Oncogene oncogene

Gene that can cause cancer. It is a sequence of DNA that has been altered or mutated from its original form, the proto-oncogene (see mutation). Proto-oncogenes promote the specialization and division of normal cells.
 18(53):7701-7705 (1999).

(6.) Levrero M, De Laurenzi V, Costanzo A, Sabatini S, Gong J, Wang JWJ JWJ Jobs with Justice , Melino G. The p53/p63/p73 family of transcription factors: overlapping and distinct functions. J Cell Sci 113:1661-1670 (2000).

(7.) Strano S, Rossi M, Fontemaggi G, Munarriz E, Soddu S, Sacchi A, Blandino G. From p63 to p53 across p73. FEBS FEBS Federation of European Biochemical Societies  Lett 490(3):183-170 (2001).

(8.) Schultz J, Ponting CP, Hofmann K, Bork P. SAM as a protein interaction domain involved in developmental regulation. Protein Sci 6(1):249-253 (1997).

(9.) Kelley ML, Winge P, Heaney JD, Stephens RE, Farrell JH, Van Beneden RJ, Reinisch CL, Lesser MP, Walker CW. Expression of homologues for p53 and p73 in the soft-shell clam (Mya arenaria), a naturally-occurring model for human leukemia. Oncogene 20(6):748-758 (2001).

(10.) Winge P, Friend S, Fleming JT. Direct submission to EMBL EMBL European Molecular Biology Laboratory
EMBL Eniwetok Marine Biological Laboratory
, Accession No. U43595 (1996). Available: http://srs.ebi.ac.uk/srs6bin/cgi-bin/wgetz?newld+ [{EMBL%20EMBLNEW}-AllText:U43595*]+lv+30+-view+SeqSimpleView [cited 29 January 2002].

(11.) Stephens RE, Walker CW, Reinisch CL. Multiple protein differences distinguish clam leukemia cells from normal hemocytes: evidence for the involvement of p53 homologues. Comp Biochem Physiol Part C, 129:329-338 (2001).

(12.) Van Beneden RJ, Walker CW, Laughner ER. Characterization of gene expression of a p53 homologue in the soft-shell clam (Mya arenaria). Mol Mar Biol Biotechnol 6(2):116-122 (1997).

(13.) Barker CM, Calvert RJ, Walker CW, Reinisch CL. Detection of mutant p53 in clam leukemia cells. Exp Cell Res 232:240-245 (1994).

(14.) Lesser MP, Farrell JH, Walker CW. Oxidative stress oxidative stress,
n an imbalance of the prooxidant antioxidant ratio in which too few antioxidants are produced or ingested or too many oxidizing agents are produced.
, DNA damage and p53 expression in the larvae of atlantic cod (Gadus morhua) exposed to ultraviolet (290-400 nm) radiation. J Exp Biol 204:157-164 (2001).

(15.) Oakley GG, Devanaboyina U, Robertson LW, Gupta RC. Oxidative DNA damage induced by activation of polychlorinated biphenyls (PCBs): implications for PCB-induced oxidative stress in breast cancer. Chem Res Toxicol 9(8):1285-1292 (1996).

(16.) Smith CR, Barker CM, Barker LF, Jessen-Eller K, Reinisch CL. Polychlorinated biphenyls (PCBs) selectively disrupt serotonergic cell growth in the developing Spisula embryo. Toxicol Sci 50:54-63 (1999).

(17.) Kreiling JA, Stephens RE, Kuzirian AM, Jessen-Eller K, Reinisch CL. Polychlorinated biphenyls are selectively neurotoxic in the developing Spisula solidissima embryo. J Toxicol Environ Health Part A 61, (8):657-675 (2000).

(18.) Jacobson JL, Jacobson SW. Intellectual impairment in children exposed to polychlorinated biphenyls in utero in utero (in u´ter-o) [L.] within the uterus.

in u·ter·o
adj.
In the uterus.



in utero adv.
. N Engl J Med 335(11):783-789 (1996).

(19.) Longo FJ, Mathews L, Palazzo RE. Sperm nuclear transformations in cytoplasmic cytoplasmic

pertaining to or included in cytoplasm.


cytoplasmic inclusions
include secretory inclusions (enzymes, acids, proteins, mucosubstances), nutritive inclusions (glycogen, lipids), pigment granules (melanin, lipofuscin,
 extracts from surf clam (Spisula solidissima) oocytes. Dev Biol 162(1):245-258 (1994).

(20.) Jessen-Eller K, Steele M, Reinisch C, Spitzer N. Blockade of ryanodine receptors stimulates neurite outgrowth in embryos of Spisula solidissima. Biol Bull 195:206-207 (1998).

(21.) Kreiling JA, Jessen-Eller K, Miller J, Seegal RF, Reinisch CL. Early development of the serotonergic and dopaminergic nervous system in Spisula solidissima (surf clam) larvae. Comp Biochem Physiol Part A, 130:341-351 (2001).

(22.) Winge P, Fleming JT, Walker CW. Direct submission to EMBL, Accession No. U45238 (1996). Available: http://srs.ebi.ac.uk/srs6bin/cgi-bin/wgetz?-newld+ [{EMBL%20EMBLNEW}-AllText:U45238*]+-lv+30+view+SeqSimpleView [cited 29 January 2002].

(23.) Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment A multiple sequence alignment (MSA) is a sequence alignment of three or more biological sequences, generally protein, DNA, or RNA. In general, the input set of query sequences are assumed to have an evolutionary relationship by which they share a lineage and are descended from a  through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Nucleic acids
The cellular molecules DNA and RNA that act as coded instructions for the production of proteins and are copied for transmission of inherited traits.
 Res 22:4673-4680 (1994).

(24.) Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST PSI-BLAST Position Specific Iterated Basic Local Alignment Search Tool : a new generation of protein database search programs. Nucleic Acids Res 25:3389-3402 (1997).

(25.) Jessen-Eller K, Picozza E, Crivello JF. Quantitation of metallothionein mRNA by RT-PCR and chemiluminescence chemiluminescence /chemi·lu·mi·nes·cence/ (kem?i-loo?mi-nes´ens) luminescence produced by direct transformation of chemical energy into light energy. . Biotechniques 17:962-973 (1994).

(26.) Vanden Heuvel JP, Tyson FL, Bell DA. Construction of recombinant RNA templates for use as internal standards in quantitative RT-PCR. Biotechniques 14(3):395-398 (1993).

(27.) Dunn SD. Effects of the modification of transfer buffer composition and the renaturation renaturation

the reassembly of a protein or nucleic acid molecule after denaturation.
 of proteins in gels on the recognition of proteins on western blots by monoclonal antibodies. Anal Biochem 157:144-153 (1985).

(28.) ATSDR ATSDR Agency for Toxic Substances & Disease Registry  Public Health Assessment. New Bedford Site. Cerclis No. MAD980731335. Atlanta:Agency for Toxic Substances and Disease Registry The United States Agency for Toxic Substances and Disease Registry, (ATSDR) is an agency for the U.S. Department of Health and Human Services that is directed by a congressional mandate to perform specific functions concerning the effect on public health of hazardous , 1995.

(29.) Rosenthal ET, Ruderman JV. Widespread changes in the translation and adenylation of maternal messenger RNAs following fertilization of Spisula oocytes. Dev Biol 121(1):237-246 (1987).

(30.) Rosenthal ET, Hunt T, Ruderman JV. Selective translation of mRNA controls the pattern of protein synthesis during early development of the surf clam, Spisula solidissima. Cell 20(2):487-494 (1980).

(31.) Tschan MP, Grob TJ, Peters UR, Laurenzi VD, Huegli B, Kreuzer kreu·zer or kreut·zer  
n.
Any of several small coins of low value formerly used in Austria and Germany.



[German, from Middle High German kriuzer, from kriuze,
 K, Schmidt CA, Melino G, Fey MF, Tobler A, et al. Enhanced p73 expression during differentiation and complex p73 isoforms in myeloid leukemia. Biochem Biophys Res Commun 277(1):62-65 (2000).

(32.) Cho Y, Gorina S, Jeffrey PD, Pavletich NP. Crystal structure of a p53 tumor suppressor-DNA complex: understanding tumorigenic tu·mor·i·gen·ic
adj.
Capable of causing tumors.
 mutations. Science 265:346-355 (1994).

(33.) Freedman DA, Wu L, Levine AJ. Functions of the MDM2 oncoprotein. Cell Mol Life Sci 55(1):96-107 (1999).

(34.) Kussie PH, Gorina S, Marechal V, Elenbaas B, Moreau J, Levine AJ, Pavletich NP. Structure of the MDM2 oncoprotein bound to the p53 tumor suppressor sup·pres·sor  
n.
1. or sup·press·er One that suppresses: a suppressor of free speech.

2. A gene that suppresses the phenotypic expression of another gene, especially of a mutant gene.
 transactivation Transactivation is an increased rate of gene expression triggered either by endogenous cellular or viral proteins - transactivators. These protein factors act in trans (i.e., intermolecularly).  domain. Science 274:948-953 (1996).

(35.) Taich A. Direct submission to EMBL, Accession No. T16028 (2000). Available: http://srs.ebi.ac.uk/srs6bin/cgibin/wgetz?-newld+ [{EMBL%20EMBLNEW}-AllText:T16028*]+-lv+30+-view+SeqSimpleView [cited 29 January 2002].

(36.) Hay BA, Wassarman DA, Rubin GM. Drosophila homologs of baculovirus baculovirus

group of rod-shaped, double-stranded, DNA viruses which infect and kill a large number of different invertebrate species especially insects, including Lepidoptera, Hymenoptera, Diptera, Neuroplera, Trichoptera, Coleoptera and Homoptera, and also prawns; used as
 inhibitor of apoptosis The Inhibitors of Apoptosis (IAP) are a family of functionally- and structurally-related proteins, originally characterized in Baculovirus, which serve as endogenous inhibitors of programmed cell death (apoptosis).  proteins function to block cell death. Cell 83(7):1253-1282 (1995).

(37.) Wang P, Reed M, Wang Y, Mayr G, Stenger JE, Anderson ME, Schwedes JF, Tegtmeyer P. p53 domains: structure, oligomerization, and transformation. Mol Cell Biol 14(8):5182-5191 (1994).

(38.) Harlow P, Nemer M. Coordinate and selective [beta]-tubulin gene expression associated with cilium cilium

Short, eyelashlike filament that is numerous on tissue cells of most animals. Capable of beating in unison, cilia perform a variety of functions, including providing the means of locomotion for some protozoans, moving mammalian ova (eggs) through oviducts, generating
 formation in sea urchin embryos. Genes Der 1:1293-1304 (1987).

(39.) Norrander JM, Linck RW, Stephens RE. Transcriptional control of tektin A mRNA correlates with cilia cilia /cil·ia/ (sil´e-ah) sing. cil´ium   [L.]
1. the eyelids or their outer edges.

2. the eyelashes.

3.
 development and length determination during sea urchin embryogenesis. Development 121(8):1615-1623 (1995).

(40.) Tchang F, Gusse M, Soussi T, Mechali M. Stabilization and expression of high levels of p53 during early development in Xenopus laevis Xenopus laevis

a toad used in the test of pregnancy in women. Called also African clawed toad.
. Dev Biol 159:163-172 (1993).

(41.) Jin S, Martinek S, Joo WS, Wortman JR, Mirkovic N, Sali A, Yandell MD, Pavletich NP, Young MW, Levine AJ. Identification and characterization of a p53 homologue in Drosophila melanogaster. Proc Natl Acad Sci USA 97(13):7301-7306 (2000).

(42.) Wallingford JB, Seufert DW, Virta VC, Vize PD. p53 activity is essential for normal development in Xenopus. Curr Biol 7:747-757 (1997).

(43.) Lowe JI, Parrish PR, Patrick JM Jr, Forester J. Effects of the polychlorinated biphenyl polychlorinated biphenyl or PCB, any of a group of organic compounds originally widely used in industrial processes but later found to be dangerous environmental pollutants.  aroclor 1254 on the American oyster Crassostrea virginica. Mar Biol 17(3):209-214 (1972).

(44.) Vodicnik MJ, Peterson RE. The enhancing effect of spawning on elimination of a persistent polychlorinated biphenyl from female yellow perch. Fundam Appl Toxicol 5(4):770-776 (1985).

(45.) Tilson HA, Kodavanti PR. The neurotoxicity neurotoxicity /neu·ro·tox·ic·i·ty/ (noor?o-tok-sis´it-e) the quality of exerting a destructive or poisonous effect upon nerve tissue.  of polychlorinated biphenyls. Neurotoxicology 19(4-5):517-525 (1998).

(46.) Seegal RF. Epidemiological and laboratory evidence of PCB-induced neurotoxicity. Crit Rev Toxicol 26(6):709-737 (1996).

(47.) Safe S. Polychlorinated biphenyls (PCBs): environmental impact, biochemical and toxic responses, and implications for risk assessment. Crit Rev Toxicol 24:87-149 (1994).

(48.) Harper DM, Flessas A, Reinisch CL. Specific reactivity of leukemia cells to polyclonal polyclonal /poly·clo·nal/ (-klon´'l)
1. derived from different cells.

2. pertaining to several clones.


polyclonal

derived from different cells; pertaining to several clones.
 anti-PCB antibodies. J Invertebr Pathol 64:234-237 (1994).

(49.) Pozniak CD, Radinovic S, Yang A, McKeon F, Kaplan DR, Miller FD. An anti-apoptotic role for the p53 family member, p73, during developmental neuron death. Science 289:304-306 (2000).

(50.) Moreno H, Nadal M, Leznik E, Sugimori M, Lax I, Schlessinger J, Llinas R. Nerve growth factor acutely reduces chemical transmission by means of postsynaptic postsynaptic /post·sy·nap·tic/ (-si-nap´tik) distal to or occurring beyond a synapse.

post·syn·ap·tic
adj.
Situated behind or occurring after a synapse.
 TrkA-like receptors in squid giant synapse synapse (sĭn`ăps), junction between various signal-transmitter cells, either between two neurons or between a neuron and a muscle or gland. A nerve impulse reaches the synapse through the axon, or transmitting end, of a nerve cell, or neuron. . Proc Natl Acad Sci USA 95(25):14997-5002 (1998).

(51.) Angus WG, Contreras ML. Aroclor 1254 alters the binding of [sup.125]I-labeled nerve growth factor in PC12 cells. Neurosci Lett 191(1-2):23-26 (1995).

Kathryn Jessen-Eller, (1) Jill A. Kreiling, (1,2) Gail S. Begley, (1) Marjorie E. Steele, (1) Charles W. Walker, (3) Raymond E. Stephens, (1,4) and Carol L. Reinisch (1)

(1) Marine Biological Laboratory, Woods Hole, Massachusetts Woods Hole is a census-designated place and village within the town of Falmouth in Barnstable County, Massachusetts, at the extreme southwest corner of Cape Cod, near Martha's Vineyard and the Elizabeth Islands. , USA; (2) Department of Obstetrics and Gynecology obstetrics and gynecology

Medical and surgical specialty concerned with the management of pregnancy and childbirth and with the health of the female reproductive system.
, Brown University School of Medicine, Women and Infants Hospital, Providence, Rhode Island

“Providence” redirects here. For other uses, see Providence (disambiguation).
Providence is the capital and the most populous city of the U.S.
, USA; (3) Department of Zoology, University of New Hampshire New Hampshire, one of the New England states of the NE United States. It is bordered by Massachusetts (S), Vermont, with the Connecticut R. forming the boundary (W), the Canadian province of Quebec (NW), and Maine and a short strip of the Atlantic Ocean (E). , Durham, New Hampshire Durham is a town in Strafford County, New Hampshire, USA. The population was 12,664 at the 2000 census. Durham is home to the University of New Hampshire. History , USA; (4) Department of Physiology and Biophysics biophysics, application of various methods and principles of physical science to the study of biological problems. In physiological biophysics physical mechanisms have been used to explain such biological processes as the transmission of nerve impulses, the muscle , Boston University School of Medicine Boston University School of Medicine (BUSM) is one of the graduate schools of Boston University. It is an American medical school located in the South End neighborhood of Boston, Massachusetts. , Boston, Massachusetts, USA

Address correspondence to C.L. Reinisch, Marine Biological Laboratory, 7 MBL Street, Woods Hole, MA 02536 USA. Telephone: (508) 289-7517. Fax: (508) 540-6902. E-mail: creinisc@mbl.edu

We thank E. Czerwiec for insightful discussion, J. Dowling for early comments, R. Cox for her review, the Marine Resource Center (MBL), and Aquaculture Research (Dennis, MA).

This research was supported by NCI See Liberate.  grant 44307 to C.L. Reinisch and a Grass Fellowship to K. Jessen-Eller.

Received 29 May 2001; accepted 1 October 2001.
COPYRIGHT 2002 National Institute of Environmental Health Sciences
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2002, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Author:Reinisch, Carol L.
Publication:Environmental Health Perspectives
Date:Apr 1, 2002
Words:8474
Previous Article:Prediction of rodent nongenotoxic carcinogenesis: evaluation of biochemical and tissue changes in rodents following exposure to nine nongenotoxic NTP...
Next Article:The potential impact of flooding on confined animal feeding operations in eastern North Carolina. (Articles).



Related Articles
Cancer gene may be relatively common. (p53)
Putting a tumor suppressor back to work. (gene therapy clinical trial)
Levels of Polychlorinated Biphenyls (PCBs) in Fish: The Influence on Local Decision Making About Fish Consumption.(Statistical Data Included)
p53 as a Diagnostic Tool for the Detection of Cancer.
Assessment of pre- and postnatal exposure to polychlorinated biphenyls: lessons from the inuit cohort study.(Children's Health)
Mechanisms of benzene-induced hematotoxicity and leukemogenicity: cDNA microarray analyses using mouse bone marrow tissue.(Toxicogenomics)
Breast cancer and environmental risks: where is the link?(Practical Stuff!)
Polychlorinated biphenyls (PCBs) exert thyroid hormone-like effects in the fetal rat brain but do not bind to thyroid hormone receptors.
Bioremediation monitoring.(Perspectives / Correspondence)
Comment on "breast milk: an optimal food".(Perspectives / Correspondence)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles